When the natural RNA and the RNA of the Toehold switch meet, the switch's RNA becomes exposed and the cell starts kicking out the prescribed protein.
|
|
An RNA virus is one where the genetic material is a strand of RNA.
|
|
RNA is constantly being made and recycled inside cells, so an RNA edit is not permanent.
|
|
Ebola is an RNA virus, one that encodes its genetic material in RNA rather than DNA.
|
|
Once messenger RNA arrives at the ribosome, yet another chemical, called transfer RNA (tRNA), gets involved.
|
|
He and his colleagues call their method sci-RNA-seq (short for single-cell combinatorial indexing RNA sequencing).
|
|
To create what Zhang and his colleagues call REPAIR ("RNA editing for programmable A to I [G] replacement"), they fused an enzyme that binds to RNA with one that changes the RNA letter A (adenosine) to inosine, a molecule similar to the RNA letter G (guanosine), they report in Science.
|
|
The system allows researchers to change a single nucleoside, or RNA letter, in an RNA chain in mammalian cells.
|
|
If you edit RNA and make a mistake, for instance, the faulty RNA will be degraded likely within 24 hours.
|
|
RNA is a molecule allied to DNA, and is produced when DNA is read by an enzyme called RNA polymerase.
|
|
That means using a guide RNA to direct a CRISPR protein to search for any specific DNA or RNA sequence.
|
|
In 2018, the Food and Drug Administration approved the first therapy using RNA interference, a technique in which a small piece of RNA is inserted into a cell, binding to its native messenger RNA and hastening their degradation.
|
|
They compared samples of RNA — molecules that deliver messages in genes — from the antlers with human RNA in search of overlaps.
|
|
Micro-RNA renders messenger RNA inactive, reducing the activity of the gene in question—and it can travel in sperm alongside DNA.
|
|
Due to the predictable pairing of RNA nucleotide bases, the researchers were able to make these RNA circuits self-assemble in E.coli bacterial cells.
|
|
Hundley believes an enzyme the squid uses to edit its RNA could potentially be used in humans to make changes in human messenger RNA.
|
|
For a gene to become a protein, that gene has to be transcribed into RNA in the cell's nucleus, and the RNA is then translated into a protein in the cytoplasm or is excreted from the cell (so-called "cell-free RNA") into the bloodstream.
|
|
Cooke's team used a technology called RNA therapeutics, which delivers RNA directly into cells, to spur cells to produce telomerase, a protein that lengthens telomeres.
|
|
Things get a bit tricker when modifying RNA for CRISPR, since the modified RNA still needs to be able to interface with the Cas9 enzyme.
|
|
Cramer described RNA as the biological equivalent of middle management: the DNA gives cells orders, and RNA carries those orders to the rest of the cell.
|
|
In a cell, genetic information flows from DNA to RNA and then to proteins, with the RNA acting as a sort of arbitrar between the two.
|
|
One solution to this problem that has been explored in RNA-based medicines is to modify the RNA so that it doesn't trigger an immune response.
|
|
The transgene's RNA binds to the natural PPO-coding RNA, and the double-stranded sequence is read as a mistake and destroyed by the cell's surveillance system.
|
|
"We're using very predictable and programmable RNA-RNA interactions to define what these circuits can do," Alex Green, a bioengineer at Arizona State, said in a statement.
|
|
Importantly, the ability to use chemically modified RNA in the CRISPR system meant that a virus was no longer needed as a host for the guide RNA.
|
|
Dr. Klug was at the forefront of determining the structure of transfer RNA, a type of RNA molecule that helps decode the instructions for producing a protein.
|
|
Qiagen, a Netherlands-based company that makes the RNA-extracting kits, has said it's ramping up production of its RNA extraction kits in response to the shortage.
|
|
"Looking forward, this tool will be very useful for studying RNA biology in the near term and hopefully for treating RNA-related diseases in the future," he said.
|
|
The idea behind the new RNA circuits is to only trigger protein synthesis when the RNA circuit registers a specific base pair matching as dictated by its programming.
|
|
By correcting problematic mutations to the letters that encode RNA, scientists could potentially reverse mutations without causing permanent change to the genome, since RNA degrades naturally over time.
|
|
ASOs are strands of nucleic acids—the same stuff as DNA and RNA—that can zipper up with RNA to either stop or enhance its protein-building activity.
|
|
The RNA editing in the squid axon demonstrated in Rosenthal's paper is analogous to the RNA editing that would need to occur in the cytoplasm for human therapies.
|
|
For a gene to become a protein, that gene has to be transcribed into RNA in the cell, and the RNA is then read to make the protein.
|
|
When a virus invades cells, the cells cut up some of the invader's RNA, making short pieces of double-stranded RNA that they use to recognize that virus in the future.
|
|
RNA possesses the unique ability to pass along genetic information and self-replicate, leading many researchers to suspect that the earliest forms of life on Earth were in fact RNA-based.
|
|
That means using a guide RNA to direct a CRISPR protein to search for any specific DNA or RNA sequence and it could be used to shape the future of bio research.
|
|
The details: According to the patent, the compositions can be used in animal or human cells, and can work as either 2 separate pieces of RNA or a single piece of RNA.
|
|
That makes RNA a tantalizing target: By editing the errant orders (RNA) rather than their issuer (DNA), scientists might be able to make temporary, reversible genetic edits, rather than CRISPR's permanent ones.
|
|
The RNA of the switch is capable of inducing the cell to create a specific protein, but first it has to match with complementary RNA that already exists naturally within the cell.
|
|
This chain of RNA is then transported outside of the cell's nucleus that is the DNA's permanent home, where it the RNA is used as a sort of instruction manual for building proteins.
|
|
And this is a vital ingredient of RNA and DNA.
|
|
If that bit of RNA fails, women produce extra proteins.
|
|
That means the guide RNA can no longer recognise it.
|
|
These two RNA then join with a protein called Cas9.
|
|
The second paper, published in Science, involves RNA more directly.
|
|
For some diseases, though, editing RNA could offer a workaround.
|
|
It can be programmed with a short piece of RNA.
|
|
Additionally the article gave an incorrect description of small RNA.
|
|
One of the things we like is this RNA concept.
|
|
RNA replication is the copying of one RNA to another. Many viruses replicate this way. The enzymes that copy RNA to new RNA, called RNA-dependent RNA polymerases, are also found in many eukaryotes where they are involved in RNA silencing. RNA editing, in which an RNA sequence is altered by a complex of proteins and a "guide RNA", could also be seen as an RNA-to-RNA transfer.
|
|
Riboviria is a realm of viruses that includes all viruses that use an RNA- dependent polymerase for replication. It includes RNA viruses that encode an RNA-dependent RNA polymerase; and, it includes reverse-transcribing viruses (with either RNA or DNA genomes) that encode an RNA-dependent DNA polymerase. RNA-dependent RNA polymerase (RdRp), also called RNA replicase, produces RNA (ribonucleic acid) from RNA. RNA-dependent DNA polymerase (RdDp), also called reverse transcriptase (RT), produces DNA (deoxyribonucleic acid) from RNA.
|
|
RNA synthesis is catalyzed by the BVDV RNA-dependent RNA polymerase (RdRp). This RdRp can undergo template strand switching allowing RNA-RNA copy choice recombination during elongative RNA synthesis.Kim MJ, Kao C. Factors regulating template switch in vitro by viral RNA-dependent RNA polymerases: implications for RNA-RNA recombination. Proc Natl Acad Sci U S A. 2001 Apr 24;98(9):4972-7.
|
|
This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription.
|
|
According to the length of RNA chain, RNA includes small RNA and long RNA. Usually, small RNAs are shorter than 200 nt in length, and long RNAs are greater than 200 nt long. Long RNAs, also called large RNAs, mainly include long non-coding RNA (lncRNA) and mRNA. Small RNAs mainly include 5.8S ribosomal RNA (rRNA), 5S rRNA, transfer RNA (tRNA), microRNA (miRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNAs), Piwi-interacting RNA (piRNA), tRNA-derived small RNA (tsRNA) and small rDNA-derived RNA (srRNA).
|
|
RNA-dependent RNA polymerase (RdRP, RDR) or RNA replicase is an enzyme that catalyzes the replication of RNA from an RNA template. Specifically, it catalyses synthesis of the RNA strand complementary to a given RNA template. This is in contrast to typical DNA-dependent RNA polymerases, which all organisms use to catalyze the transcription of RNA from a DNA template. RdRP is an essential protein encoded in the genomes of all RNA-containing viruses with no DNA stage, i.e.
|
|
RNA viruses have genomes made of ribonucleic acid (RNA) and comprise three groups: double-stranded RNA (dsRNA) viruses, positive sense single-stranded RNA (+ssRNA) viruses, and negative sense single-stranded RNA (-ssRNA) viruses. RNA viruses are classified in the kingdom Orthornavirae in the realm Riboviria.
|
|
Three forms of RNA are made; circular genomic RNA, circular complementary antigenomic RNA, and a linear polyadenylated antigenomic RNA, which is the mRNA containing the open reading frame for the HDAg. Synthesis of antigenomic RNA occurs in the nucleolus, mediated by RNA polymerase I, whereas synthesis of genomic RNA takes place in the nucleoplasm, mediated by RNA polymerase II. HDV RNA is synthesized first as linear RNA that contains many copies of the genome. The genomic and antigenomic RNA contain a sequence of 85 nucleotides, the hepatitis delta virus ribozyme, that acts as a ribozyme, which self-cleaves the linear RNA into monomers. These monomers are then ligated to form circular RNA.
|
|
Some DNA sequences are transcribed into RNA but are not translated into protein products—such RNA molecules are called non-coding RNA. In some cases, these products fold into structures which are involved in critical cell functions (e.g. ribosomal RNA and transfer RNA). RNA can also have regulatory effects through hybridization interactions with other RNA molecules (e.g. microRNA).
|
|
A general scenario of RNA virus evolution All members of Riboviria contain a gene that encodes for an RNA-dependent polymerase, also called RNA-directed polymerase. There are two types of RNA-dependent polymerases: RNA-dependent RNA polymerase (RdRp), also called RNA replicase, which synthesizes RNA from RNA, and RNA-dependent DNA polymerase (RdDp), also called reverse transcriptase (RT), which synthesizes DNA from RNA. In a typical virus particle, called a virion, the RNA-dependent polymerase is bound to the viral genome in some manner and begins transcription of the viral genome after entering a cell. As part of a virus's life cycle, the RNA- dependent polymerase also synthesizes copies of the viral genome as part of the process of creating new viruses.
|
|
In the case of gene expression assay microarrays or RNA sequencing (RNA-seq), RNA spike-ins are used.
|
|
Eukaryotic SRP RNAs are transcribed from DNA by RNA polymerase III (Pol III). RNA polymerase III also transcribes the genes for 5S ribosomal RNA, tRNA, 7SK RNA, and U6 spliceosomal RNA. The promoters of the human SRP RNA genes include elements located downstream of the transcriptional start site. Plant SRP RNA promoters contain an upstream stimulatory element (USE) and a TATA box.
|
|
Ribonucleic acid (RNA) functions in converting genetic information from genes into the amino acid sequences of proteins. The three universal types of RNA include transfer RNA (tRNA), messenger RNA (mRNA), and ribosomal RNA (rRNA). Messenger RNA acts to carry genetic sequence information between DNA and ribosomes, directing protein synthesis. Ribosomal RNA is a major component of the ribosome, and catalyzes peptide bond formation.
|
|
Double-stranded RNA Double- stranded RNA (dsRNA) is RNA with two complementary strands, similar to the DNA found in all cells, but with the replacement of thymine by uracil. dsRNA forms the genetic material of some viruses (double-stranded RNA viruses). Double- stranded RNA, such as viral RNA or siRNA, can trigger RNA interference in eukaryotes, as well as interferon response in vertebrates.
|
|
John Atkins is an active proponent of the RNA World hypothesis and is an editor of The RNA World and RNA Worlds books.Gesteland, Raymond F.; Cech, Thomas; Atkins, John F. (2006). The RNA world: the nature of modern RNA suggests a prebiotic RNA world. Plainview, N.Y: Cold Spring Harbor Laboratory Press. .
|
|
Three-dimensional structure of an RNA molecule. RNA spike-ins are short synthetic RNA polymers. An RNA spike-in is an RNA transcript of known sequence and quantity used to calibrate measurements in RNA hybridization assays, such as DNA microarray experiments, RT-qPCR, and RNA-Seq. A spike-in is designed to bind to a DNA molecule with a matching sequence, known as a control probe.
|
|
RNA origami is represented as a DNA gene, which within cells can be transcribed into RNA by RNA polymerase. Many computer algorithms are present to help with RNA folding, but none can fully predict the folding of RNA of a singular sequence.
|
|
RNA editing (also RNA modification) is a molecular process through which some cells can make discrete changes to specific nucleotide sequences within an RNA molecule after it has been generated by RNA polymerase. It occurs in all living organisms, and is one of the most evolutionarily conserved properties of RNAs. RNA editing may include the insertion, deletion, and base substitution of nucleotides within the RNA molecule. RNA editing is relatively rare, with common forms of RNA processing (e.g.
|
|
RNA viruses can be further classified according to the sense or polarity of their RNA into negative-sense and positive-sense, or ambisense RNA viruses. Positive-sense viral RNA is similar to mRNA and thus can be immediately translated by the host cell. Negative-sense viral RNA is complementary to mRNA and thus must be converted to positive-sense RNA by an RNA-dependent RNA polymerase before translation. Purified RNA of a positive- sense virus can directly cause infection though it may be less infectious than the whole virus particle.
|
|
As such, the RNA architectonics approach can be seen as RNA modular origami. This approach was extended to the synthesis of larger self-assembling units of more than 400 nts. More recently, RNA origami was extended to the design of long single stranded RNA sequences able to fold into large pre-defined nanostructures. Hence, RNA modular origami (originally called RNA architectonics), RNA origami and RNA single stranded origami are both originating from the same concept where RNA sequences can be design to self-fold and assemble into predefined shapes.
|
|
Once in the cytoplasm, the SeV genomic RNA is getting involved, as a template, in two different RNA synthetic processes performed by RNA-dependent RNA polymerase, which consists of L and P proteins: (1) transcription to generate mRNAs and (2) replication to produce a positive- sense antigenome RNA that in turn acts as a template for production of progeny negative-strand genomes. RNA-dependent RNA polymerase promotes the generation of mRNAs methylated cap structures. The NP protein is thought to have both structural and functional roles This protein concentration is believed to regulate the switch from RNA transcription to RNA replication. The genomic RNA functions as the template for the viral RNA transcription until the NP protein concentration increases.
|
|
Improper methylations of human genes can lead to disease development, including cancer. Similarly, RNA methylation occurs in different RNA species viz. tRNA, rRNA, mRNA, tmRNA, snRNA, snoRNA, miRNA, and viral RNA. Different catalytic strategies are employed for RNA methylation by a variety of RNA-methyltransferases.
|
|
Guide RNAs binds to the anti sense RNA sequence and regulates the RNA modification. It is observed that small interfering RNA (siRNA) and micro RNA (miRNA) are generally used as target RNA sequence and modifications are comparatively easy to introduce because of small size.
|
|
The enzyme dicer trims double stranded RNA, to form small interfering RNA or microRNA. These processed RNAs are incorporated into the RNA-induced silencing complex (RISC), which targets messenger RNA to prevent translation.
|
|
OLE RNA (Ornate Large Extremophilic RNA) is a conserved RNA structure present in certain bacteria. The RNA averages roughly 610 nucleotides in length. The only known RNAs that are longer than OLE RNA are ribozymes such as the group II intron and ribosomal RNAs. The exceptional length and highly conserved structure of OLE RNA prompted the hypothesis that OLE RNA could be a ribozyme, or otherwise perform an intricate biochemical task.
|
|
Mediating RNA interference in cultured mammalian cells. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA non-coding RNA molecules, typically 20-27 base pairs in length, similar to miRNA, and operating within the RNA interference (RNAi) pathway. It interferes with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription, preventing translation.
|
|
The predicted amino acid sequence of ORF 1 contains motifs similar to RNA-dependent RNA-polymerase, cysteine proteases, and RNA helicase. Positive-stranded RNA viruses do not have RNA-dependent RNA- polymerases in their capsid so they encode for them in their genomes and rely on the cell's translation mechanisms produce RNA-dependent RNA-polymerase. ORF 2 contains the sequences for four structural proteins VP1, VP2, VP3, and minor protein VP4 which will be the main components of the viral capsid.
|
|
RNA- binding proteins exhibit highly specific recognition of their RNA targets by recognizing their sequences and structures. Specific binding of the RNA- binding proteins allow them to distinguish their targets and regulate a variety of cellular functions via control of the generation, maturation, and lifespan of the RNA transcript. This interaction begins during transcription as some RBPs remain bound to RNA until degradation whereas others only transiently bind to RNA to regulate RNA splicing, processing, transport, and localization. In this section, three classes of the most widely studied RNA- binding domains (RNA-recognition motif, double-stranded RNA-binding motif, zinc-finger motif) will be discussed.
|
|
Other classes of small RNA have been identified, including piwi-interacting RNA (piRNA) and its subspecies repeat associated small interfering RNA (rasiRNA).
|
|
RNA polymerase 1 (also known as Pol I) is, in higher eukaryotes, the polymerase that only transcribes ribosomal RNA (but not 5S rRNA, which is synthesized by RNA polymerase III), a type of RNA that accounts for over 50% of the total RNA synthesized in a cell.
|
|
For instance, a number of RNA viruses (such as poliovirus) use this type of enzyme to replicate their genetic material. Also, RNA-dependent RNA polymerase is part of the RNA interference pathway in many organisms.
|
|
This in turn affects RNA infectivity altering viral RNA production levels.
|
|
RNA inhibitors such as rifampin, act upon DNA-dependent RNA polymerase.
|
|
The RNA helicase database stores data (sequence, structures...) about RNA helicases.
|
|
RNA is subdivided into many categories, including messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), long non- coding RNA (lncRNA), and several other small functional RNAs. Whereas many proteins have quaternary structure, the majority of RNA molecules have only primary through tertiary structure but function as individual molecules rather than as multi-subunit structures. Some types of RNA show clear quaternary structure that is essential for function, whereas other types of RNA function as single molecules and do not associate with other molecules to form quaternary structures.Symmetrical complexes of RNA molecules are extremely uncommon compared to protein oligomers.
|
|
Double-stranded RNA-specific adenosine deaminase is an enzyme that in humans is encoded by the ADAR gene (which stands for adenosine deaminase acting on RNA). Adenosine deaminases acting on RNA (ADAR) are enzymes responsible for binding to double stranded RNA (dsRNA) and converting adenosine (A) to inosine (I) by deamination. ADAR protein is a RNA-binding protein, which functions in RNA-editing through post-transcriptional modification of mRNA transcripts by changing the nucleotide content of the RNA. The conversion from A to I in the RNA disrupt the normal A:U pairing which makes the RNA unstable.
|
|
RNA-OUT is a non-coding RNA that is antisense to the RNA-IN non-coding RNA. Transposition of insertion sequence IS10 is regulated by an anti-sense RNA which inhibits transposase expression when IS10 is present in multiple copies per cell. IS10 antisense pairing is facilitated by the RNA-binding protein, Hfq. RNA-OUT consists of a stem-loop domain topped by a flexibly paired loop; the 5′ end of the target molecule, RNA-IN, is complementary to the top of the loop, and complementarity extends for 35 nucleotides down one side of RNA-OUT.
|
|
RNA silencing or RNA interference refers to a family of gene silencing effects by which gene expression is negatively regulated by non-coding RNAs such as microRNAs. RNA silencing may also be defined as sequence-specific regulation of gene expression triggered by double-stranded RNA (dsRNA). RNA silencing mechanisms are highly conserved in most eukaryotes. The most common and well- studied example is RNA interference (RNAi), in which endogenously expressed microRNA (miRNA) or exogenously derived small interfering RNA (siRNA) induces the degradation of complementary messenger RNA.
|
|
RNA phase transitions driven in part by intermolecular RNA- RNA interactions may play a role in stress granule formation. Similar to intrinsically disordered proteins, total RNA extracts are capable of undergoing phase separation in physiological conditions in vitro. RNA-seq analyses demonstrate that these assemblies share a largely overlapping transcriptome with stress granules, with RNA enrichment in both being predominately based on the length of the RNA. Furthermore, stress granules contain many RNA helicases, including the DEAD/H-box helicases Ded1p/DDX3, eIF4A1, and RHAU.
|
|
RNA component of mitochondrial RNA processing endoribonuclease, also known as RMRP, is a human gene. Mitochondrial RNA-processing endoribonuclease cleaves mitochondrial RNA complementary to the light chain of the displacement loop at a unique site (Chang and Clayton, 1987). The enzyme is a ribonucleoprotein whose RNA component is a nuclear gene product. The RNA component is the first RNA encoded by a single-copy gene in the nucleus and imported into mitochondria.
|
|
RNA viruses are a group of related viruses that have genomes made of RNA (ribonucleic acid). They encode an RNA-dependent RNA polymerase (RdRp) which is used to transcribe the viral RNA genome into messenger RNA (mRNA) and to replicate the genome. Viruses in the group share a number of characteristics involving evolution, including high rates of genetic mutations, recombinations, and reassortments. RNA viruses constitute the kingdom Orthornavirae in the realm Riboviria.
|
|
Mycobacterium smegmatis small RNA 1 (Ms1 small RNA) is highly expressed during stationary phase of growth, Ms1 RNA directly interacts with RNA polymerase (RNAP). but in a different way than 6S, which is present in other bacteria. Ms1 does not require the presence of the main sigma factor for RNAP interaction. There is evidence that Ms1 RNA may function similar to 6S RNA in M. smegmatis which does not have 6S RNA.
|
|
The mature mRNA may then be transported to the cytosol and translated by the ribosome into a protein. Other types of RNA include ribosomal RNA (rRNA) and transfer RNA (tRNA). These types are transcribed by RNA polymerase II and RNA polymerase III, respectively, and are essential for protein synthesis. However 5s rRNA is the only rRNA which is transcribed by RNA Polymerase III.
|
|
An RNA sequence that is complementary to an endogenous mRNA transcript is sometimes called "antisense RNA". In other words, it is a non-coding strand complementary to the coding sequence of RNA; this is similar to negative-sense viral RNA. When mRNA forms a duplex with a complementary antisense RNA sequence, translation is blocked. This process is related to RNA interference.
|
|
ACT, CAG, TTT). In transcription, the codons of a gene are copied into messenger RNA by RNA polymerase. This RNA copy is then decoded by a ribosome that reads the RNA sequence by base-pairing the messenger RNA to transfer RNA, which carries amino acids. Since there are 4 bases in 3-letter combinations, there are 64 possible codons (43 combinations).
|
|
400x400px RNA origami is the nanoscale folding of RNA, enabling the RNA to create particular shapes to organize these molecules. It is a new method that was developed by researchers from Aarhus University and California Institute of Technology. RNA origami is synthesized by enzymes that fold RNA into particular shapes. The folding of the RNA occurs in living cells under natural conditions.
|
|
RNA polymerase V is a multisubunit plant specific RNA polymerase found in nucleus. Together with RNA polymerase IV required for normal function and biogenesis of small interfering RNA (siRNA). Pol V is involved in siRNA- directed DNA methylation pathway which leads to heterochromatic silencing. RNA polymerase V is composed of 12 subunits that are paralogous to RNA polymerase II subunits.
|
|
Brome mosaic virus (BMV) genomes are able to undergo RNA- RNA homologous recombination upon infection of plant cells.Lai MM. RNA recombination in animal and plant viruses. Microbiol Rev. 1992 Mar;56(1):61-79. PMID: 1579113; PMCID: PMC372854 The RNA-dependent RNA polymerase specified by the BMV genome appears to undergo template switching (copy choice) recombination during viral RNA synthesis.
|
|
Silencing of RNA occurs when double stranded RNA molecules are processed by a series of enzymatic reactions, resulting in RNA fragments that degrade complementary RNA sequences. By degrading transcripts, a lower amount of protein products are translated and the phenotype is altered by yet another RNA processing event.
|
|
" Bartel DP, Szostak JW. After he became independent at the Whitehead Institute, he further evolved this ribozyme to function as a RNA- dependent RNA polymerase to extend primers on external RNA templates, bolstering the "RNA world" theory.Trends Cell Biol. 1999 Dec;9(12):M9-M13. "Constructing an RNA world.
|
|
The same way that RNA silencing regulates downstream target mRNAs, RNA silencing itself is regulated. For example, silencing signals get spread between cells by a group of enzymes called RdRPs (RNA-dependent RNA polymerases) or RDRs.
|
|
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction.
|
|
VAI RNA functions as a decoy RNA for the double stranded RNA activated protein kinase R which would otherwise phosphorylate eukaryotic initiation factor 2.
|
|
Small RNA sequencing (Small-Seq) is a type of RNA sequencing based on the use of NGS technologies that allows to isolate and get information about noncoding RNA molecules in order to evaluate and discover new forms of small RNA and to predict their possible functions. By using this technique, it is possible to discriminate small RNAs from the larger RNA family to better understand their functions in the cell and in gene expression. Small RNA-Seq can analyze thousands of small RNA molecules with a high throughput and specificity. The greatest advantage of using RNA-seq is represented by the possibility of generating libraries of RNA fragments starting from the whole RNA content of a cell.
|
|
RNA reads may be obtained using a variety of RNA-seq methods.
|
|
RNA can also be transfected into cells to transiently express its coded protein, or to study RNA decay kinetics. RNA transfection is often used in primary cells that do not divide. siRNAs can also be transfected to achieve RNA silencing (i.e. loss of RNA and protein from the targeted gene).
|
|
These results paved the way for a series of investigations into the various properties and propensities of RNA. Through the late 1950s and early 1960s, numerous papers were published on various topics in RNA structure, including RNA-DNA hybridization, triple stranded RNA, and even small-scale crystallography of RNA di-nucleotides - G-C, and A-U - in primitive helix-like arrangements. For a more in-depth review of the early work in RNA structural biology, see the article The Era of RNA Awakening: Structural biology of RNA in the early years by Alexander Rich.
|
|
RNA I and RNA II first form a weak interaction called a kissing complex. The kissing complex is stabilized by a protein called Rop (repressor of primer) and a double-stranded RNA-I/RNA-II RNA duplex is formed. This altered shape prevents RNA II from hybridizing to the DNA and being processed from RNaseH to produce the primer necessary for initiation of plasmid replication. More RNA I is produced when the concentration of the plasmid is high, and high concentration of RNA I inhibits replication, resulting in regulation of copy number.
|
|
As nuclear RNA emerges from RNA polymerase, RNA transcripts are immediately covered with RNA-binding proteins that regulate every aspect of RNA metabolism and function including RNA biogenesis, maturation, transport, cellular localization and stability. All RBPs bind RNA, however they do so with different RNA-sequence specificities and affinities, which allows the RBPs to be as diverse as their targets and functions. These targets include mRNA, which codes for proteins, as well as a number of functional non-coding RNAs. NcRNAs almost always function as ribonucleoprotein complexes and not as naked RNAs.
|
|
If the RNA is a regulatory RNA (such as a miRNA), the RNA may cause other changes in the cell (such as RNAi-mediated knockdown).
|
|
RNA transfection is the process of deliberately introducing RNA into a living cell. RNA can be purified from cells after lysis or synthesized from free nucleotides either chemically, or enzymatically using an RNA polymerase to transcribe a DNA template. As with DNA, RNA can be delivered to cells by a variety of means including microinjection, electroporation, and lipid-mediated transfection. If the RNA encodes a protein, transfected cells may translate the RNA into the encoded protein.
|
|
RNA hydrolysis is a reaction in which a phosphodiester bond in the sugar- phosphate backbone of RNA is broken, cleaving the RNA molecule. RNA is susceptible to this base-catalyzed hydrolysis because the ribose sugar in RNA has a hydroxyl group at the 2’ position. This feature makes RNA chemically unstable compared to DNA, which does not have this 2’ -OH group and thus is not susceptible to base-catalyzed hydrolysis. Mechanism of base catalyzed RNA hydrolysis.
|
|
In the 1960s, the replication process of RNA virus was believed to be similar to other single-stranded RNA. Single-stranded RNA replication involves RNA-dependent RNA synthesis which meant that virus-coding enzymes would make partial double-stranded RNA. This belief was proven to be incorrect because there were no double-stranded RNA found in the retrovirus cell. In 1964, Howard Temin proposed a provirus hypothesis, but shortly after reverse transcription in the retrovirus genome was discovered.
|
|
During elongation, RNA polymerase slides down the double stranded DNA, unwinding it and transcribing (copying) its nucleotide sequence into newly synthesized RNA. The movement of the RNA-DNA complex is essential for the catalytic mechanism of RNA polymerase. Additionally, RNA polymerase increases the overall stability of this process by acting as a link between the RNA and DNA strands. New nucleotides that are complementary to the DNA template strand are added to the 3' end of the RNA strand.
|
|
Negative-sense (3′-to-5′) viral RNA is complementary to the viral mRNA, thus a positive-sense RNA must be produced by an RNA-dependent RNA polymerase from it prior to translation. Like DNA, negative-sense RNA has a nucleotide sequence complementary to the mRNA that it encodes; also like DNA, this RNA cannot be translated into protein directly. Instead, it must first be transcribed into a positive-sense RNA that acts as an mRNA. Some viruses (e.g.
|
|
Modern life, based largely on DNA as the genetic material, is thought to have descended from RNA-based organisms in an earlier RNA world. RNA life would have depended on an RNA-dependent RNA polymerase ribozyme to copy functional RNA molecules, including copying the polymerase itself. Tjhung et al.Tjhung KF, Shokhirev MN, Horning DP, Joyce GF. An RNA polymerase ribozyme that synthesizes its own ancestor. Proc Natl Acad Sci U S A. 2020;117(6):2906-2913. doi:10.1073/pnas.
|
|
RNA spike-ins can be synthesized by any means of creating RNA synthetically, or by using cells to transcribe DNA to RNA in vivo (in cells). RNA can be produced in vitro (cell free) using RNA polymerase and DNA with the desired sequence. Large scale biotech manufacturers produce RNA synthetically via high-throughput techniques and provide solutions of RNA spike-ins at predetermined concentration. Bacteria containing DNA (usually on plasmids) for transcription to spike-ins are also commercially available.
|
|
Because RNA-3 and RNA-4 are medium-density, they are encapsidated together. RNA-1 and RNA-2 are thought to be involved in viral replication while RNA-3 has a role in the spread of infection throughout the plant. When RNA-3 is deficient, virus replication still does occur, just at a significantly reduced level. Due to these four species of single-stranded, positive sense RNA molecules, the CCMV genome codes for four separate genes.
|
|
Kim MJ, Kao C. Factors regulating template switch in vitro by viral RNA-dependent RNA polymerases: implications for RNA-RNA recombination. Proc Natl Acad Sci U S A. 2001 Apr 24;98(9):4972-7. doi: 10.1073/pnas.081077198.
|
|
These elements can partially base-pair forming a short hairpin. There are multiple copies of class I RNA in the D. discoideum genome and the RNA is highly expressed i.e. 14 unique sequences were identified in the small RNA library and it comprised ~12% of all RNA in the small RNA library. Homologs to class I RNA have only been located in D. discoideum to date.
|
|
In molecular biology, the SR1 RNA is a small RNA (sRNA) produced by species of Bacillus and closely related bacteria. It is a dual-function RNA which acts both as a protein-coding RNA and as a regulatory sRNA. SR1 RNA is involved in the regulation of arginine catabolism. SR1 RNA binds to complementary stretches of ahrC mRNA (also known as argR and inhibits translation.
|
|
Positive-sense (5′-to-3′) viral RNA signifies that a particular viral RNA sequence may be directly translated into viral proteins (e.g., those needed for viral replication). Therefore, in positive-sense RNA viruses, the viral RNA genome can be considered viral mRNA, and can be immediately translated by the host cell. Unlike negative-sense RNA, positive-sense RNA is of the same sense as mRNA.
|
|
The SraC/RyeA RNA is a non-coding RNA that was discovered in E. coli during two large scale screens for RNAs. The function of this RNA is currently unknown. This RNA overlaps the SdsR/RyeB RNA on the opposite strand suggesting that the two RNAs may act in a concerted manner.
|
|
The IS102 RNA is a non-coding RNA that is found in bacteria such as Shigella flexneri and Escherichia coli. The RNA is 208 nucleotides in length and found between the yeeP and flu genes. This RNA was identified in a computational screen of E. coli. The function of this RNA is unknown.
|
|
A RNA immunoprecipitation chip (RIP-Chip) is immunoprecipitation of an RNA- binding protein coupled to reverse transcription and a microarray. It has been used to find interactions between RNA and protein (one protein but many RNA species per analysis).
|
|
Sar RNA is an antisense non-coding RNA that is partly responsible for the negative regulation of antirepressor synthesis during development of bacteriophage P22. The target of Sar RNA is ant mRNA. Structurally, Sar RNA forms two stem-loops.
|
|
This technology makes available the ability to isolate endogenous RNA transcripts in cells without the need to induce chemical modifications to RNA or RNA tagging methods.
|
|
Small nucleolar RNA R30/Z108 (snoR30) is a C/D box small nucleolar RNA that acts as a methylation guide for 18S ribosomal RNA in plants.
|
|
RNAse H is an enzyme that removes RNA from an RNA-DNA duplex.
|
|
A sub genomic positive strand RNA - the 26S RNA - is replicated from a negative-stranded RNA intermediate. This serves as template for the synthesis of viral structural proteins. Most alphaviruses have conserved domains involved in regulation of viral RNA synthesis.
|
|
Bacteria with Cas13 make molecules that can dismember RNA, destroying the virus. Tailoring these genes opened any RNA molecule to editing. CRISPR-Cas systems can also be employed for editing of micro-RNA and long-noncoding RNA genes in plants.
|
|
Double-stranded RNA viruses (dsRNA viruses) are a polyphyletic group of viruses that have double-stranded genomes made of ribonucleic acid. The double-stranded genome is used to transcribe a positive-strand RNA by the viral RNA-dependent RNA polymerase (RdRp). The positive-strand RNA may be used as messenger RNA (mRNA) which can be translated into viral proteins by the host cell's ribosomes. The positive-strand RNA can also be replicated by the RdRp to create a new double-stranded viral genome.
|
|
One important gene regulation method is RNA mutagenesis which can be introduced by RNA editing with the help of gRNA. Guide RNA replaces adenosine with inosine at the specific target site and modify the genetic code. Adenosine deaminase acts on RNA bringing post transcriptional modification by altering the codons and different protein functions. Guide RNAs are the small nucleloar RNA, these along with riboproteins perform intracellular RNA alterations such as ribomethylation in rRNA and introduction of pseudouridine in preribosomal RNA.
|
|
However, HU also binds to dsRNA and RNA-DNA hybrids with a lower affinity similar to that with a linear dsDNA. Moreover, HU preferentially binds to RNA containing secondary structures and an RNA-DNA hybrid in which the RNA contains a nick or overhang. The binding affinities of HU with these RNA substrates are similar to those with which it binds to distorted DNA. An immunoprecipitation of HU- bound RNA coupled to reverse transcription and microarray (RIP-Chip) study as well as an analysis of RNA from purified intact nucleoids identified nucleoid- associated RNA molecules that interact with HU. Several of them are non-coding RNAs, and one such RNA named naRNA4 (nucleoid-associated RNA 4), is encoded in a repetitive extragenic palindrome (REP325).
|
|
A polymerase that exhibits this behavior is RNA-dependent RNA polymerase, present in many RNA viruses. Reverse transcriptase has also been observed to undergo this polymerase stuttering.
|
|
Spiegelman's Monster is the name given to an RNA chain of only 218 nucleotides that is able to be reproduced by the RNA replication enzyme RNA-dependent RNA polymerase, also called RNA replicase. It is named after its creator, Sol Spiegelman, of the University of Illinois at Urbana-Champaign who first described it in 1965.
|
|
The first virus to be discovered, tobacco mosaic virus, is an RNA virus. In modern history, RNA viruses have caused numerous disease outbreaks, and RNA plant viruses infect many economically important crops. Most eukaryotic viruses, including most human, animal, and plant viruses, are RNA viruses. In contrast, there are relatively few prokaryotic RNA viruses.
|
|
In circular RNA the 3' and 5' ends normally present in an RNA molecule have been joined together. This feature confers numerous properties to circular RNA, many of which have only recently been identified. Many types of circular RNA arise from otherwise protein- coding genes. Some circular RNA have been shown to code for proteins.
|
|
The exoribonuclease nonstructural protein, for instance, provides extra fidelity to replication by providing a proofreading function which the RNA-dependent RNA polymerase lacks. Replication – One of the main functions of the complex is to replicate the viral genome. RdRp directly mediates the synthesis of negative-sense genomic RNA from the positive-sense genomic RNA. This is followed by the replication of positive- sense genomic RNA from the negative-sense genomic RNA.
|
|
As replication starts, both S and L RNA genomes synthesize the antigenomic S and L RNAs, and from the antigenomic RNAs, genomic S and L RNA are synthesized. Both genomic and antigenomic RNAs are needed for transcription and translation. The S RNA encodes GP and NP (viral nucleocapsid protein) proteins, while L RNA encodes Z and L proteins. The L protein most likely represents the viral RNA-dependent RNA polymerase.
|
|
This RNA switch from the SVV IRES has been incorporated into triangular RNA nanostructures.
|
|
The abiF RNA motif is a conserved RNA structure that was discovered by bioinformatics.
|
|
The product of the largest segment (L) is the viral RNA-dependent RNA polymerase.
|
|
Inside the capsid with the genome there is also the RNA- dependent RNA polymerse.
|
|
Some RNA viruses and viroids also replicate their genome through rolling circle RNA replication. For viroids, there are two alternative RNA replication pathways that respectively followed by members of the family Pospivirodae (asymmetric replication) and Avsunviroidae (symmetric replication). Rolling circle replication of viral RNA In the family Pospiviroidae (PSTVd-like), the circular plus strand RNA is transcribed by a host RNA polymerase into oligomeric minus strands and then oligomeric plus strands. These oligomeric plus strands are cleaved by a host RNase and ligated by a host RNA ligase to reform the monomeric plus strand circular RNA.
|
|
They have also been shown to aid in the regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintaining the telomeres. snRNA are always associated with a set of specific proteins, and the complexes are referred to as small nuclear ribonucleoproteins (snRNP, often pronounced "snurps"). Each snRNP particle is composed of a snRNA component and several snRNP-specific proteins (including Sm proteins, a family of nuclear proteins). The most common human snRNA components of these complexes are known, respectively, as: U1 spliceosomal RNA, U2 spliceosomal RNA, U4 spliceosomal RNA, U5 spliceosomal RNA, and U6 spliceosomal RNA.
|
|
All transcriptomic methods require RNA to first be isolated from the experimental organism before transcripts can be recorded. Although biological systems are incredibly diverse, RNA extraction techniques are broadly similar and involve mechanical disruption of cells or tissues, disruption of RNase with chaotropic salts, disruption of macromolecules and nucleotide complexes, separation of RNA from undesired biomolecules including DNA, and concentration of the RNA via precipitation from solution or elution from a solid matrix. Isolated RNA may additionally be treated with DNase to digest any traces of DNA. It is necessary to enrich messenger RNA as total RNA extracts are typically 98% ribosomal RNA.
|
|
This step is usually followed by an assessment of RNA quality, with the purpose of avoiding contaminants such as DNA or technical contaminants related to sample processing. RNA quality is measured using UV spectrometry with an absorbance peak of 260nm. RNA integrity can also be analyzed quantitatively comparing the ratio and intensity of 28S RNA to 18S RNA reported in the RNA Integrity Number (RIN) score. Since mRNA is the species of interest and it represents only 3% of its total content, the RNA sample should be treated to remove rRNA and tRNA and tissue-specific RNA transcripts.
|
|
The RNA recognition motif, which is the most common RNA-binding motif, is a small protein domain of 75–85 amino acids that forms a four-stranded β-sheet against the two α-helices. This recognition motif exerts its role in numerous cellular functions, especially in mRNA/rRNA processing, splicing, translation regulation, RNA export, and RNA stability. Ten structures of an RRM have been identified through NMR spectroscopy and X-ray crystallography. These structures illustrate the intricacy of protein–RNA recognition of RRM as it entails RNA–RNA and protein–protein interactions in addition to protein–RNA interactions.
|
|
Lagging strand during DNA replicationEventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease, and DNA ligase come along to convert the RNA (of the primers) to DNA and to seal the gaps in between the Okazaki fragments. But, in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it does not happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade any RNA left on the DNA.
|
|
Alternatively, the transcribed gene may encode for non-coding RNA such as microRNA, ribosomal RNA (rRNA), transfer RNA (tRNA), or enzymatic RNA molecules called ribozymes.Eldra P. Solomon, Linda R. Berg, Diana W. Martin. Biology, 8th Edition, International Student Edition. Thomson Brooks/Cole.
|
|
Another method, called RNA-seq, can show which RNA molecules are involved with specific diseases. Unlike DNA, levels of RNA can change in response to the environment. Therefore, sequencing RNA can provide a broader understanding of a person's state of health. Recent studies have linked genetic differences between individuals to RNA expression, translation, and protein levels.
|
|
Some common features of protein-RNA interfaces were deduced based on known structures. For example, RNP in snRNPs have an RNA-binding motif in its RNA-binding protein. Aromatic amino acid residues in this motif result in stacking interactions with RNA. Lysine residues in the helical portion of RNA- binding proteins help to stabilize interactions with nucleic acids.
|
|
PMID: 31540135 Review. The mechanism of recombination of the RNA genome likely involves template strand switching during RNA replication, a process known as copy choice recombination. RNA recombination is considered to be an adaptation for dealing with RNA genome damage and a source of genetic diversity.Barr JN, Fearns R. How RNA viruses maintain their genome integrity.
|
|
In the late 1960s, Orgel proposed that life was based on RNA before it was based on DNA or proteins. His theory included genes based on RNA and RNA enzymes. This view would be developed and shaped into the now widely accepted RNA world hypothesis. Almost thirty years later, Orgel wrote a lengthy review of the RNA World hypothesis.
|
|
RNA sequencing (RNA-Seq) is performed by reverse transcribing RNA to complementary DNA (cDNA) and high-throughput sequencing the cDNA. Such high-throughput methods can be error prone, and known controls are necessary to detect and correct for levels of error. RNA spike-in controls can provide a measure of sensitivity and specificity of an RNA-Seq experiment.
|
|
The CyaR RNA (formerly known as RyeE RNA) non-coding RNA was identified in a large scale screen of Escherichia coli and was called candidate 14. The exact 5′ and 3′ ends of this RNA are uncertain. This gene lies between yegQ and orgK in E. coli. This small RNA was shown to be bound by the Hfq protein.
|
|
The double-stranded RNA panhandle structure is critical for efficient viral RNA synthesis, but potential interterminal double-stranded RNA interactions must be transiently relieved in order to recruit the viral polymerase. The S-segment RNA is approximately 3.5 kb, and encodes the viral nucleocapsid protein (NP) and glycoprotein (GPC). The L-segment RNA is approximately 7.2 kb, and encodes the viral RNA-dependent RNA-polymerase (L) and a small RING-domain containing protein (Z). The Z protein forms homo oligomers and a structural component of the virions.
|
|
Initially thought to use just RNA polymerase II, now RNA polymerases I and III have also been shown to be involved in HDV replication. Normally RNA polymerase II utilizes DNA as a template and produces mRNA. Consequently, if HDV indeed utilizes RNA polymerase II during replication, it would be the only known animal pathogen capable of using a DNA-dependent polymerase as an RNA-dependent polymerase. The RNA polymerases treat the RNA genome as double-stranded DNA due to the folded rod-like structure it is in.
|
|
Since this virus possesses a negative-sense RNA genome, its replication and transcription cycles follow that of the negative-RNA genome. Therefore, to replicate, the negative, single-stranded RNA genome must use RNA-dependent RNA polymerase to generate the positive strand of RNA, which can directly be made into protein by host ribosomes. Likewise, both the positive and negative RNA strands must be present for replication of the genome to occur. RNA-dependent RNA polymerase binds the 3’ end of the viral genome and begins transcription, regularly identifying start and stop signals along the way which edge the genes. During mRNA synthesis, the viral “L” protein aids in capping and polyadenylating the product.
|
|
The specific chemical, structural or other characteristics of long RNA molecules that are required for recognition by PRRs remain largely unknown despite intense study. At any given time, a typical mammalian cell may contain several hundred thousand mRNA and other, regulatory long RNA molecules. How cells distinguish exogenous long RNA from the large amount of endogenous long RNA is an important open question in cell biology. Several reports suggest that phosphorylation of the 5'-end of a long RNA molecule can influence its immunogenicity, and specifically that 5'-triphosphate RNA, which can be produced during viral infection, is more immunogenic than 5'-diphosphate RNA, 5'-monophosphate RNA or RNA containing no 5' phosphate.
|
|
NoRC associated RNA (also known as pRNA) is a non-coding RNA element which regulates ribosomal RNA transcription by interacting with TIP5, part of the NoRC chromatin remodeling complex.
|
|
For many RNA molecules, the secondary structure is highly important to the correct function of the RNA -- often more so than the actual sequence. This fact aids in the analysis of non- coding RNA sometimes termed "RNA genes". One application of bioinformatics uses predicted RNA secondary structures in searching a genome for noncoding but functional forms of RNA. For example, microRNAs have canonical long stem- loop structures interrupted by small internal loops.
|
|
Function of RNA polymerase II (transcription). Green: newly synthesized RNA strand by enzyme RNA polymerase II (RNAP II and Pol II) is a multiprotein complex that transcribes DNA into precursors of messenger RNA (mRNA) and most small nuclear RNA (snRNA) and microRNA. It is one of the three RNAP enzymes found in the nucleus of eukaryotic cells. A 550 kDa complex of 12 subunits, RNAP II is the most studied type of RNA polymerase.
|
|
The FourU thermometer RNA motif, with the Shine-Dalgarno sequence highlighted. An RNA thermometer (or RNA thermosensor) is a temperature-sensitive non-coding RNA molecule which regulates gene expression. RNA thermometers often regulate genes required during either a heat shock or cold shock response, but have been implicated in other regulatory roles such as in pathogenicity and starvation. In general, RNA thermometers operate by changing their secondary structure in response to temperature fluctuations.
|
|
The RyhB gene name is an acronym composed of R for RNA, y for unknown function (after the protein naming convention), with the h representing the ten-minute-interval section of the E. coli map the gene is found in. The B comes from the fact that this was one of two RNA genes identified in this interval. Other RNAs using this nomenclature include RydB RNA, RyeB RNA, RyeE RNA and RyfA RNA.
|
|
These animals can be infected and used for studies of replication and pathogenesis. Binding causes a conformational change in the viral capsid proteins, and myristic acid are released. These acids form a pore in the cell membrane through which RNA is injected . Once inside the cell, the RNA un-coats and the (+) strand RNA genome is replicated through a double-stranded RNA intermediate that is formed using viral RDRP (RNA-Dependent RNA polymerase).
|
|
Proteins are much more flexible in catalysis than RNA due to the existence of diverse amino acid side chains with distinct chemical characteristics. The RNA record in existing cells appears to preserve some 'molecular fossils' from this RNA world. These RNA fossils include the ribosome itself (in which RNA catalyses peptide-bond formation), the modern ribozyme catalyst RNase P, and tRNAs. The nearly universal genetic code preserves some evidence for the RNA world.
|
|
The ryfA RNA gene is a non-coding RNA present in E. coli, Shigella flexneri and Salmonella species where it is found between the ydaN and dbpA genes. These RNA genes are about 300 nucleotides in length. The function of this RNA is unknown.
|
|
The Bacillaceae-1 RNA motif is a conserved RNA structure identified by bioinformatics within bacteria in the family bacillaceae. The RNA is presumed to operate as a non-coding RNA, and is sometimes adjacent to operons containing ribosomal RNAs. The most characteristic feature is two terminal loops that have the nucleotide consensus RUCCU, where R is either A or G. The motif might be related to the Desulfotalea-1 RNA motif, as the motifs share some similarity in conserved features, and the Desulfotalea-1 RNA motif is also sometimes adjacent to ribosomal RNA operons.
|
|
In enzymology, a RNA-3'-phosphate cyclase () is an enzyme that catalyzes the chemical reaction :ATP + RNA 3'-terminal-phosphate \rightleftharpoons AMP + diphosphate + RNA terminal-2',3'-cyclic-phosphate Thus, the two substrates of this enzyme are ATP and RNA 3'-terminal-phosphate, whereas its 3 products are AMP, diphosphate, and RNA terminal-2',3'-cyclic-phosphate. This enzyme belongs to the family of ligases, specifically those forming phosphoric-ester bonds. The systematic name of this enzyme class is RNA-3'-phosphate:RNA ligase (cyclizing, AMP-forming). This enzyme is also called RNA cyclase.
|
|
This structural transition can then expose or occlude important regions of RNA such as a ribosome binding site, which then affects the translation rate of a nearby protein-coding gene. RNA thermometers, along with riboswitches, are used as examples in support of the RNA world hypothesis. This theory proposes that RNA was once the sole nucleic acid present in cells, and was replaced by the current DNA → RNA → protein system. Examples of RNA thermometers include FourU, the Hsp90 cis- regulatory element, the ROSE element, the Lig RNA thermometer, and the Hsp17 thermometer.
|
|
The RNA world hypothesis states that RNA was once both the carrier of hereditary information and enzymatically active, with different sequences acting as biocatalysts, regulators and sensors. The hypothesis then proposes that modern DNA, RNA and protein-based life evolved and selection replaced the majority of RNA's roles with other biomolecules. RNA thermometers and riboswitches are thought to be evolutionarily ancient due to their wide-scale distribution in distantly- related organisms. It has been proposed that, in the RNA world, RNA thermosensors would have been responsible for temperature-dependent regulation of other RNA molecules.
|
|
57-68 Analysis of crystallographic structures and comparisons with theoretical models then made it possible to establish predictive rules for RNA folding. With Neocles Leontis, Eric Westhof proposed an ontology of pairs between nucleic acid bases that allows automatic annotation of crystal structures and bioinformatic research of structured regions in RNA sequences;Leontis NB, et al., « RNA Geometric nomenclature and classification of RNA base pairs », RNA, (2001), 7, p. 499-512 This structural bioinformatics work by the RNA has made it possible to identify a set of constraints in sequence allowing architectural models of RNA.
|
|
The isostericity of Watson-Crick pairs between the complementary bases forms the basis of RNA helices and of the resulting RNA secondary structure (covariation). In addition, several defined suites of non-Watson-Crick base pairs assemble into RNA modules that form recurrent, rather regular, building blocks of the tertiary architecture of folded RNAs. RNA modules are intrinsic to RNA architecture are therefore disconnected from a biological function specifically attached to a RNA sequence. RNA modules occur in all kingdoms of life and in structured RNAs with diverse functions.
|
|
The longest primer extension performed by a ribozyme polymerase was 20 bases.Hani S. Zaher and Peter J. Unrau, Selection of an improved RNA polymerase ribozyme with superior extension and fidelity. RNA (2007), 13:1017-1026 In 2016, researchers reported the use of in vitro evolution to improve dramatically the activity and generality of an RNA polymerase ribozyme by selecting variants that can synthesize functional RNA molecules from an RNA template. Each RNA polymerase ribozyme was engineered to remain linked to its new, synthesized RNA strand, this allowed the team to isolate successful polymerases.
|
|
The term intron refers to both the DNA sequence within a gene and the corresponding sequence in RNA transcripts. Sequences that are joined together in the final mature RNA after RNA splicing are exons. Introns are found in the genes of most organisms and many viruses and can be located in a wide range of genes, including those that generate proteins, ribosomal RNA (rRNA) and transfer RNA (tRNA). When proteins are generated from intron-containing genes, RNA splicing takes place as part of the RNA processing pathway that follows transcription and precedes translation.
|
|
Pospiviroidae replication occurs in an asymmetric fashion via host cell RNA polymerase, RNase, and RNA ligase.
|
|
Bunyaviruses have tripartite genomes consisting of a large (L), medium (M), and small (S) RNA segment. These RNA segments are single-stranded, and exist in a helical formation within the virion. Besides, they exhibit a pseudo-circular structure due to each segment's complementary ends. The L segment encodes the RNA-dependent RNA polymerase, necessary for viral RNA replication and mRNA synthesis.
|
|
In molecular biology, the Norovirus cis-acting replication element (CRE) is an RNA element which is found in the coding region of the RNA-dependent RNA polymerase in Norovirus. It occurs near to the 5′ end of the RNA dependant RNA polymerase gene, this is the same location that the Hepatitis A virus cis- acting replication element is found in.
|
|
The SRP RNA spans a wide phylogenetic spectrum with respect to size and the number of its structural features (see the SRP RNA Secondary Structure Examples, below). The smallest functional SRP RNAs have been found in mycoplasma and related species. Escherichia coli SRP RNA (also called 4.5S RNA) is composed of 114 nucleotide residues and forms an RNA stem-loop.
|
|
The Hepatitis C virus (HCV) cis-acting replication element (CRE) is an RNA element which is found in the coding region of the RNA-dependent RNA polymerase NS5B. Mutations in this family have been found to cause a blockage in RNA replication and it is thought that both the primary sequence and the structure of this element are crucial for HCV RNA replication.
|
|
The Alfalfa mosaic virus RNA 1 5′ UTR stem-loop represents a putative stem- loop structure found in the 5′ UTR in RNA 1 of alfalfa mosaic virus. RNA 1 is responsible for encoding the viral replicase protein P1. This family is required for negative strand RNA synthesis in the alfalfa mosaic virus and may also be involved in positive strand RNA synthesis.
|
|
These processes happen in a Mg2+ dependent fashion. Retroviral RNases H cleave their substrates through 3 different modes: #sequence-specific internal cleavage of RNA [1-4]. Human immunodeficiency virus type 1 and Moloney murine leukemia virus enzymes prefer to cleave the RNA strand one nucleotide away from the RNA-DNA junction. #RNA 5'-end directed cleavage 13-19 nucleotides from the RNA end.
|
|
Some types of circular RNA have recently shown potential as gene regulators. The biological function of most circular RNA are unclear. Because circular RNA does not have 5' or 3' ends, they are resistant to exonuclease-mediated degradation and are presumably more stable than most linear RNA in cells. Circular RNA has been linked to some diseases such as cancer.
|
|
Sex might also have been present even earlier, in the hypothesized RNA world that preceded DNA cellular life forms. One proposed origin of sex in the RNA world was based on the type of sexual interaction that is known to occur in extant single- stranded segmented RNA viruses, such as influenza virus, and in extant double- stranded segmented RNA viruses such as reovirus. Exposure to conditions that cause RNA damage could have led to blockage of replication and death of these early RNA life forms. Sex would have allowed re-assortment of segments between two individuals with damaged RNA, permitting undamaged combinations of RNA segments to come together, thus allowing survival.
|
|
Noncoding RNA also contributes to epigenetics, transcription, RNA splicing, and the translational machinery. The role of RNA in genetic regulation and disease offers a new potential level of unexplored genomic complexity.
|
|
The virion has a capsid (coat protein) but no envelope. The icosahedral symmetry of the capsid is round to elongated. The range for the length of the virion particle is about 30–57 nm. AMV is a multipartite virus and is composed of 4 particles (3 bacilliform and 1 spheroidal) with a diameter of 18 nm. The genetic material of AMV consists of 3 linear single strands RNAs (RNA 1, RNA 2 and RNA 3) and a subgenomic RNA (RNA 4) which is obtained by transcription of the negative- sense strand of RNA 3. RNA 1 and 2 encode proteins needed for replication. RNA 3 is required for the synthesis of the protein responsible for cell-to-cell movement. RNA 4 encodes the capsid.
|
|
In ColE1 derived plasmids, replication is primarily regulated through a small plasmid-encoded RNA called RNA I. A single promoter initiates replication in ColE1: the RNA II promoter. The RNA II transcript forms a stable RNA-DNA hybrid with the DNA template strand near the origin of replication, where it is then processed by RNaseH to produce the 3' OH primer that DNA polymerase I uses to initiate leading strand DNA synthesis. RNA I serves as a major plasmid-encoded inhibitor of this process whose concentration is proportional to plasmid copy number. RNA I is exactly complementary to the 5' end of the RNA II (because it is transcribed from the opposite strand of the same region of DNA as RNA II).
|
|
Streptolydigin (Stl) is an antibiotic that works by inhibiting nucleic acid chain elongation by binding to RNA polymerase, thus inhibiting RNA synthesis inside a cell. Streptolydigin inhibits bacterial RNA polymerase, but not eukaryotic RNA polymerase. It has antibacterial activity against a number of Gram positive bacteria.
|
|
RNA recombination occurs frequently during replication of carmoviruses, facilitating viral genome repair and promoting sequence variability.Cheng CP, Nagy PD. Mechanism of RNA recombination in carmo- and tombusviruses: evidence for template switching by the RNA-dependent RNA polymerase in vitro. J Virol. 2003 Nov;77(22):12033-47.
|
|
In order for the RSV genome transcription to occur, a primer is required. 4S RNA is the primer for RSV and 70S RNA serves as the template for DNA synthesis. Reverse transcriptase, an RNA-dependent DNA polymerase, transcribes viral RNA into the full length DNA complement.
|
|
The accumulation of GFP-MS2 in the nucleus will result in strong nuclear fluorescence signals, which will delay or prevent the analysis of RNA nuclear localization because it will hinder the analysis of splicing, RNA editing, the nuclear export of RNA, and RNA translation. Moreover, due to the addition of the tag, the RNA secondary structure may introduce an artifact. Additionally, the small noncoding RNA (sRNA) expression levels and regulatory properties will be influenced by MS2 tag.
|
|
PMTV is (+)ssRNA virus with a tripartite genome. The longest segment of PMTV, RNA-rep encodes RNA dependent RNA polymerase and replicase subunits. The second segment, RNA-CP codes for virus coat protein (CP), and CP-RT or minor CP, which is produced by translational read-through of the CP stop codon. The third segment, RNA-TGB encodes triple gene block of movement proteins, TGB1, TGB2, TGB3, and 8K protein which is a viral suppressor of RNA silencing.
|
|
The resulting recombinant viruses may sometimes cause an outbreak of infection in humans, as in the case of SARS and MERS. Positive-strand RNA viruses are common in plants. In tombusviruses and carmoviruses, RNA recombination occurs frequently during replication. The ability of the RNA-dependent RNA polymerase of these viruses to switch RNA templates suggests a copy choice model of RNA recombination that may be an adaptive mechanism for coping with damage in the viral genome.
|
|
However, the Bacillus- plasmid RNA motif does not appear to be homologous to any such known RNA.
|
|
Therefore, a RNA transcript requiring extensive editing will need more than one guide RNA and editosome complex.
|
|
This DNA is transcribed into a full length, Terminally redundant, 35S RNA and a subgenomic 19S RNA.
|
|
He is known for his studies of RNA biochemistry. Some have called him the “Father of RNA.” His most widely accepted publications include those on the enzymatic synthesis of RNA from synthetic DNA. He has also researched RNA polymerases that are involved in the creation of DNA synthesis.
|
|
Several methods have been developed or adapted to detect, characterize, and quantify exRNA from biological samples. RT-PCR, cDNA microarrays, and RNA sequencing are common techniques for RNA analysis. Applying these methods to study exRNAs mainly differs from cellular RNA experiments in the RNA isolation and/or extraction steps.
|
|
These principles, occasionally dubbed "Turner Rules", are used in many RNA structure prediction algorithms. This has helped advance methods for predicting RNA structure from sequence, as well as RNA-RNA interactions: e.g. miRNA or siRNA target binding. Methods using the "Turner Rules" are widely used by biochemists and biologists.
|
|
MS2 biotin-tagged RNA affinity purification (MS2-BioTRAP) is one in vivo method of identifying protein-RNA interactions. Both the RNA that tagged with MS2 and the MS2 protein tag were expressed, and then, the affinity interaction was used to help the process of identifying protein-RNA interactions.
|
|
The IS128 RNA is a non-coding RNA found in bacteria such as Escherichia coli and Shigella flexneri. The RNA is 209 nucleotides in length. It is found between the sseA and sseB genes. The IS128 RNA was initially identified in a computational screen of the E. coli genome.
|
|
For some RNA viruses, the infecting RNA produces messenger RNA (mRNA). This is translation of the genome into protein products. For others with negative stranded RNA and DNA, viruses are produced by transcription then translation. The mRNA is used to instruct the host cell to make virus components.
|
|
Small nuclear RNA (snRNA) is a class of small RNA molecules that are found within the splicing speckles and Cajal bodies of the cell nucleus in eukaryotic cells. The length of an average snRNA is approximately 150 nucleotides. They are transcribed by either RNA polymerase II or RNA polymerase III. Their primary function is in the processing of pre-messenger RNA (hnRNA) in the nucleus.
|
|
The RNA-protein complexes are then separated from free RNA using gel electrophoresis and membrane transfer. Proteinase K digestion is then performed in order to remove protein from the RNA-protein complexes. This step leaves a peptide at the cross-link site, allowing for the identification of the cross-linked nucleotide. After ligating RNA linkers to the RNA 5' ends, cDNA is synthesized via RT-PCR.
|
|
This is followed by the transcription of these negative-sense subgenomic RNA molecules to their corresponding positive-sense mRNAs. The other important function of the replicase-transcriptase complex is to replicate the viral genome. RdRp directly mediates the synthesis of negative-sense genomic RNA from the positive-sense genomic RNA. This is followed by the replication of positive- sense genomic RNA from the negative-sense genomic RNA.
|
|
The function of ZGRF1 is unknown. Given this, the paralogs to the helicase core of the gene are associated with translation, transcription, nonsense-mediated mRNA decay, RNA decay, miRNA processing, RISC assembly, and pre-mRNA splicing. These paralogs operate under a SPF1 RNA helicase motif. Mov10, a paralog, and probable RNA helicase is required for RNA-mediated gene silencing by the RNA-induced silencing complex (RISC).
|
|
Gene activation involves that transcription of DNA information into molecules of RNA. This transcription involves the enzyme RNA polymerase. Cissé used transient-PALM to demonstrate that the lifetime of a RNA polymerase cluster impacts how many RNA messages are sent from a gene. He showed that clusters of almost 100 RNA polymerases form for around 10 seconds close to the sites of activating genes.
|
|
A DamID variant known as RNA-DamID can be used to detect interactions between RNA molecules and DNA. This method relies on the expression of a Dam-MCP fusion protein which is able to bind to an RNA that has been modified with MS2 stem-loops. Binding of the Dam-fusion protein to the RNA results in detectable methylation at sites of RNA binding to the genome.
|
|
Overall, RNA helps synthesize, regulate, and process proteins; it therefore plays a fundamental role in performing functions within a cell. In virology, the term may also be used when referring to mRNA synthesis from an RNA molecule (i.e., RNA replication). For instance, the genome of a negative-sense single-stranded RNA (ssRNA -) virus may be template for a positive-sense single-stranded RNA (ssRNA +).
|
|
As retroviral particles consistently have similar amounts of RNA, lack of genomic RNA in some viral particles must be supplemented by cellular RNA. When treated with RNase, retoviral cores are disrupted. Therefore, regardless of whether the NC domain of Gag needs assistance in assembling retroviruses, the RNA encapsidation (packaging) signal does ensure the presence of RNA material in the viral particles, which serve as important structural elements.
|
|
This family represents the SL1 RNA. The gene encoding SL1 RNA is commonly, but not always, located in the spacer region between 5S-rRNA genes. The SL1 RNA is involved in trans-splicing, which is a form of RNA processing. The acquisition of a spliced leader from an SL RNA is an inter-molecular reaction that precisely joins exons derived from separately transcribed RNAs.
|
|
Replication of the viral RNA begins with the migration of p28 to the mitochondrial membrane. p28 migrates to and invaginates the outer mitochondrial membrane; several p88 molecules are brought the newly formed vesicles. The viral RNA binds to the p28 bound to the membrane and the RNA dependent RNA polymerase, or p88, initiates replication of the positive strand RNA to produce a minus strand intermediate. The negative-strand intermediate is used as a template to produce progeny positive strand RNA.
|
|
The process of elongation is the synthesis of a copy of the DNA into messenger RNA. RNA Pol II matches complementary RNA nucleotides to the template DNA by Watson-Crick base pairing. These RNA nucleotides are ligated, resulting in a strand of messenger RNA. Unlike DNA replication, mRNA transcription can involve multiple RNA polymerases on a single DNA template and multiple rounds of transcription (amplification of particular mRNA), so many mRNA molecules can be rapidly produced from a single copy of a gene.
|
|
Similarly, proteins nsp7 and nsp8 form a hexadecameric sliding clamp as part of the complex which greatly increases the processivity of the RNA-dependent RNA polymerase. The coronaviruses require the increased fidelity and processivity during RNA synthesis because of the relatively large genome size in comparison to other RNA viruses. One of the main functions of the replicase-transcriptase complex is to transcribe the viral genome. RdRp directly mediates the synthesis of negative-sense subgenomic RNA molecules from the positive-sense genomic RNA.
|
|
OxyS RNA is induced in response to oxidative stress in Escherichia coli. The B2 RNA is a small noncoding RNA polymerase III transcript that represses mRNA transcription in response to heat shock in mouse cells. B2 RNA inhibits transcription by binding to core Pol II. Through this interaction, B2 RNA assembles into preinitiation complexes at the promoter and blocks RNA synthesis. A recent study has shown that just the act of transcription of ncRNA sequence can have an influence on gene expression.
|
|
Following entry into its host via mechanical inoculation, TMV uncoats itself to release its viral [+]RNA strand. As uncoating occurs, the MetHel:Pol gene is translated to make the capping enzyme MetHel and the RNA Polymerase. Then the viral genome will further replicate to produce multiple mRNAs via a [-]RNA intermediate primed by the tRNAHIS at the [+]RNA 3' end. The resulting mRNAs encode several proteins, including the coat protein and an RNA-dependent RNA polymerase (RdRp), as well as the movement protein.
|
|
Vault RNA was first identified as part of the vault ribonucleoprotein complex in 1986. Since the first discovery of non-coding RNA in the mid 1960s, there had been considerable interest in the field. The fruition of this interest was apparent in the 1980s during a string of non- coding RNA discoveries, such as Ribosomal RNA, snoRNA, Xist, and vault RNA. Early research in the 1990s looked into the specifics of vault RNA and focused around the conservation of the gene in animals.
|
|
The isolated RNA polymerases were again used for another round of evolution. After several rounds of evolution, they obtained one RNA polymerase ribozyme called 24-3 that was able to copy almost any other RNA, from small catalysts to long RNA based enzymes. Particular RNAs were amplified up to 10,000 times, a first RNA version of the polymerase chain reaction (PCR). ;Catalysis :The ability to catalyze simple chemical reactions—which would enhance creation of molecules that are building blocks of RNA molecules (i.e.
|
|
The earliest attempts to target RNA led to the discovery that aminoglycosides could bind to human RNA. In an early report, Noller discovered that several classes of antibiotics (streptomycin, tetracycline, spectinomycin, edeine, hygromycin, and the neomycins) could "protect" nucleotides in 16S ribosomal RNA by binding to this RNA. Subsequent studies by Schroeder and Green began to plant the seed that RNA could be targeted. Schroeder uncovered that aminoglycosides could inhibit protein synthesis by interacting with the ribosome through interactions with the 3’ end of the 16S RNA of E. coli taking advantage of RNA conformational changes.
|
|
The process of transcriptional termination is less understood in eukaryotes, which have extensive post-transcriptional RNA processing, and each of the three types of eukaryotic RNA polymerase have a different termination system. In RNA polymerase I, Transcription termination factor, RNA polymerase I binds downstream of the pre-rRNA coding regions, causing the dissociation of the RNA polymerase from the template and the release of the new RNA strand. In RNA polymerase II, the termination occurs via a polyadenylation/cleaving complex. The 3' tail on the ending of the strand is bound at the polyadenylation site, but the strand will continue to code.
|
|
Functionally during host invasion by viral RNA, it appears that s2m first binds one or more proteins as a mechanism for the viral RNA to substitute host protein synthesis. This has also been seen in s2m RNA macromolecular substitution of ribosomal RNA folds. The s2m RNA element are also effective targets for the design of anti-viral drugs. During COVID-19 pandemic in 2020, many genomic sequences of Australian SARS‐CoV‐2 isolates have deletions or mutations in the s2m, suggesting that RNA recombination events may have occurred in this RNA element of SARS-CoV-2.
|
|
Reverse transcription capability could have arisen as a secondary function of an early RNA dependent RNA polymerase ribozyme.
|
|
The genomes of these fungal viruses only encode an RNA-dependent RNA polymerase and have no structural proteins.
|
|
Members of Tombusviridae replicate in the cytoplasm, by use of negative strand templates. The replication process leaves a surplus of positive sense (+)RNA strands, and it is thought that not only does the viral RNA act as a template for replication, but is also able to manipulate and regulate RNA synthesis. The level of RNA synthesis has been shown to be affected by the cis-acting properties of certain elements on the RNA (such as RNA1 and 2), which include core promoter sequences which regulate the site of initiation for the complementary RNA strand synthesis. This mechanism is thought to be recognised by RNA-dependent RNA polymerase, found encoded within the genome.
|
|
SR proteins can increase genome stability by preventing the formation of R loops in the DNA strand that is actively being transcribed during transcription. SR protein SC35 has the ability to bind to the largest subunit of RNA polymerase II at the phosphorylated C-terminal domain. Once RNA polymerase II begins making the new RNA strand, SR proteins move from the C-terminal domain of the RNA polymerase II to the new RNA strand. The movement of SR proteins from the RNA polymerase II to the new RNA strand prevents the new RNA strand, which is complementary to the template DNA strand, from binding to the template DNA strand thus preventing R loops.
|
|
Taxonomy and replication strategies of different types of RNA viruses An RNA virus is a virus that has RNA (ribonucleic acid) as its genetic material. This nucleic acid is usually single-stranded RNA (ssRNA) but may be double-stranded RNA (dsRNA). Notable human diseases caused by RNA viruses include the common cold, influenza, SARS, COVID-19, Dengue Virus, hepatitis C, hepatitis E, West Nile fever, Ebola virus disease, rabies, polio and measles. The International Committee on Taxonomy of Viruses (ICTV) classifies RNA viruses as those that belong to Group III, Group IV or Group V of the Baltimore classification system of classifying viruses and does not consider viruses with DNA intermediates in their life cycle as RNA viruses.
|
|
Later, in her work with her husband at Massachusetts Institute of Technology, one of the vesicular stomatitis viruses (VSV) she studied made ribonucleic acid (RNA) from RNA instead of DNA (deoxyribonucleic acid), which did not follow the conventional central dogma: DNA RNA Protein. Her discovery of this VSV virion-associated RNA – dependent RNA polymerase led to Baltimore’s research on tumor viruses and the discovery of the enzyme called reverse transcriptase. This enzyme converted RNA to DNA, and became a major breakthrough in virology. In her postdoctoral work at the Salk Institute and MIT with David Baltimore, Dr. Huang worked on vesicular stomatitis virus (VSV) and discovered that these viruses had RNA-dependent RNA-polymerase.
|
|
The piwi domain is a protein domain found in piwi proteins and a large number of related nucleic acid-binding proteins, especially those that bind and cleave RNA. The function of the domain is double stranded-RNA-guided hydrolysis of single stranded-RNA that has been determined in the argonaute family of related proteins. Argonautes, the most well-studied family of nucleic-acid binding proteins, are RNase H-like enzymes that carry out the catalytic functions of the RNA-induced silencing complex (RISC). In the well-known cellular process of RNA interference, the argonaute protein in the RISC complex can bind both small interfering RNA (siRNA) generated from exogenous double-stranded RNA and microRNA (miRNA) generated from endogenous non-coding RNA, both produced by the ribonuclease Dicer, to form an RNA-RISC complex.
|
|
As an adenosine nucleoside triphosphate analog (GS-443902), the active metabolite of remdesivir interferes with the action of viral RNA-dependent RNA polymerase and evades proofreading by viral exoribonuclease (ExoN), causing a decrease in viral RNA production. In some viruses such as the respiratory syncytial virus it causes the RNA-dependent RNA polymerases to pause, but its predominant effect (as in Ebola) is to induce an irreversible chain termination. Unlike with many other chain terminators, this is not mediated by preventing addition of the immediately subsequent nucleotide, but is instead delayed, occurring after five additional bases have been added to the growing RNA chain. For the RNA-Dependent RNA Polymerase of MERS-CoV, SARS-CoV-1, and SARS-CoV-2 arrest of RNA synthesis occurs after incorporation of three additional nucleotides.
|
|
As described previously, the RNA molecule is cleaved within the bulge-helix- bulge. As the target RNA molecule and the exogenous RNA molecule are treated with the correct ligase, RNA chimeras form.Perkins, K. K., Furneaux, H. and Hurwitz, J., “Isolation and characterization of an RNA ligase from HeLa cells,” Proc. Natl. Acad. Sci. USA 82:684-688 (1985).Mattoccia, E., Baldi, M. I., Gandini-Attardi, D., Ciafrè, S. and Tocchini-Valentini, G. P., “Site selection by the tRNA splicing endonuclease of Xenopus laevis,” Cell 55:731-738 (1988) This results in the recombination of the target RNA and the exogenous RNA across the bulge-helix-bulge structure, thus this method can also be used for recombining RNA molecules in order to alter RNA function and hence gene expression.
|
|
After the mRNA is completed and cleaved off at the poly-A signal sequence, the left-over (residual) RNA strand remains bound to the DNA template and the RNA polymerase II unit, continuing to be transcribed. After this cleavage, a so- called exonuclease binds to the residual RNA strand and removes the freshly transcribed nucleotides one at a time (also called 'degrading' the RNA), moving towards the bound RNA polymerase II. This exonuclease is XRN2 (5'-3' Exoribonuclease 2) in humans. This model proposes that XRN2 proceeds to degrade the uncapped residual RNA from 5' to 3' until it reaches the RNA pol II unit. This causes the exonuclease to 'push off' the RNA pol II unit as it moves past it, terminating the transcription while also cleaning up the residual RNA strand.
|
|
Z-RNA is a left-handed alternative conformation for the RNA double helix. Just like for Z-DNA, Z-RNA is favored by a sequence composed of Purine/Pyrimidine repeats and especially CG repeats.
|
|
In contrast, purified RNA of a negative-sense virus is not infectious by itself as it needs to be transcribed into positive-sense RNA; each virion can be transcribed to several positive-sense RNAs. Ambisense RNA viruses resemble negative-sense RNA viruses, except they also translate genes from the positive strand.
|
|
The VA (viral associated) RNA is a type of non-coding RNA found in adenovirus. It plays a role in regulating translation. There are two copies of this RNA called VAI or VA RNAI and VAII or VA RNAII. These two VA RNA genes are distinct genes in the adenovirus genome.
|
|
Reverse transcribing viruses replicate their genomes by reverse transcribing DNA copies from their RNA; these DNA copies are then transcribed to new RNA. Retrotransposons also spread by copying DNA and RNA from one another, and telomerase contains an RNA that is used as template for building the ends of eukaryotic chromosomes.
|
|
Positive-strand RNA virus genomes usually contain relatively few genes, usually between three and ten, including an RNA- dependent RNA polymerase. Coronaviruses have the largest known RNA genomes, between 27 and 32 kilobases in length, and likely possess replication proofreading mechanisms in the form of an exoribonuclease within nonstructural protein nsp14.
|
|
Ribonucleic acid (RNA) occurs in different forms within organisms and serves many different roles. Listed here are the types of RNA, grouped by role. Abbreviations for the different types of RNA are listed and explained.
|
|
He researched the mechanismis of RNA splicing and RNA interference. His 2006 dissertation was titled Building the Drosophila RNA-induced silencing complex. Pham completed postdoctural studies at Harvard Medical School and Brigham and Women's Hospital.
|
|
The first part of Orthornavirae, the kingdom that RNA viruses belong to, comes from Greek ὀρθός [orthós], meaning straight, the middle part, rna, refers to RNA, and -virae is the suffix used for virus kingdoms.
|
|
RNA, 5S cluster 1, also known as RN5S1@, is a human gene encoding the 5S subunit of ribosomal RNA.
|
|
The Protein–RNA Interface Database (PRIDB) is a database of protein–RNA interfaces extracted from the Protein Data Bank.
|
|
RNA methylation is thought to have existed before DNA methylation in the early forms of life evolving on earth. N6-methyladenosine (m6A) is the most common and abundant methylation modification in RNA molecules (mRNA) present in eukaryotes. 5-methylcytosine (5-mC) also commonly occurs in various RNA molecules. Recent data strongly suggest that m6A and 5-mC RNA methylation affects the regulation of various biological processes such as RNA stability and mRNA translation, and that abnormal RNA methylation contributes to etiology of human diseases.
|
|
In addition to controlling the expression of certain genes, there are a variety of protein complexes, many with implications for human health, which only bind to methylated DNA recognition sites. Many of the early DNA methyltransferases have been thought to be derived from RNA methyltransferases that were supposed to be active in the RNA world to protect many species of primitive RNA. RNA methylation has been observed in different types of RNA species viz.mRNA, rRNA, tRNA, snoRNA, snRNA, miRNA, tmRNA as well as viral RNA species.
|
|
Introns are removed and exons joined together in the process of RNA splicing. An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene after introns have been removed by RNA splicing. The term exon refers to both the DNA sequence within a gene and to the corresponding sequence in RNA transcripts. In RNA splicing, introns are removed and exons are covalently joined to one another as part of generating the mature messenger RNA.
|
|
"CIRBP" : Structure of the CIRBP protein. As RNA- binding proteins exert significant control over numerous cellular functions, they have been a popular area of investigation for many researchers. Due to its importance in the biological field, numerous discoveries regarding RNA- binding proteins' potentials have been recently unveiled. Recent development in experimental identification of RNA-binding proteins has extended the number of RNA-binding proteins significantly RNA-binding protein Sam68 controls the spatial and temporal compartmentalization of RNA metabolism to attain proper synaptic function in dendrites.
|
|
Two RNA species with tightly regulated secondary structures are ribosomal RNA (rRNA) and transfer RNA (tRNA) which are essential in translation of mRNA to protein. If the variant disrupts the stability of the RNA secondary structure, the half-life of the RNA could be shortened thus lowering the concentration of RNA in the cell. Non-coding regions encompasses 99% of the human genome and region-based annotation is extremely useful in identifying variants in those regions. This approach can be used on WGS data.
|
|
Binding of rifampicin in the active site of RNA polymerase. Mutation of amino acids shown in red are involved in resistance to the antibiotic. Rifampicin inhibits bacterial DNA-dependent RNA synthesis by inhibiting bacterial DNA-dependent RNA polymerase. Crystal structure data and biochemical data suggest that rifampicin binds to the pocket of the RNA polymerase β subunit within the DNA/RNA channel, but away from the active site.
|
|
Alternatively, a frameshift may occur in the Core region to produce an alternate reading frame protein (ARFP). HCV encodes two proteases, the NS2 cysteine autoprotease and the NS3-4A serine protease. The NS proteins then recruit the viral genome into an RNA replication complex, which is associated with rearranged cytoplasmic membranes. RNA replication takes place via the viral RNA-dependent RNA polymerase NS5B, which produces a negative strand RNA intermediate.
|
|
The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase.
|
|
Though the mechanism is as of yet unclear, RNA-dependent RNA polymerase RrpC has been shown to post-transcriptionally silence retrotransposons in Dictyostelium.Wiegand, S., Meier, D., Seehafer, C., Malicki, M., Hofmann, P., Schmith, A., et al. (2014). The Dictyostelium discoideum RNA-dependent RNA polymerase RrpC silences the centromeric retrotransposon DIRS-1 post- transcriptionally and is required for the spreading of RNA silencing signals. [Article]. Nucleic Acids Research, 42(5), 3330-3345.
|
|
RNA-dominant diseases are characterized by deleterious mutations that typically result in degenerative disorders affecting various neurological, cardiovascular, and muscular functions. Studies have found that they arise from repetitive non-coding RNA sequences, also known as toxic RNA, which inhibit RNA-binding proteins leading to pathogenic effects. The most studied RNA-dominant diseases include, but are not limited to, myotonic dystrophy and fragile X-associated tremor/ataxia syndrome (FXTAS).
|
|
Nucleoside analogue inhibitors terminate the RNA synthesis essential for RNA replication. They do so by being incorporated by the RNA-dependent RNA polymerase, which prevents incoming nucleotides from being added to the RNA chain. It has been proposed that steric hindrance by the nucleoside inhibitors, which contain a 3’-hydroxyl group, is the reason for the chain termination. Because of this mechanism, nucleoside inhibitors are sometimes called chain terminating inhibitors.
|
|
In fact, the transcription of pre-RNA by RNA polymerase I accounts for about 60% of cell's total cellular RNA transcription. This is followed by the folding of the pre-RNA so that it can be assembled with ribosomal proteins. This folding is catalyzed by endo- and exonucleases, RNA helicases, GTPases and ATPases. The rRNA subsequently undergoes endo- and exonucleolytic processing to remove external and internal transcribed spacers.
|
|
In practice, many molecules are not referred to using this terminology due to more prevalent common names. For example, RNA polymerase is the modern common name for what was formerly known as RNA nucleotidyltransferase, a kind of nucleotidyl transferase that transfers nucleotides to the 3’ end of a growing RNA strand. In the EC system of classification, the accepted name for RNA polymerase is DNA-directed RNA polymerase.
|
|
The SdsR/RyeB RNA is a non-coding RNA that was identified in a large scale screen of E. coli. The exact 5′ and 3′ ends of this RNA are uncertain. This RNA overlaps the SraC/RyeA RNA on the opposite strand suggesting that the two may act in a concerted manner. It is transcribed by general stress factor σs and is most highly expressed in stationary phase.
|
|
The RprA RNA gene encodes a 106 nucleotide regulatory non-coding RNA. Translational regulation of the stationary phase sigma factor RpoS is mediated by the formation of a double-stranded RNA stem-loop structure in the upstream region of the rpoS messenger RNA, occluding the translation initiation site. Clones carrying rprA (RpoS regulator RNA A) increased the translation of RpoS. As with DsrA, RprA is predicted to form three stem-loops.
|
|
The DNA sequence also dictates where termination of RNA synthesis will occur. Primary transcript RNAs are often modified by enzymes after transcription. For example, a poly(A) tail and a 5' cap are added to eukaryotic pre-mRNA and introns are removed by the spliceosome. There are also a number of RNA-dependent RNA polymerases that use RNA as their template for synthesis of a new strand of RNA.
|
|
As the NP protein accumulates, the transition from the transcription to the replication occurs. The NP protein encapsidates the genomic RNA, forming a helical nucleocapsid which is the template for RNA synthesis by the viral RNA polymerase. The protein is a crusial component of the following complexes NP-P (P, phosphoprotein), NP-NP, nucleocapsid- polymerase, and RNA-NP. All these complexes are needed for the viral RNA replication.
|
|
NS3 has enzymatic activity as a helicase and protease, while NS5 is an RNA dependent RNA polymerase, allowing the virus to replicate a new (+)RNA genome by creating a complementary (-)RNA strand and using that as a template for the genome. The other non-structural proteins function in RNA replication, viral assembly and release, processing the viral polyprotein and inhibiting the host’s innate immunity, like inhibiting interferon signaling.
|
|
Barkan has also discovered and named the CRM (chloroplast RNA splicing and ribosome maturation) domain, which is found in nucleus-encoded proteins required for chloroplast RNA splicing. In 2019, Barkan and colleagues successfully constructed PPR proteins that bound specific RNA sequences in vivo, thus establishing a system for creating targeted protein-RNA interactions.
|
|
VS RNA is transcribed as a multimeric transcript from VS DNA. VS DNA contains a region coding reverse transcriptase necessary for replication of the VS RNA. Once transcribed VS RNA undergoes a site specific cleavage. VS RNA self-cleaves at a specific phosphodiester bond to produce a monomeric and few mutimeric transcripts.
|
|
Spiegelman introduced RNA from a simple bacteriophage Qβ (Qβ) into a solution which contained Qβ's RNA replicase, some free nucleotides, and some salts. In this environment, the RNA started to be replicated. After a while, Spiegelman took some RNA and moved it to another tube with fresh solution. This process was repeated.
|
|
The Mostly Independently Structured, Large RNA motif (MISL RNA motif) is a conserved RNA structure that was discovered by bioinformatics. The MISL motif is found in Verrucomicrobia. MISL RNAs likely function in trans as small RNAs, and average roughly 780 nucleotides in length. In comparison to other similarly sized RNA motifs (e.g.
|
|
TCL1 upstream neural differentiation-associated RNA is a long noncoding RNA that in humans is produced from the TUNAR gene.
|
|
The process of transcription is carried out by RNA polymerase (RNAP), which uses DNA (black) as a template and produces RNA (blue). The production of a RNA copy from a DNA strand is called transcription, and is performed by RNA polymerases, which add one ribonucleotide at a time to a growing RNA strand as per the complementarity law of the nucleotide bases. This RNA is complementary to the template 3′ → 5′ DNA strand, with the exception that thymines (T) are replaced with uracils (U) in the RNA. In prokaryotes, transcription is carried out by a single type of RNA polymerase, which needs to bind a DNA sequence called a Pribnow box with the help of the sigma factor protein (σ factor) to start transcription.
|
|
The bamboo mosaic virus satellite RNA cis-regulatory element is an RNA element found in the 5' UTR of the genome of the bamboo mosaic virus. This element is thought to be essential for efficient RNA replication.
|
|
Enhancers as sites of extragenic transcription were initially discovered in genome-wide studies that identified enhancers as common regions of RNA polymerase II (RNA pol II) binding and non-coding RNA transcription. The level of RNA pol II–enhancer interaction and RNA transcript formation were found to be highly variable among these initial studies. Using explicit chromatin signature peaks, a significant proportion (~70%) of extragenic RNA Pol II transcription start sites were found to overlap enhancer sites in murine macrophages. Out of 12,000 neuronal enhancers in the mouse genome, almost 25% of the sites were found to bind RNA Pol II and generate transcripts.
|
|
Analysis of mature eukaryotic messenger RNA molecules showed that they are often much smaller than the DNA sequences that encode them. The genes were shown to be discontinuous, composed of sequences that are not present in the final mature RNA (introns), located between sequences that are retained in the mature RNA (exons). Introns were shown to be removed after transcription through a process termed RNA splicing. Splicing of RNA transcripts requires a highly precise and coordinated sequence of molecular events, consisting of (a) definition of boundaries between exons and introns, (b) RNA strand cleavage at exactly those sites, and (c) covalent linking (ligation) of the RNA exons in the correct order.
|
|
262x262px Ribosomal ribonucleic acid (rRNA) is a type of non-coding RNA which is the primary component of ribosomes, essential to all cells. rRNA is a ribozyme that contains a short (70-90 nucleotides), stable RNA with extensive intramolecular base pairing; containing an amino acid binding site and an mRNA binding site. rRNA is the physical and mechanical factor of the ribosome that forces transfer RNA (tRNA) and messenger RNA (mRNA) to process and translate the latter into proteins. Ribosomal RNA is the predominant form of RNA found in most cells; it makes up about 80% of cellular RNA despite never being translated into proteins itself.
|
|
These modifications happen to many types of cellular RNA including, but not limited to, ribosomal RNA (rRNA), transfer RNA (tRNA), messenger RNA (mRNA), and small nuclear RNA (snRNA). The most common and well- understood mRNA modification at present is N6-Methyladenosine (m6A), which has been observed to occur an average of three times in every mRNA molecule. Currently, work is focused on determining the types of and location of RNA modifications, determining if these modification have function, and if so, what is their mechanism of action. Similar to the epigenome, the epitranscriptome has "writers" and "erasers" that mark RNA and "readers" that translate those marks into function.
|
|
These are the only animal viruses within the order Mononegavirales to do this. Many plant rhabdoviruses replicate in the nucleus. Bornaviruses have negative sense RNA genomes The negative sense RNA is copied to make a positive sense RNA template. This template is then used to synthesise many copies of the negative sense RNA genome.
|
|
The Ocean-V RNA motif is a conserved RNA structure discovered using bioinformatics. Only a few Ocean-V RNA sequences have been detected, all in sequences derived from DNA that was extracted from uncultivated bacteria found in ocean water. As of 2010, no Ocean-V RNA has been detected in any known, cultivated organism.
|
|
DNA-directed RNA polymerases I, II, and III subunit RPABC4 is a protein that in humans is encoded by the POLR2K gene. This gene encodes one of the smallest subunits of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA- directed RNA polymerases.
|
|
Since RNA is charged, metal ions such as Mg2+ are needed to stabilise many secondary and tertiary structures. The naturally occurring enantiomer of RNA is D-RNA composed of D-ribonucleotides. All chirality centers are located in the D-ribose. By the use of L-ribose or rather L-ribonucleotides, L-RNA can be synthesized.
|
|
The genome structure is 5'UTR-L-VP2-(VP4)-VP1-VP3-RNA helicase-(VPg)-3C protease-RNA dependent RNA polymerase-3'UTR The putative VP4 and VPg proteins are marked here by parentheses. If the VPg is present in the genome a copy will be bound to the 5' end of the RNA genome.
|
|
The core RNA polymerase (consisting of 2 alpha (α), 1 beta (β), 1 beta-prime (β'), and 1 omega (ω) subunits) binds a sigma factor to form a complex called the RNA polymerase holoenzyme. It was previously believed that the RNA polymerase holoenzyme initiates transcription, while the core RNA polymerase alone synthesizes RNA. Thus, the accepted view was that sigma factor must dissociate upon transition from transcription initiation to transcription elongation (this transition is called "promoter escape"). This view was based on analysis of purified complexes of RNA polymerase stalled at initiation and at elongation.
|
|
RBPs interact with RNA through various structural motifs. Aromatic amino acid residues in RNA-binding proteins result in stacking interactions with RNA. Lysine residues in the helical portion of RNA binding proteins help to stabilize interactions with other nucleic acids as a result of the force of attraction between the positively-charged lysine side chains and the negatively-charged phosphate "backbone" of RNA. It is hypothesized that RNA sequences in the 3'-untranslated region determine the binding of RBPs, and that these RBPs determine the post-transcriptional fate of mRNAs.
|
|
The 23S methyl RNA motif is a conserved RNA structure found upstream of genes predicted to encode rRNA methyltransferases, possibly for 23S rRNA. However, in one case it is far (3 kilobases) from the rRNA methyltransferase gene. Nonetheless, it was proposed that this RNA could be a cis-regulatory element, an attractive hypothesis in view of the fact that rRNA methyltransferases can bind RNA, and therefore presumably the 23S methyl RNA. This regulatory strategy is common in bacteria to control levels of ribosomal subunits, using RNA motifs called ribosomal leaders.
|
|
VSV entered a host cell as a single negative strand of RNA, but brought with it RNA polymerase to stimulate the processes of transcription and replication of more RNA. Baltimore extended this work and examined two RNA tumor viruses, Rauscher murine leukemia virus and Rous sarcoma virus. He went on to discover reverse transcriptase (RTase or RT) – the enzyme that polymerizes DNA from an RNA template. In doing so, he discovered a distinct class of viruses, later name retroviruses, that use an RNA template to catalyze synthesis of viral DNA.
|
|
187-226, doi:10.1016/S0079-6603(04)78005-8 Tombusviridae have been found to co-opt GAPDH, a host metabolic enzyme, for use in the replication center. GAPDH may bind to the (−)RNA strand and keep it in the replicase complex, allowing (+)RNA strands synthesized from it to be exported and accumulate in the host cell. Downregulation of GAPDH reduced viral RNA accumulation, and eliminated the surplus of (+)RNA copies.Wang, R. and Nagy, P. (2008) Tomato bushy stunt virus Co-Opts the RNA-Binding Function of a Host Metabolic Enzyme for Viral Genomic RNA Synthesis.
|
|
Arcturus Therapeutics is an American biotech company focused on the discovery, development and commercialization of therapeutics for rare diseases with focus on RNA. Arcturus has developed a novel, potent and safe RNA therapeutics platform called LUNAR, a proprietary lipid-enabled delivery system for RNA medicines including small interfering RNA, messenger RNA, gene editing, DNA, antisense, and microRNA oligotherapeutics. The company’s pipeline includes RNA therapeutics towards rare diseases such as ornithine transcarbamylase deficiency (OTCD), and respiratory diseases such as cystic fibrosis. Vaccine medicines include a vaccine candidate for COVID-19.
|
|
There have been furious debates on whether the issue of RNA quality control does exist. However, with the concern of various lengths of half lives of diverse RNA species ranging from several minutes to hours, degradation of defective RNA can not easily be attributed to its transient character anymore. Indeed, reaction with ROS takes only few minutes, which is even shorter than the average life-span of the most unstable RNAs. Adding the fact that stable RNA take the lion’s share of total RNA, RNA error deleting becomes hypercritical and should not be neglected anymore.
|
|
RNA sequencing is a next-generation sequencing technology; as such it requires only a small amount of RNA and no previous knowledge of the genome. It allows for both qualitative and quantitative analysis of RNA transcripts, the former allowing discovery of new transcripts and the latter a measure of relative quantities for transcripts in a sample. The three main steps of sequencing transcriptomes of any biological samples include RNA purification, the synthesis of an RNA or cDNA library and sequencing the library. The RNA purification process is different for short and long RNAs.
|
|
Much to their surprise, they found that RNase-P contained RNA in addition to protein and that RNA was an essential component of the active enzyme. This was such a foreign idea that they had difficulty publishing their findings. The following year, Altman demonstrated that RNA can act as a catalyst by showing that the RNase-P RNA subunit could catalyze the cleavage of precursor tRNA into active tRNA in the absence of any protein component. Since Cech's and Altman's discovery, other investigators have discovered other examples of self-cleaving RNA or catalytic RNA molecules.
|
|
RNA run on a formaldehyde agarose gel to highlight the 28S (top band) and 18S (lower band) ribosomal subunits. The RNA samples are most commonly separated on agarose gels containing formaldehyde as a denaturing agent for the RNA to limit secondary structure. The gels can be stained with ethidium bromide (EtBr) and viewed under UV light to observe the quality and quantity of RNA before blotting. Polyacrylamide gel electrophoresis with urea can also be used in RNA separation but it is most commonly used for fragmented RNA or microRNAs.
|
|
The genome is a linear segmented genome that is 11,467 nucleotides long and is composed of three negative single strand RNA sequences. RNA one is the longest RNA sequence and contains two open reading frames (ORFs) that encode two proteins. The proteins encoded include a 23 kDa protein that has an unknown function and a 272 kDa RdRp (RNA-dependent RNA polymerase) replicase. The presence of these two ORFs in the largest RNA strand and the two ORF's having the same polarity is a key genomic feature of Ophioviridae.
|
|
TectoRNAs are modular RNA units able to self-assemble into larger nanostructures in a programmable fashion. They are generated by rational design through an approach called RNA architectonics, which make use of RNA structural modules identified in natural (or sometimes artificial) RNA molecules to form pre-defined 3D structures spontaneously. The abilities of RNA which is capable of catalysis and non-canonical base pairing make it an attractive biomolecule for design. By applying the knowledge of computational modeling and biochemical characterization, RNA can be shaped into defined geometries and conduct various functions.
|
|
Additionally, the DNA origami's molecular breakup is not easily incorporated into the genetic material of an organism. However, RNA origami is capable of being written directly as a DNA gene and transcribed using RNA polymerase. Therefore, while DNA origami requires expensive culturing outside of a cell, RNA origami can be produced in mass, cheap quantities directly within cells just by growing bacteria. The feasibility and cost effectiveness of manufacturing RNA in living cells and combined with the extra functionality of RNA structure is promising for the development of RNA origami.
|
|
RNAs that were identified in environmental sequence samples include the IMES-1, IMES-3, IMES-4, Whalefall-1, potC, Termite-flg and Gut-1 RNA motifs. These RNA structures have not been detected in the genome of any known species. The IMES-2 RNA motif, GOLLD RNA motif and manA RNA motif were discovered using environmental DNA or RNA sequence samples, and are present in a small number of known species. Additional non- coding RNAs are predicted in marine environments, although no specific conserved secondary structures have been published for these other candidates.
|
|
Prior to inactivation, both X chromosomes weakly express Xist RNA from the Xist gene. During the inactivation process, the future Xa ceases to express Xist, whereas the future Xi dramatically increases Xist RNA production. On the future Xi, the Xist RNA progressively coats the chromosome, spreading out from the XIC; the Xist RNA does not localize to the Xa. The silencing of genes along the Xi occurs soon after coating by Xist RNA. Like Xist, the Tsix gene encodes a large RNA which is not believed to encode a protein.
|
|
DUF3800 RNA motifs refer to conserved RNA structures that were discovered by bioinformatics and are usually located nearby to genes that encode proteins containing the conserved domain called "DUF3800". However, the gene can be located 5′ or 3′ relative to the RNA, and could be on the same or on the opposite DNA strand. This arrangement is typical of RNA and proteins that function as an RNA-protein complex, but could have other explanations. The function of this protein domain is unknown, and no specific biological function has been proposed for the RNA.
|
|
Viral genomes can be composed of either RNA or DNA. The genomes of RNA viruses can be either single-stranded RNA or double-stranded RNA, and may contain one or more separate RNA molecules (segments: monopartit or multipartit genome). DNA viruses can have either single-stranded or double-stranded genomes. Most DNA virus genomes are composed of a single, linear molecule of DNA, but some are made up of a circular DNA molecule.
|
|
Newly synthesized RNA is labeled with a reactive thiol group, making it possible to link useful molecules to the RNA. Biotin is a popular molecule for use in this type of assay, as it is inexpensive and binds incredibly strongly and selectively to streptavidin. Incubation of biotinylated RNA with beads containing streptavidin allows for the selective purification of newly synthesized RNA. From here, newly synthesized and total RNA are sequenced separately and compared for differences.
|
|
Chemical structure of RNA. The sequence of bases differs between RNA molecules. :For further information, see RNA and Messenger RNA RNAs are a type of large biological molecules, whose individual building blocks are called nucleotides. The name poly(A) tail (for polyadenylic acid tail) reflects the way RNA nucleotides are abbreviated, with a letter for the base the nucleotide contains (A for adenine, C for cytosine, G for guanine and U for uracil).
|
|
This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of bacteriophage (including T7 RNA polymerase), mitochondrial polymerases of lower eukaryotes as well as chloroplastic RpoT polymerases.
|
|
It is made from the first promoter until the plasmid reaches its copy number, upon which the protein CopB represses this primary promoter. RepA expression is also regulated post-transcriptionally from the secondary promoter by an antisense RNA called CopA. CopA interacts with its RNA target in the RepA mRNA and forms a kissing complex and then a RNA-RNA duplex. The resultant double stranded RNA is cleaved by RNase III, preventing synthesis of RepA.
|
|
Whenever a segment of Z-DNA forms, there must be B–Z junctions at its two ends, interfacing it to the B-form of DNA found in the rest of the genome. In 2007, the RNA version of Z-DNA, Z-RNA, was described as a transformed version of an A-RNA double helix into a left-handed helix. The transition from A-RNA to Z-RNA, however, was already described in 1984.
|
|
A typical protein-coding gene is first copied into RNA as an intermediate in the manufacture of the final protein product. In other cases, the RNA molecules are the actual functional products, as in the synthesis of ribosomal RNA and transfer RNA. Some RNAs known as ribozymes are capable of enzymatic function, and microRNA has a regulatory role. The DNA sequences from which such RNAs are transcribed are known as non- coding RNA genes.
|
|
RNA polymerase then starts to synthesize the initial DNA-RNA heteroduplex, with ribonucleotides base-paired to the template DNA strand according to Watson- Crick base-pairing interactions. As noted above, RNA polymerase makes contacts with the promoter region. However these stabilizing contacts inhibit the enzyme's ability to access DNA further downstream and thus the synthesis of the full-length product. In order to continue RNA synthesis, RNA polymerase must escape the promoter.
|
|
Our lab is involved in characterising the pathways that mediate and control DNA, RNA and histone modifications. We try to understand the cellular processes they regulate, their mechanism of action and their involvement in cancer. Our focus at the moment is modifications of messenger RNA (mRNA) and non-coding RNA. There are very few modifications identified on these low- abundance RNAs, unlike on transfer RNA and ribosomal RNA, where there are many.
|
|
The technique utilizes native ADAR enzymes (pictured with RNA). LEAPER (Leveraging endogenous ADAR for programmable editing of RNA) is a genetic engineering technique in molecular biology by which RNA can be edited. The technique relies on engineered strands of RNA to recruit native ADAR enzymes to swap out different compounds in RNA. Developed by researchers at Peking University in 2019, the technique, some have claimed, is more efficient than the CRISPR gene editing technique.
|
|
The RNA-binding Proteins Database (RBPDB) is a biological database of RNA- binding protein specificities that includes experimental observations of RNA- binding sites. The experimental results included are both in vitro and in vivo from primary literature. It includes four metazoan species, which are Homo sapiens, Mus musculus, Drosophila melanogaster, and Caenorhabditis elegans. RNA-binding domains included in this database are RNA recognition motif, K homology, CCCH zinc finger, and more domains.
|
|
Shorter RNA chains were able to be replicated faster, so the RNA became shorter and shorter as selection favored speed. After 74 generations, the original strand with 4,500 nucleotide bases ended up as a dwarf genome with only 218 bases. This short RNA sequence replicated very quickly in these unnatural circumstances. M. Sumper and R. Luce of Eigen's laboratory replicated the experiment, except without adding RNA, only RNA bases and Qβ replicase.
|
|
Even so, the evidence for an RNA world is strong enough that the hypothesis has gained wide acceptance. The concurrent formation of all four RNA building blocks further strengthened the hypothesis. Like DNA, RNA can store and replicate genetic information; like protein enzymes, RNA enzymes (ribozymes) can catalyze (start or accelerate) chemical reactions that are critical for life. One of the most critical components of cells, the ribosome, is composed primarily of RNA.
|
|
RNA origami is a new concept and has great potential for applications in nanomedicine and synthetic biology. The method was developed to allow new creations of large RNA nanostructures that create defined scaffolds for combining RNA based functionalities. Because of the infancy of RNA origami, many of its potential applications are still in the process of discovery. Its structures are able to provide a stable basis to allow functionality for RNA components.
|
|
The Extended-Gap, in Firmicutes and One Actiobacterium RNA motif (EGFOA RNA motif) is a conserved RNA structure that was discovered by bioinformatics. EGFOA motifs are found in Firmicutes and one example was detected in Actinobacteria. The EGFOA-assoc-1 and EGFOA-assoc-2 RNA motifs are conserved RNA structures that are often located nearby to EGFOA RNAs, and presumably functions in some related mechanism. EGFOA RNAs likely function in trans as small RNAs.
|
|
IS605-orfB RNA motifs refer to conserved RNA or DNA structures that were discovered by bioinformatics. Although such motifs were published as a RNA candidates, there is some reason to suspect that they might function as a single-stranded DNA. In terms of secondary structure, RNA and DNA are difficult to distinguish when only sequence information is available. If the motifs function as RNA, they likely are small RNAs, that are independently transcribed.
|
|
Similarly, RNA triple helices are formed as a result of a single stranded RNA forming hydrogen bonds with an RNA duplex; the duplex consists of Watson-Crick base pairing while the third strand binds via Hoogsteen base pairing.
|
|
The availability of purified preparations of RNA polymerase permitted investigators to develop a wide range of novel methods for studying RNA in the test tube, and led directly to many of the subsequent key discoveries in RNA biology.
|
|
The C0299 RNA family consists of a group of Shigella flexneri and Escherichia coli RNA genes which are 78 bases in length and are found between the hlyE and umuD genes. The function of this RNA is unknown.
|
|
As the result, RBPs can bind RNA with higher specificity and affinity than single domain. RNA-binding protein database has three main specific categories. They are RNA recognition motif (RRM), K-Homology domain (KH domain) and zinc fingers.
|
|
Another motif predicted by bioinformatics is typically located upstream of DUF2693-encoding genes: the DUF2693 RNA motif. However, no case has been observed in which a DUF2693 RNA and a DUF2693-FD RNA flank the same specific gene.
|
|
This list of RNA structure prediction software is a compilation of software tools and web portals used for RNA structure prediction.
|
|
Once fusion is complete, the viral genome, accessory proteins, and RNA dependent RNA polymerase are released into the host cell cytoplasm.
|
|
DNA viruses have genomes consisting of deoxyribonucleic acid (or DNA), while RNA viruses, like Coltivirus, have an RNA (ribonucleic acid) genome.
|
|
Small nucleolar RNA host gene 1 is a non-protein coding RNA that in humans is encoded by the SNHG1 gene.
|
|
Long intergenic non-protein coding RNA 900 is a Non-coding RNA that in humans is encoded by the LINC00900 gene.
|
|
The Lacto-rpoB RNA motif is a conserved RNA structure identified by bioinformatics. It has been detected only in lactic acid bacteria, and is always located in the presumed 5' untranslated regions of rpoB genes. These genes encode a subunit of RNA polymerase, and it is hypothesized that Lacto- rpoB RNA participate in the regulation of these genes.
|
|
Long-RNA transfection is the process of deliberately introducing RNA molecules longer than about 25nt into living cells. A distinction is made between short- and long-RNA transfection because exogenous long RNA molecules elicit an innate immune response in cells that can cause a variety of nonspecific effects including translation block, cell-cycle arrest, and apoptosis.
|
|
In addition to inhibiting gene expression, splicing ribozymes can be used to repair damaged or defective RNA. Splicing ribozymes catalyze RNA splicing, removing a section of RNA that contains a mutation and replacing it with well-functioning RNA. Existing ribozymes can also be altered in a way that changes the reaction(s) that the ribozyme catalyzes.
|
|
When sequencing RNA other than mRNA, the library preparation is modified. The cellular RNA is selected based on the desired size range. For small RNA targets, such as miRNA, the RNA is isolated through size selection. This can be performed with a size exclusion gel, through size selection magnetic beads, or with a commercially developed kit.
|
|
16S rRNA pseudouridine516 synthase (, 16S RNA pseudouridine516 synthase, 16S PsiI516 synthase, 16S RNA Psi516 synthase, RNA pseudouridine synthase RsuA, RsuA, 16S RNA pseudouridine 516 synthase) is an enzyme with systematic name 16S rRNA-uridine516 uracil mutase. This enzyme catalyses the following chemical reaction : 16S rRNA uridine516 \rightleftharpoons 16S rRNA pseudouridine516 The enzyme is specific for uridine516 in 16S rRNA.
|
|
They also play an important role in sensing viral RNAs. RNA helicases are involved in the mediation of antiviral immune response because they can identify foreign RNAs in vertebrates. About 80% of all viruses are RNA viruses and they contain their own RNA helicases. Defective RNA helicases have been linked to cancers, infectious diseases and neuro-degenerative disorders.
|
|
This is because thymidine is found in deoxyribonucleic acid (DNA) and not ribonucleic acid (RNA). Conversely, uridine is found in RNA and not DNA. The remaining three nucleosides may be found in both RNA and DNA. In RNA, they would be represented as A, C and G whereas in DNA they would be represented as dA, dC and dG.
|
|
A transcript is an RNA molecule that is copied or transcribed from a DNA template. A transcript can be further processed by alternative splicing, which is the retention of different combinations of exons. These unique combinations of exons are termed RNA transcript isoforms. The transcriptome is a set of all RNA, including rRNA, mRNA, tRNA, and non-coding RNA.
|
|
The function of the S4 domain is to be an RNA-binding protein. S4 is a multifunctional protein, and it must bind to the 16S ribosomal RNA. In addition, the S4 domain binds a complex pseudoknot and represses translation. More specifically, this protein domain delivers nucleotide-modifying enzymes to RNA and to regulates translation through structure specific RNA binding.
|
|
The RNA that results from RNA splicing is a sequence of exons. The reason why introns are not considered untranslated regions is that the introns are spliced out in the process of RNA splicing. The introns are not included in the mature mRNA molecule that will undergo translation and are thus considered non-protein- coding RNA.
|
|
Transcriptomic biomarkers analyze all RNA molecules, not solely the exome. Transcriptomic biomarkers reveal the molecular identity and concentration of RNA in a specific cell or population. Pattern-based RNA expression analysis provides increased diagnostic and prognostic capability in predicting therapeutic responses for individuals. For example, distinct RNA subtypes in breast cancer patients have different survival rates.
|
|
ADAR : an RNA binding protein involved in RNA editing events. The most extensively studied form of RNA editing involves the ADAR protein. This protein functions through post-transcriptional modification of mRNA transcripts by changing the nucleotide content of the RNA. This is done through the conversion of adenosine to inosine in an enzymatic reaction catalyzed by ADAR.
|
|
Replicase-transcriptase complex A number of the nonstructural proteins coalesce to form a multi-protein replicase-transcriptase complex. The main replicase-transcriptase protein is the RNA-dependent RNA polymerase (RdRp). It is directly involved in the replication and transcription of RNA from an RNA strand. The other nonstructural proteins in the complex assist in the replication and transcription process.
|
|
The RydB RNA is a non-coding RNA originally identified in E. coli in an RNA screen. This gene is only 67 nucleotides in length and is composed of a hairpin like structure. RydB lies between the ydiC and ydiH in E. coli. Homologous RNA genes have been found in other species such as Shigella flexneri and Salmonella species.
|
|
The Alfalfa mosaic virus (AMV) coat protein binding (CPB) RNA is an RNA element which is found in the 3′ UTR of the genome. AMV CPB can stimulate the translation of AMV RNA by between 50 and 100-fold. This family contains at least two coat protein binding sites which are thought to be essential for efficient RNA translation.
|
|
The lentivirus group appears to be basal to all the remaining RNA viruses. The next major division lies between the picornasupragroup and the remaining viruses. The dsRNA viruses appear to have evolved from a +ve RNA ancestor and the -ve RNA viruses from within the dsRNA viruses. The closest relation to the -ve stranded RNA viruses is the Reoviridae.
|
|
Jack D. Keene (born June 22, 1947, Jacksonville, Florida) is a James B. Duke Professor of Molecular Genetics and Microbiology at Duke University. Keene studies the regulation of RNA and the mechanisms of RNA-protein interactions. He identified RNA recognition motif (RRM) proteins, which are the largest family of RNA-binding proteins. He isolated the first human autoimmune antigen.
|
|
DNA is composed of base pairs in which adenine pairs with thymine and guanine pairs with cytosine. While DNA serves as template for production of ribonucleic acid (RNA), RNA is usually responsible for making protein. The process of making RNA from DNA is called transcription. RNA uses a similar set of bases except that thymine is replaced with uracil.
|
|
The Acido-1 RNA motif is a conserved RNA structure identified by bioinformatics. It is found only in acidobacteria, and appears to be a non- coding RNA as it does not have a consistent association with protein-coding genes.
|
|
Like other amatoxins, proamanullin is an inhibitor of RNA polymerase II. Promanullin has a specific attraction to the enzyme RNA polymerase II. Upon ingestion, it binds to the RNA polymerase II enzyme, effectively causing cytolysis of hepatocytes (liver cells).
|
|
The asymptomatic GpSGHV infection state represents either a sub-lethal persistence or latency. Host's RNA interference (RNAi) machineries such as the small interfering RNA (siRNA) and micro RNA (miRNA) pathways have been implicated in keeping GpSGHV infections under control,.
|
|
Long intergenic non-protein coding RNA 674 is a Long non-coding RNA in humans that is encoded by the LINC00674 gene.
|
|
RNA thermometers in modern organisms may be molecular fossils which could hint at a previously more widespread importance in an RNA world.
|
|
The primary challenge associated with RNA origami stems from the fact RNA folds on its own and can thus easily tangle itself.
|
|
Long intergenic non-protein coding RNA 520 is a long non-coding RNA that in humans is encoded by the LINC00520 gene.
|
|
Facilitates RNA-dependent RNA polymerase attachment and recruits M2 protein. M1- Matrix protein. Facilitates nucleocapsid and envelope interactions. M2-1- Matrix protein.
|
|
A schematic figure explaining the steps in a typical chemical probing experiment to assay the structure of RNA molecules. RNA chemical probing uses chemicals that react with RNAs. Importantly, their reactivity depends on local RNA structure e.g. base-pairing or accessibility.
|
|
Integrase 'integrates' retrotransposon DNA into eukaryotic genome DNA. Ribonuclease cleaves phosphodiester bonds between RNA nucleotides. LTR retrotransposons encode transcripts with tRNA binding sites so that they can undergo reverse transcription. The tRNA-bound RNA transcript binds to a genomic RNA sequence.
|
|
DEAD box proteins are considered to be RNA helicases and many have been found to be required in cellular processes such as RNA metabolism, including nuclear transcription, pre mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression.
|
|
CircRNA biogenesis. A. mRNA splicing, with alternative splice variants. All mRNAs have cap and polyA tail. B. CircRNA formation via backsplicingCircular RNA (or circRNA) is a type of single-stranded RNA which, unlike linear RNA, forms a covalently closed continuous loop.
|
|
Hanold and Randles, 1991. In CCCVd, changes in molecular forms are related to the steps of the disease. There are four different RNAs found in CCCVd, two of them fast and the other two slow (the difference between fast and slow RNA is their mobilities in electrophoresis gel). In the early stages of the disease, RNA fast 1 and RNA fast 2 appear, while in the late stages RNA slow 1 and RNA slow 2 are detected.
|
|
A pre-cell (or protocell) is a hypothetical lipid-based structure that, under the RNA world hypothesis, could have confined RNA in ancient times. A pre-cell allowed the RNA to remain in close proximity with other RNA molecules, keeping them concentrated and allowing for an increased reaction rate of enzymes. Pre- cells would have had semi-permeable membranes, allowing only certain molecules to pass through. These enclosed structures may have facilitated natural selection in RNA molecules.
|
|
The degradosome is a multiprotein complex present in most bacteria that is involved in the processing of ribosomal RNA and the degradation of messenger RNA and is regulated by Non-coding RNA. It contains the proteins RNA helicase B, RNase E and Polynucleotide phosphorylase. The store of cellular RNA in the cells is constantly fluctuating. For example, in Escherichia coli, Messenger RNA's life expectancy is between 2 and 25 minutes, in other bacteria it might last longer.
|
|
For some RNA (non-coding RNA) the mature RNA is the final gene product. In the case of messenger RNA (mRNA) the RNA is an information carrier coding for the synthesis of one or more proteins. mRNA carrying a single protein sequence (common in eukaryotes) is monocistronic whilst mRNA carrying multiple protein sequences (common in prokaryotes) is known as polycistronic. During the translation, tRNA charged with amino acid enters the ribosome and aligns with the correct mRNA triplet.
|
|
It has been shown that 7SK RNA, a metazoan ncRNA, acts as a negative regulator of the RNA polymerase II elongation factor P-TEFb, and that this activity is influenced by stress response pathways. The bacterial ncRNA, 6S RNA, specifically associates with RNA polymerase holoenzyme containing the sigma70 specificity factor. This interaction represses expression from a sigma70-dependent promoter during stationary phase. Another bacterial ncRNA, OxyS RNA represses translation by binding to Shine-Dalgarno sequences thereby occluding ribosome binding.
|
|
The RNA encapsidation (packaging) signal participates in the process of RNA packaging and aids in making viral packaging and encapsidation more efficient. RNA packaging is characterized by an initial recognition event between the Gag polyprotein and the RNA encapsidation (packaging) signal. Research suggests this specifically takes place at the 5’ end of the viral genome and involves stable RNA secondary structures. These structures interact with amino acids located in the nucleocapsid, or NC domain, of the Gag protein.
|
|
Guide RNA targets the complementary sequences by simple Watson-Crick base pairing. In type II CRISPR/cas system, single guide RNA directs the target specific regions. Single guide RNA are artificially programmed combination of two RNA molecules, one component (tracrRNA) is responsible for Cas9 endonuclease activity and other (crRNA) binds to the target specific DNA region. Therefore, the trans activating RNA (tracrRNA) and crRNA are two key components and are joined by tetraloop which results in formation of sgRNA.
|
|
It was produced by molecular competition (in vitro evolution) of candidate enzyme mixtures. Competition between RNA may have favored the emergence of cooperation between different RNA chains, opening the way for the formation of the first protocell. Eventually, RNA chains developed with catalytic properties that help amino acids bind together (a process called peptide-bonding). These amino acids could then assist with RNA synthesis, giving those RNA chains that could serve as ribozymes the selective advantage.
|
|
RNA thermometers regulate gene expression in response to temperature allowing pathogens like Yersinia to switch on silent genes after entering the host organism. Usually, RNA thermometers are located in the 5'UTR, but an intergenic RNA thermometer was found in Yersinia pseudotuberculosis. The LcrF RNA thermometer together with the termo-labile YmoA protein activates synthesis of the most crucial virulence activator LcrF (VirF). The RNA thermosensor sequence is 100% identical in all human pathogenic Yersinia species.
|
|
Research within the past decade has shown that strands of RNA are not merely transcribed from regions of DNA and translated into proteins. Rather RNA has retained some of its former independence from DNA, and is subject to a network of processing events that alter the protein expression from that bounded by just the genomic DNA. Processing of RNA influences protein expression by managing the transcription of DNA sequences, the stability of RNA, and the translation of messenger RNA.
|
|
The GC-Enriched, Between Replication Origins RNA motif (GEBRO RNA motif) is a conserved RNA or single-stranded DNA structure that was discovered by bioinformatics. Although the GEBRO motif was published as an RNA candidate, there is some reason to suspect that it might function as a single-stranded DNA (see below). In terms of secondary structure, RNA and DNA are difficult to distinguish when only sequence information is available. GEBRO motifs are found in some species of Streptococcus.
|
|
The Hazara orthonairovirus is part of the genus Orthonairovirus of the Bunyavirales order of viruses, which are an order of enveloped negative-stranded RNA viruses with a genome split into three parts—Small (S), Middle (M) and Large (L). The L RNA segment encodes an RNA- dependent RNA polymerase (L protein), the M RNA segment encodes two surface glycoproteins (Gc and Gn), and the S RNA segment encodes a nucleocapsid protein (N). The three genomic RNA segments are encapsidated by copies of the N protein in the form of ribonucleoprotein (RNP) complexes. The N protein is the most abundant viral protein in Bunyaviridae virus particles and infected cells and, therefore, the main target in many serological and molecular diagnostics.
|
|
Little is known about the replication mechanisms of dicistroviruses but it is likely that they use a mechanism that is very similar to picornaviruses. The general picornavirus replication mechanism begins with the cloverleaf-shaped structure at the 5’ end of the RNA genome is bound by the 3CD protein. 3CD functions as an RNA-dependent RNA-polymerase. 3CD then interacts with another protein that binds the poly(A) tail. This circularizes the RNA and allows RNA polymerase to generate negative-sense RNA from the 3’ end while also being able to generate positive-sense RNA from the 5’ end. Translation of the genome is regulated by the binding of 3CD initially to the 5’ UTR.
|
|
The special properties of the HDV ribozyme’s cleavage reaction make it a useful tool to prepare RNA transcripts with homogenous 3′ ends, an alternative to transcription of RNA with T7 RNA polymerase than can often produce heterogenous ends or undesired additions. The cDNA version of the ribozyme may be prepared adjacent to cDNA of the target RNA sequence and RNA prepared from transcription with T7 RNA polymerase. The ribozyme sequence will efficiently cleave itself with no downstream requirements, as the -1 nucleotide is invariant, leaving a 2′–3′ cyclic phosphate that can easily be removed by treatment with a phosphatase or T4 polynucleotide kinase. The target RNA can then be purified with gel purification.
|
|
However, the three-dimensional configuration of the RNA often gives the complex specific localization to regions where the RNA is created to bind.
|
|
Moss WN, Eickbush DG, Lopez MJ, Eickbush TH, and Turner DH (2011). The R2 retrotransposon RNA families. RNA Biol 8(5): 714–718.
|
|
Because SeV is a negative-strand RNA virus the virus entire life cycle is completed in the cytoplasm using its own RNA polymerase.
|
|
Unlike metabolic labeling, nascent transcript sequencing (NET-seq) directly sequences transcripts that are still undergoing transcription by RNA polymerase II. This method allows for the study of the dynamics of transcription elongation, which is not possible with metabolic labeling techniques. For a NET-seq experiment, cells are treated as with a standard RNA-seq experiment until they are lysed. Lysis is performed such that RNA-protein complexes remain intact, and RNA polymerase II is immunoprecipitated from the lysate. RNA that was undergoing transcription from DNA is still attached to RNA polymerase and is subsequently eluted from the polymerase and sequenced.
|
|
Genomes of Arenaviridae Arenaviruses have a segmented RNA genome that consists of two single-stranded ambisense RNAs. As with all negative-sense RNA viruses, the genomic RNA alone is not infectious and the viral replication machinery is required to initiate infection within a host cell. Genomic sense RNA packaged into the arenavirus virion is designated negative-sense RNA, and must first be copied into a positive-sense mRNA in order to produce viral protein. The two RNA segments are denoted Small (S) and Large (L), and code for four viral proteins in a unique ambisense coding strategy.
|
|
Vesicular stomatitis virus (VSV) virion and Mononegavirales genomes All viruses in Negarnaviricota are negative-sense, single-stranded RNA (-ssRNA) viruses. They have genomes made of RNA, which are single instead of double-stranded. Their genomes are negative sense, meaning that messenger RNA (mRNA) can be synthesized directly from the genome by the viral enzyme RNA-dependent RNA polymerase (RdRp), also called RNA replicase, which is encoded by all -ssRNA viruses. Excluding viruses in the genus Tenuivirus and some in the family Chuviridae, all -ssRNA viruses have linear rather than circular genomes, and the genomes may be segmented or non-segmented.
|
|
Helicases are often used to separate strands of a DNA double helix or a self-annealed RNA molecule using the energy from ATP hydrolysis, a process characterized by the breaking of hydrogen bonds between annealed nucleotide bases. They also function to remove nucleic acid-associated proteins and catalyze homologous DNA recombination. Metabolic processes of RNA such as translation, transcription, ribosome biogenesis, RNA splicing, RNA transport, RNA editing, and RNA degradation are all facilitated by helicases. Helicases move incrementally along one nucleic acid strand of the duplex with a directionality and processivity specific to each particular enzyme.
|
|
Gene expression and RNA quantification studies have benefited from the increased precision and absolute quantification of dPCR. RNA quantification can be accomplished via RT-PCR, wherein RNA is reverse- transcribed into cDNA in the partitioned reaction itself, and the number of RNA molecules originating from each transcript (or allelic transcript) is quantified via dPCR (ref). One can often achieve greater sensitivity and precision by using dPCR rather than qPCR to quantify RNA molecules in part because it does not require use of a standard curve for quantification. dPCR is also more resilient to PCR inhibitors for the quantification of RNA than qPCR.
|
|
This phenomenon came to light with the advent of technologies, such as MS2 tagging and single molecule RNA fluorescence in situ hybridisation, to detect RNA production in single cells, through precise measurements of RNA number or RNA appearance at the gene. Other, more widespread techniques, such as Northern blotting, microarrays, RT-PCR and RNA-Seq, measure bulk RNA levels from homogenous population extracts. These techniques lose dynamic information from individual cells and give the impression that transcription is a continuous smooth process. Observed at an individual cell level, transcription is irregular, with strong periods of activity interspersed by long periods of inactivity.
|
|
RNA silencing suppressor p19 (also known as Tombusvirus P19 core protein and 19 kDa symptom severity modulator) is a protein expressed from the ORF4 gene in the genome of tombusviruses. These viruses are positive-sense single- stranded RNA viruses that infect plant cells, in which RNA silencing forms a widespread and robust antiviral defense system. The p19 protein serves as a counter-defense strategy, specifically binding the 19- to 21-nucleotide double-stranded RNAs that function as small interfering RNA (siRNA) in the RNA silencing system. By sequestering siRNA, p19 suppresses RNA silencing and promotes viral proliferation.
|
|
Other DNA methyltransferases are expressed in plants but have no known function (see the Chromatin Database). It is not clear how the cell determines the locations of de novo DNA methylation, but evidence suggests that for many (though not all) locations, RNA-directed DNA methylation (RdDM) is involved. In RdDM, specific RNA transcripts are produced from a genomic DNA template, and this RNA forms secondary structures called double-stranded RNA molecules. The double-stranded RNAs, through either the small interfering RNA (siRNA) or microRNA (miRNA) pathways direct de-novo DNA methylation of the original genomic location that produced the RNA.
|
|
The Infectious bronchitis virus D-RNA is an RNA element known as defective RNA or D-RNA. This element is thought to be essential for viral replication and efficient packaging of avian infectious bronchitis virus (IBV) particles. Coronavirus D-RNA like that of IBV, are produced during high multiplicity of infection and contain cis-acting sequences which are required for viral replication. While it is unclear exactly how IBV D-RNA is made, it is thought to be synthesized in a similar manner as subgenomic mRNA (sg mRNA), with most of the genomic sequence left out of the product.
|
|
U8 small nucleolar RNA (also known as SNORD118) is the RNA component of a small RNA:protein complex (the U8 snoRNP) which is required for biogenesis of mature large subunit ribosomal RNAs, 5.8S and 28S rRNAs. More specifically, U8 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA.
|
|
RNA is a very similar molecule to DNA, with only two major chemical differences (the backbone of RNA uses ribose instead of deoxyribose and its nucleobases include uracil instead of thymine). The overall structure of RNA and DNA are immensely similar—one strand of DNA and one of RNA can bind to form a double helical structure. This makes the storage of information in RNA possible in a very similar way to the storage of information in DNA. However, RNA is less stable, being more prone to hydrolysis due to the presence of a hydroxyl group at the ribose 2' position.
|
|
In eukaryotes, the processing of pre-mRNA and RNA editing take place at sites determined by the base pairing between the target RNA and RNA constituents of small nuclear ribonucleoproteins (snRNPs). Such enzyme targeting is also responsible for gene down regulation though RNA interference (RNAi), where an enzyme-associated guide RNA targets specific mRNA for selective destruction. Likewise, in eukaryotes the maintenance of telomeres involves copying of an RNA template that is a constituent part of the telomerase ribonucleoprotein enzyme. Another cellular organelle, the vault, includes a ribonucleoprotein component, although the function of this organelle remains to be elucidated.
|
|
The family of long non-coding RNAs includes a variety of different kinds of RNA, including, but not limited to, circular RNA (circRNA), nuclear lncRNA, long intergenic non-coding RNA, and enhancer RNA. The development of next-generation sequencing has made the study of lncRNA more accessible (because lncRNA is not very common in the cell relative to other types of RNA). Editing and modifications to lncRNA have demonstrated to result in changes in RNA expression and rate of mutation. 5-methylcytosine (m5C), N6-methyladenosine (m6A), and pseudouridine are the three most common and most studied modifications occurring in lncRNA.
|
|
ChiRP-Seq (Chromatin Isolation by RNA purification) is a high-throughput sequencing method to discover regions of the genome which are bound by a specific RNA (or by a ribonucleoprotein containing the RNA of interest). Recent studies have shown that a significant proportion of some genomes (including mouse and human genomes) synthesize RNA that apparently do not code for proteins. The function of most of these non-coding RNA still has to be ascertained. Various genomic methods are being developed to map the functional association of these novel RNA to distinct regions of the genome to gain a better understanding of their function.
|
|
Consensus structure of TB11Cs2H1 TB11Cs2H1 is a member of the H/ACA-like class of non-coding RNA (ncRNA) molecules that guide the sites of modification of uridines to pseudouridines of substrate RNAs. It is known as a small nucleolar RNA (snoRNA) thus named because of its cellular localization in the nucleolus of the eukaryotic cell. TB11Cs2H1 is a unique H/ACA RNA, it is also known as the splice leader associated RNA (SLA1). It was demonstrated that although this RNA guides pseudouridylation on SL RNA its main function is to properly fold its target in a distinct structure early in its biogenesis.
|
|
RNA-based evolution is a theory that posits that RNA is not merely an intermediate between Watson and Crick model of the DNA molecule and proteins, but rather a far more dynamic and independent role-player in determining phenotype. By regulating the transcription in DNA sequences, the stability of RNA, and the capability of messenger RNA to be translated, RNA processing events allow for a diverse array of proteins to be synthesized from a single gene. Since RNA processing is heritable, it is subject to natural selection suggested by Darwin and contributes to the evolution and diversity of most eukaryotic organisms.
|
|
By contrast, RNA viruses do not appear to have been a prominent part of the LUCA virome, even though straightforward thinking might have envisaged the LUCA virome as a domain of RNA viruses descending from the primordial RNA world. Instead, by the time the LUCA lived, RNA viruses had probably already been largely supplanted by the more efficient DNA virosphere.
|
|
Electrophoresis of RNA samples can be used to check for genomic DNA contamination and also for RNA degradation. RNA from eukaryotic organisms shows distinct bands of 28s and 18s rRNA, the 28s band being approximately twice as intense as the 18s band. Degraded RNA has less sharply defined bands, has a smeared appearance, and intensity ratio is less than 2:1.
|
|
It is directly involved in the replication and transcription of RNA from an RNA strand. The other nonstructural proteins in the complex assist in the replication and transcription process. The protein nsp14 is a 3'-5' exoribonuclease which provides extra fidelity to the replication process. The exoribonuclease provides a proofreading function to the complex which the RNA- dependent RNA polymerase lacks.
|
|
PMID: 3005623 and in the mouse central nervous system.Keck JG, Matsushima GK, Makino S, Fleming JO, Vannier DM, Stohlman SA, Lai MM. In vivo RNA-RNA recombination of coronavirus in mouse brain. J Virol. 1988 May;62(5):1810-3. PMID: 2833625 These findings suggest that RNA-RNA recombination may play a significant role in the natural evolution and neuropathogenesis of coronaviruses.
|
|
The function of certain genes can be studied more easily. RNA interference is a major step in genetics. In 2003 Tuschl became professor and head of laboratory at Rockefeller University in New York, where he continues his research. He is looking into microRNA, small RNA-sections, which are formed by the cells and cause RNA interference like introduced synthetic RNA-strains.
|
|
The helical nucleocapsid contains an RNA genome consisting of two negative single-stranded RNA segments. The negative RNA strand, complementary to the necessary mRNA strand, indicates that it must first be transcribed into a positive mRNA strand before it can be translated into the required proteins. The L strand is ambisense RNA, encoding multiple proteins in opposite directions, separated by an intergenic region.
|
|
The mechanism of recombination likely involves strand switching by the RNA-dependent RNA polymerase (copy-choice recombination), a mechanism demonstrated in poliovirus.Kirkegaard K, Baltimore D. The mechanism of RNA recombination in poliovirus. Cell. 1986 Nov 7;47(3):433-43. PMID: 3021340 In addition to being a source of sequence diversity, recombination in RNA viruses appears to be an adaptation for repairing genome damage.
|
|
TGT interferes with development of chloroplasts in young plant leaves thereby causing chlorosis. The natural target of the toxin is chloroplast RNA polymerase. Chloroplast RNA polymerase belongs to ubiquitous family of multisubunit RNA polymerases (RNAP) and is most closely related to bacterial enzymes. In vitro, TGT inhibits bacterial RNAPs from Escherichia coli and Thermus thermophilus, and eukaryotic RNA polymerase III.
|
|
RNAse T catalyzes the removal of nucleotides from the 3' end of both RNA and DNA. It is inhibited by both double stranded DNA and RNA, as well as cytosine residues on the 3' end of RNA. Two cytosines at the 3' end of RNA appear to remove the activity of RNAse T entirely. This cytosine effect, however, is observed less with ssDNA.
|
|
All RNA viruses use their own RNA replicase enzymes to create copies of their genomes.Collier p. 79 ; Reverse transcribing viruses: Reverse transcribing viruses have ssRNA (Retroviridae, Metaviridae, Pseudoviridae) or dsDNA (Caulimoviridae, and Hepadnaviridae) in their particles. Reverse transcribing viruses with RNA genomes (retroviruses) use a DNA intermediate to replicate, whereas those with DNA genomes (pararetroviruses) use an RNA intermediate during genome replication.
|
|
In the process of transcription (by any polymerase), there are three main stages: #Initiation: the construction of the RNA polymerase complex on the gene's promoter with the help of transcription factors #Elongation: the actual transcription of the majority of the gene into a corresponding RNA sequence #Termination: the cessation of RNA transcription and the disassembly of the RNA polymerase complex.
|
|
Ribavirin's amide group can make the native nucleoside drug resemble adenosine or guanosine, depending on its rotation. For this reason, when ribavirin is incorporated into RNA, as a base analog of either adenine or guanine, it pairs equally well with either uracil or cytosine, inducing mutations in RNA-dependent replication in RNA viruses. Such hypermutation can be lethal to RNA viruses.
|
|
Importantly, RNA integrity is maintained by inactivating RNases with chaotropic agents such as guanidinium isothiocyanate, sodium dodecyl sulphate (SDS), phenol or chloroform. Total RNA is then separated from other cellular components and precipitated with alcohol. Various commercial kits exist for simple and rapid RNA extractions for specific applications. Additional bead-based methods can be used to isolate specific sub-types of RNA (e.g.
|
|
The various kinds of LSm rings function as scaffolds or chaperones for RNA oligonucleotides, assisting the RNA to assume and maintain the proper three-dimensional structure. In some cases, this allows the oligonucleotide RNA to function catalytically as a ribozyme. In other cases, this facilitates modification or degradation of the RNA, or the assembly, storage, and intracellular transport of ribonucleoprotein complexes.
|
|
In bacteria, termination of RNA transcription can be rho-dependent or rho-independent. The former relies on the rho factor, which destablizes the DNA-RNA heteroduplex and causes RNA release. The latter, also known as intrinsic termination, relies on a palindromic region of DNA. Transcribing the region causes the formation of a "hairpin" structure from the RNA transcription looping and binding upon itself.
|
|
The genes of viruses are made from DNA (deoxyribonucleic acid) and, in many viruses, RNA (ribonucleic acid). The biological information contained in an organism is encoded in its DNA or RNA. Most organisms use DNA, but many viruses have RNA as their genetic material. The DNA or RNA of viruses consists of either a single strand or a double helix.
|
|
Many ribozymes have either a hairpin – or hammerhead – shaped active center and a unique secondary structure that allows them to cleave other RNA molecules at specific sequences. It is now possible to make ribozymes that will specifically cleave any RNA molecule. These RNA catalysts may have pharmaceutical applications. For example, a ribozyme has been designed to cleave the RNA of HIV.
|
|
In molecular biology, small nucleolar RNA SNORA10 and small nuclear RNA SNORA64 are homologous members of the H/ACA class of small nucleolar RNA (snoRNA). This family of ncRNAs involved in the maturation of ribosomal RNA. snoRNA in this family act as guides in the modification of uridines to pseudouridines. This family includes the human snoRNAs U64 and ACA10 and mouse MBI-29.
|
|
SR proteins bind to the phosphorylated Ser2 on the CTD. The positioning of SR proteins on the RNA polymerase II allows the SR proteins to "see" the new RNA transcript first. SR proteins then moves from the RNA polymerase II to the pre-mRNA transcript. Once on the new RNA transcript, SR proteins can then stimulate the formation of the spliceosome.
|
|
CSP genes evolved via duplication, intron loss and gain, and retrotransposition events [4, 14, 32, 40-41, 45]. A single unified hypothesis of RNA editing and retrotransposition-driven evolution of CSPs, i.e. initial production of new CSP protein motifs via DNA and RNA -dependent RNA polymerization before retro- transposition of edited CSP-RNA variants, has been proposed in moths [11].
|
|
The virus is uncoated, a process in which the helical viral proteins are removed. This exposes the viral genomic RNA to the cytoplasm. The RNA is then translated to produce a polyprotein, which is then processed by viral proteases into RNA dependent RNA polymerase and structural proteins. These are both used to replicate the viral genome, which takes place in cytoplasmic viral factories.
|
|
Another proposal is that the dual-molecule system we see today, where a nucleotide- based molecule is needed to synthesize protein, and a peptide-based (protein) molecule is needed to make nucleic acid polymers, represents the original form of life. This theory is called RNA-peptide coevolution, or the Peptide-RNA world, and offers a possible explanation for the rapid evolution of high- quality replication in RNA (since proteins are catalysts), with the disadvantage of having to postulate the coincident formation of two complex molecules, an enzyme (from peptides) and a RNA (from nucleotides). In this Peptide-RNA World scenario, RNA would have contained the instructions for life, while peptides (simple protein enzymes) would have accelerated key chemical reactions to carry out those instructions. The study leaves open the question of exactly how those primitive systems managed to replicate themselves — something neither the RNA World hypothesis nor the Peptide-RNA World theory can yet explain, unless polymerases (enzymes that rapidly assemble the RNA molecule) played a role.
|
|
The Methylobacterium-1 RNA motif is a conserved RNA structure discovered using bioinformatics. Almost all known examples of this RNA are found in DNA extracted from marine bacteria. However, one instance is predicted in Methylobacterium sp. 4-46, a species of alphaproteobacteria.
|
|
Rho is able to catch up with the RNA polymerase, which is stalled at the downstream tsp sites. Contact between Rho and the RNA polymerase complex stimulates dissociation of the transcriptional complex through a mechanism involving allosteric effects of Rho on RNA polymerase.
|
|
Researchers have found that myricetin has the ability to interfere in the RNA polymerase pathway in two different ways. In E. coli myricetin competitively inhibited GTP substrate binding to RNA polymerase. In T7 bacteriophages myricetin competitively inhibited DNA template binding to RNA polymerase.
|
|
RNA polymerase II holoenzyme is a form of eukaryotic RNA polymerase II that is recruited to the promoters of protein-coding genes in living cells. It consists of RNA polymerase II, a subset of general transcription factors, and regulatory proteins known as .
|
|
Even after the loss of the nucleus in mammals, residual ribosomal RNA allows further synthesis of Hb until the reticulocyte loses its RNA soon after entering the vasculature (this hemoglobin-synthetic RNA in fact gives the reticulocyte its reticulated appearance and name).
|
|
Retrotransposons are regulated by RNA interference. RNA interference is carried out by a bunch of short non-coding RNAs. The short non-coding RNA interacts with protein Argonaute to degrade retrotransposon transcripts and change their DNA histone structure to reduce their transcription.
|
|
Like other amatoxins, amanullin is an inhibitor of RNA polymerase II. Amanullin has a species dependent and specific attraction to the enzyme RNA polymerase II. Upon ingestion, it binds to the RNA polymerase II enzyme, effectively causing cytolysis of hepatocytes (liver cells).
|
|
A metal ion can interact with RNA in multiple ways. An ion can associate diffusely with the RNA backbone, shielding otherwise unfavorable electrostatic interactions. This charge screening is often fulfilled by monovalent ions. Site-bound ions stabilize specific elements of RNA tertiary structure.
|
|
Advances in genetics (Vol. 90, pp. 133–208). Currently, the ubiquitous nature of systems of RNA regulation of genes has been discussed as support for the RNA World theory.J.W. Nelson, R.R. Breaker (2017) "The lost language of the RNA World."Sci. Signal.
|
|
RNA from Bacteriophage Qβ was used by Sol Spiegelman in experiments that favored faster replication, and thus shorter strands of RNA. He ended up with Spiegelman's Monster, an minimal RNA chain of only 218 nucleotides that can be replicated by Qβ replicase.
|
|
A replicon is a DNA molecule or RNA molecule, or a region of DNA or RNA, that replicates from a single origin of replication.
|
|
Several non-coding RNA elements have been identified in the HBV genome. These include: HBV PREalpha, HBV PREbeta and HBV RNA encapsidation signal epsilon.
|
|
Secondly it has ribonuclease H (Rnase H) activity as it degrades the RNA strand of RNA-DNA intermediate that forms during viral DNA synthesis.
|
|
The company calls these agents Spiegelmers, from Spiegel, the German word for "mirror." The L-RNA are resistant to the natural RNA nuclease enzymes.
|
|
The TRAMP complex works more efficiently in RNA processing by engaging Exosome complex exonuclease RrP6 wherein Nab3(RNA binding protein) plays a crucial role.
|
|
It has been suggested that these originated in an RNA- based world. In addition, RNA thermometers regulate gene expression in response to temperature changes.
|
|
Her research and specializations include Messenger RNA-based gene therapy, RNA-induced immune reactions, molecular bases of ischemic tolerance and treatment of brain ischemia.
|
|
RNA sequencing of total RNA from 20 human tissues from NCBI Gene entry on CDV3. Illumina bodyMap2 transcriptome from NCBI Gene entry on CDV3.
|
|
However, this association is not consistent to declare a cis-regulatory function for the RNA, and so it might function as a small RNA.
|
|
The Plasmid-Associated gamma-Proteobacteria Especially Vibrionales RNA motif (PAGEV RNA motif) is a conserved RNA structure that was discovered by bioinformatics. PAGEV motif RNAs are found in Gammaproteobacteria, especially within the order Vibrionales. PAGEV RNAs likely have a function that relates to plasmids, and one PAGEV RNA is predicted to reside in the plasmid pPMA4326D, which was found in a strain of Pseudomonas syringae. This RNA overlaps a region that was predicted as being essential for replication of the plasmid.
|
|
In 2011, Butcher and colleagues discovered a frameshifting stimulator (DB213) which bound to HIV-1 FS RNA with moderate binding affinity. An NMR structure of the RNA in complex with DB213, showed that the small molecule bound to the major groove of the RNA duplex. Schneekloth and Hargrove have taken a different approach by targeting the HIV-1 TAR RNA hairpin. In a small molecule microarray screening, the Schneekloth group identified a thienopyridine derivative that interacts with HIV-1 TAR RNA hairpin.
|
|
In other RNA viruses, the RNA is a complementary copy of mRNA and these viruses rely on the cell's or their own enzyme to make mRNA. These are called negative-sense RNA viruses. In viruses made from DNA, the method of mRNA production is similar to that of the cell. The species of viruses called retroviruses behave completely differently: they have RNA, but inside the host cell a DNA copy of their RNA is made with the help of the enzyme reverse transcriptase.
|
|
Viroids are the first known representatives of a new biological realm of sub-viral pathogens. Viroid RNA does not code for any protein. Its replication mechanism hijacks RNA polymerase II, a host cell enzyme normally associated with synthesis of messenger RNA from DNA, which instead catalyzes "rolling circle" synthesis of new RNA using the viroid's RNA as a template. Some viroids are ribozymes, having catalytic properties which allow self-cleavage and ligation of unit-size genomes from larger replication intermediates.
|
|
OxyS RNA is a small non-coding RNA which is induced in response to oxidative stress in Escherichia coli. This RNA acts as a global regulator to activate or repress the expression of as many as 40 genes, by an antisense mechanism, including the fhlA-encoded transcriptional activator and the rpoS-encoded sigma(s) subunit of RNA polymerase. OxyS is bound by the Hfq protein, that increases the OxyS RNA interaction with its target messages. Binding to Hfq alters the conformation of OxyS.
|
|
Fig. 1. Duck HBV RNA encapsidation signal epsilon Fig. 2. Heron HBV RNA encapsidation signal epsilon The Avian HBV RNA encapsidation signal epsilon (AHBV epsilon) is an RNA structure that is shown to facilitate encapsidation of the pregenomic RNA required for viral replication. There are two main classes of encapsidation signals in avian hepatitis B viruses - Duck hepatitis B virus (DHBV) and Heron hepatitis B virus (HHBV) like. DHBV is used as a model to understand human Hepatitis B virus.
|
|
The first work in RNA origami appeared in Science, published by Ebbe S. Andersen of Aarhus University. Researchers at Aarhus University used various 3D models and computer software to design individual RNA origami. Once encoded as a synthetic DNA gene, adding RNA polymerase resulted in the formation of RNA origami. Observation of RNA was primarily done through atomic force microscopy, a technique that allows researchers to look at molecules a thousand times closer than would normally be possible with a conventional light microscope.
|
|
The distance matrix constructed from this tree of life is then subtracted from the distance matrices of the proteins of interest. However, because RNA distance matrices and DNA distance matrices have different scale, presumably because RNA and DNA have different mutation rates, the RNA matrix needs to be rescaled before it can be subtracted from the DNA matrices. By using molecular clock proteins, the scaling coefficient for protein distance/RNA distance can be calculated. This coefficient is used to rescale the RNA matrix.
|
|
The viral RNA is translated into a polyproteinss and then cleaved by viral and cellular proteases into the structural (C, prM, and E) and non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, 2K, NS4B, and NS5). Replication takes places on the surface of the endoplasmic reticulum within the membrane vessicles. A complementary negative sense RNA strand is formed via the RNA-dependent RNA polymerase (non- structural protein NS5) to create a double-stranded RNA. The dsRNA is transcribed producing viral mRNAs.
|
|
The CyVA-1 RNA motif is a conserved RNA structure that was discovered by bioinformatics. CyVA-1 motifs are found in Cyanobacteria, Acidobacteria AND Verrucomicrobia. Only one example of the RNA is known in any Acidobacterial organism, and only one CyVA-1 RNA was found in any Verrucomicrobial organism. This could suggest that the RNA is not well-established in these bacterial lineages, or simply reflect the fact that relatively few genome sequences are available for organisms in these phyla.
|
|
RT RNA motifs refers to conserved RNA motifs discovered by bioinformatics and that are usually or always located nearby to genes predicted to encode reverse transcriptase (RT genes). Known RNAs located nearby to RT genes include self- splicing introns, retrons and diversity-generating retroelements (DGR), and RT RNA motifs could function as part of such elements. Nineteen RT RNA motifs found and named RT-1 through RT-19. The RT-10 RNA motif occurs in a known DGR in Bordetella phage BPP-1.
|
|
Structural alignment techniques have traditionally been applied exclusively to proteins, as the primary biological macromolecules that assume characteristic three-dimensional structures. However, large RNA molecules also form characteristic tertiary structures, which are mediated primarily by hydrogen bonds formed between base pairs as well as base stacking. Functionally similar noncoding RNA molecules can be especially difficult to extract from genomics data because structure is more strongly conserved than sequence in RNA as well as in proteins, and the more limited alphabet of RNA decreases the information content of any given nucleotide at any given position. However, because of the increasing interest in RNA structures and because of the growth of the number of experimentally determined 3D RNA structures, few RNA structure similarity methods have been developed recently.
|
|
3D structure of a hammerhead ribozyme Ribozymes (ribonucleic acid enzymes) are RNA molecules that have the ability to catalyze specific biochemical reactions, including RNA splicing in gene expression, similar to the action of protein enzymes. The 1982 discovery of ribozymes demonstrated that RNA can be both genetic material (like DNA) and a biological catalyst (like protein enzymes), and contributed to the RNA world hypothesis, which suggests that RNA may have been important in the evolution of prebiotic self-replicating systems. The most common activities of natural or in vitro-evolved ribozymes are the cleavage or ligation of RNA and DNA and peptide bond formation. Within the ribosome, ribozymes function as part of the large subunit ribosomal RNA to link amino acids during protein synthesis.
|
|
While transcription of prokaryotic protein-coding genes creates messenger RNA (mRNA) that is ready for translation into protein, transcription of eukaryotic genes leaves a primary transcript of RNA (pre-RNA), which first has to undergo a series of modifications to become a mature RNA. Types and steps involved in the maturation processes vary between coding and non-coding preRNAs; i.e. even though preRNA molecules for both mRNA and tRNA undergo splicing, the steps and machinery involved are different. The processing of non-coding RNA is described below (non-coring RNA maturation). The processing of premRNA include 5′ capping, which is set of enzymatic reactions that add 7-methylguanosine (m7G) to the 5′ end of pre-mRNA and thus protect the RNA from degradation by exonucleases.
|
|
Pyrococcus C/D box small nucleolar RNA are non-coding RNA (ncRNA) molecules identified in the archaeal genus Pyrococcus which function in the modification of ribosomal RNA (rRNA) and transfer RNA (tRNA). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell, which is a major site of ribosomal RNA and snRNA biogenesis, but there is no corresponding visible structure in archaeal cells. This group of ncRNAs are known as small nucleolar RNAs (snoRNA) and also often referred to as a guide RNAs because they direct associated protein enzymes to add a modification to specific nucleotides in target RNAs. C/D box RNAs guide the addition of a methyl group (-CH3) to the 2'-O position in the RNA backbone.
|
|
An example of a ribonucleoprotein-motif protein. From PDB entry 1IBM. A ribonucleoprotein particle or RNP is a complex formed between RNA and RNA- binding proteins (RBPs). The term RNP foci can also be used to denote intracellular compartments involved in processing of RNA transcripts.
|
|
The ribonucleoproteins play a role of protection. mRNAs never occur as free RNA molecules in the cell. They always associate with ribonucleoproteins and function as ribonucleoprotein complexes. In the same way, the genomes of negative-strand RNA viruses never exist as free RNA molecule.
|
|
Mitoviruses have nonsegmented, linear, positive-sense, single-stranded RNA genomes. The genome has one open reading frame which encodes the RNA-dependent RNA polymerase (RdRp). The genome is associated with the RdRp in the cytoplasm of the fungi host and forms a naked ribonucleoprotein complex.
|
|
Narnaviruses have nonsegmented, linear, positive-sense, single-stranded RNA genomes. The genome has one open reading frame which encodes the RNA-dependent RNA polymerase (RdRp). The genome is associated with the RdRp in the cytoplasm of the fungi host and forms a naked ribonucleoprotein complex.
|
|
A DNA-binding repressor blocks the attachment of RNA polymerase to the promoter, thus preventing transcription of the genes into messenger RNA. An RNA-binding repressor binds to the mRNA and prevents translation of the mRNA into protein. This blocking of expression is called repression.
|
|
RNA interference (RNAIi) is the process in which a cell's RNA to protein mechanism is turned down or off in order to suppress genes. This method of genetic modification works by interfering with messenger RNA to stop the synthesis of proteins, effectively silencing a gene.
|
|
L-RNA is much more stable against degradation by RNase. Like other structured biopolymers such as proteins, one can define topology of a folded RNA molecule. This is often done based on arrangement of intra-chain contacts within a folded RNA, termed as circuit topology.
|
|
NS3 functions as a protease and helicase. NS5 functions as the RNA-dependent RNA polymerase. NS1 is important in the viral replication process. NS2A interacts with NS3 and NS5, helps in viral assembly and recruits the viral RNA genome to membrane- bound replication complex.
|
|
It is designated by the BLM as both an RNA and an Area of Critical Environmental Concern (ACEC). Elevations within the RNA vary from to .
|
|
However, given that the Lacto-usp RNA motif is much shorter than the standard 6S RNA structure, the function of Lacto-usp RNAs remains unclear.
|
|
It has 79 protein coding genes, 30 RNA transferring genes, as well as four ribosomal RNA genes adding up to a total of 113 genes.
|
|
These domains are then involved in the initiation of DNA transcription, the capping of the RNA transcript, and attachment to the spliceosome for RNA splicing.
|
|
These first deoxyribozymes were unable to catalyze a full RNA substrate strand, but by incorporating the full RNA substrate strand into the selection process, deoxyribozymes which functioned with substrates consisting of either full RNA or full DNA with a single RNA base were both able to be utilized. The first of these more versatile deoxyribozymes, 8-17 and 10-23, are currently the most widely studied deoxyribozymes.
|
|
Indirect RNA sequencing of exRNA samples involves generating a cDNA library from the exRNAs followed by PCR amplification and sequencing. In 2009, Helicos Biosciences published a method for directly sequencing RNA molecules called Direct RNA sequencing (DRS™). Regardless of the RNA sequencing platform, inherent biases exist at various steps in the experiment, but methods have been proposed to correct for these biases with promising results.
|
|
Cross-linking immunoprecipitation (CLIP) is a method used in molecular biology that combines UV cross-linking with immunoprecipitation in order to analyse protein interactions with RNA or to precisely locate RNA modifications (e.g. m6A). CLIP-based techniques can be used to map RNA binding protein binding sites or RNA modification sites of interest on a genome-wide scale, thereby increasing the understanding of post-transcriptional regulatory networks.
|
|
352: p. 444-448. In their research, they attached RNA polymerase to the surface, and gold beads were attached to one end of the DNA molecules. In the beginning, the RNA polymerase "captures" the DNA near the gold bead. During the transcription, the DNA "slides" on the RNA polymerase so the distance between the RNA polymerase and the gold bead (the tether length)is increased.
|
|
Genetic recombination can occur when at least two RNA viral genomes are present in the same infected host cell. RNA-RNA recombination between different strains of the murine coronavirus was found to occur at a very high frequency both in tissue cultureMakino S, Keck JG, Stohlman SA, Lai MM. High-frequency RNA recombination of murine coronaviruses. J Virol. 1986 Mar;57(3):729-37.
|
|
Another previously unknown mechanism by which RNA molecules are involved in genetic regulation was discovered in the 1990s. Small RNA molecules termed microRNA (miRNA) and small interfering RNA (siRNA) are abundant in eukaryotic cells and exert post-transcriptional control over mRNA expression. They function by binding to specific sites within the mRNA and inducing cleavage of the mRNA via a specific silencing-associated RNA degradation pathway.
|
|
Unlike DNA editing, which is permanent, the effects of RNA editing − including potential off-target mutations in RNA − are transient and are not inherited. RNA editing is therefore considered to be less risky. Furthermore, it may only require a guide RNA by using the ADAR protein already found in humans and many other eukaryotes' cells instead of needing to introduce a foreign protein into the body.
|
|
When running RNA markers and RNA samples on a gel, it is important to prevent nuclease contamination, as RNA is very sensitive to ribonuclease (RNase) degradation through catalysis. Thus, all materials to be used in the procedure must be taken into consideration. Any glassware that is to come into contact with RNA should be pretreated with diethylpyrocarbonate (DEPC) and plastic materials should be disposable.
|
|
The initiation of the transcription is a multistep sequential process that involves several mechanisms: promoter location, initial reversible binding of RNA polymerase, conformational changes in RNA polymerase, conformational changes in DNA, binding of nucleoside triphosphate (NTP) to the functional RNA polymerase-promoter complex, and nonproductive and productive initiation of RNA synthesis. The promoter binding process is crucial in the understanding of the process of gene expression.
|
|
The structure of the tomato bushy stunt virus p19 protein bound to double-stranded RNA. The two p19 monomers are shown in blue and green; the RNA backbone is shown in orange. The alpha helices at the top and bottom interact with the ends of the RNA, ensuring that only RNA of the correct length is bound. This has been described as a "molecular caliper".
|
|
RNA extraction is the purification of RNA from biological samples. This procedure is complicated by the ubiquitous presence of ribonuclease enzymes in cells and tissues, which can rapidly degrade RNA. Several methods are used in molecular biology to isolate RNA from samples, the most common of these is guanidinium thiocyanate-phenol-chloroform extraction. The filter paper based lysis and elution method features high throughput capacity.
|
|
Retroviruses encode an unusual DNA polymerase called reverse transcriptase, which is an RNA-dependent DNA polymerase (RdDp) that synthesizes DNA from a template of RNA. The reverse transcriptase family contain both DNA polymerase functionality and RNase H functionality, which degrades RNA base-paired to DNA. An example of a retrovirus is HIV. Reverse transcriptase is commonly employed in amplification of RNA for research purposes.
|
|
The HgcE RNA (also known as Pf3 RNA) gene is a non-coding RNA that was identified computationally and experimentally verified in AT-rich hyperthermophiles. The genes in the screen were named hgcA through hgcG ("high GC"). The HgcE has been renamed as Pf3 and identified as an H/ACA snoRNA that is suggested to target 23S rRNA for pseudouridylation. This RNA contains two K-turn motifs.
|
|
However, tectoRNA can also incorporate flexible junctions and RNA modules (or RNA aptamers) responsive to ligands. Nowadays, extensive databases and powerful algorithms can be useful tools to design sequences of tectoRNAs. The folding of tectoRNAs are optimized by minimizing the free energy and maximizing their thermodynamic stability. The RNA sequences are mainly transcribed in vitro, and the folding condition for RNA is also important.
|
|
A schematic representation of the RNA world hypothesis Nucleotides are the fundamental molecules that combine in series to form RNA. They consist of a nitrogenous base attached to a sugar-phosphate backbone. RNA is made of long stretches of specific nucleotides arranged so that their sequence of bases carries information. The RNA world hypothesis holds that in the primordial soup (or sandwich), there existed free-floating nucleotides.
|
|
Through combinatorial studies of viral and bacterial systems, he has identified targets for novel pharmacological studies. Later in the 1980s, Keene identified RNA recognition motif (RRM) proteins. RRM proteins are the largest family of RNA-binding proteins and the seventh largest protein family of the human genome. RRM is a prevalent RNA- binding fold involving proteins implicated in RNA biogenesis, processing, transport, and degradation.
|
|
While some functions of RNA silencing and its machinery are understood, many are not. For example, RNA silencing has been shown to be important in the regulation of development and in the control of transposition events. RNA silencing has been shown to play a role in antiviral protection in plants as well as insects. Also in yeast, RNA silencing has been shown to maintain heterochromatin structure.
|
|
Protein synthesis within chloroplasts relies on an RNA polymerase coded by the chloroplast's own genome, which is related to RNA polymerases found in bacteria. Chloroplasts also contain a mysterious second RNA polymerase that is encoded by the plant's nuclear genome. The two RNA polymerases may recognize and bind to different kinds of promoters within the chloroplast genome. The ribosomes in chloroplasts are similar to bacterial ribosomes.
|
|
It has to be considered that run-on only detects elongating RNA polymerases whereas ChIP-chip detects all present RNA polymerases, including backtracked ones. Overview of the Global run on sequencing assay for delineating genes, genome-wide, that are engaged in transcription.Attachment of new RNA polymerase to genes is prevented by inclusion of sarkosyl. Therefore only genes that already have an RNA polymerase will produce labeled transcripts.
|
|
The FuFi-1 RNA motif is a conserved RNA structure that was discovered by bioinformatics. Such RNA "motifs" are often the first step to elucidating the biological function of a novel RNA. FuFi-1 motif RNAs are found in Firmicutes AND Fusobacteria. FuFi-1 RNAs are sometimes located in the vicinity of genes that encode XRE-like proteins, an example of a helix-turn-helix structure.
|
|
The RNA genome of the virus codes 6 main proteins Nucleoprotein (N), Phosphoprotein (P), Matrix protein (M), Fusion protein (F), Hemagglutinin (H), and Large Protein (L), which represents RNA dependent RNA polymerase (RdRp). The viral genome also codes two non- structural proteins C and V. These non-structural proteins are innate immunity antagonists; they help the virus to escape host immune response. Inside the virion genomic RNA is forming complex with N, L and P proteins. N, P and M proteins regulate RNA synthesis by RdRp.
|
|
The Dictyoglomi-1 RNA motif (also called dct-1) is a conserved RNA structure that was discovered via bioinformatics. Only four instances of the RNA were detected, and all are in the bacterial phylum Dictyoglomi, whose members have not been extensively studied. The RNA might have a cis-regulatory role, but the evidence is ambiguous. Because of the few instances of Dictyoglomi-1 RNAs known, it is also unknown whether the RNA structure might extend further in the 5′ or 3′ direction, or in both directions.
|
|
Dharmacon Inc., now known as Dharmacon, a Horizon Discovery Group company, was founded in 1995 by Stephen Scaringe as Dharmacon Research to develop and commercialize a new technology for RNA oligonucleotide synthesis. The original Dharmacon focus and vision was to develop 2'-ACE RNA technology as the standard for RNA synthesis and to advance RNA oligo-dependent applications and technologies. When RNA interference (RNAi) emerged in the late 1990s, Dharmacon was poised to provide RNAi-related products to the multitude of academic and industry researchers.
|
|
The sucC RNA motif is a conserved RNA structure discovered using bioinformatics. sucC RNAs are found in the genus Pseudomonas, and are consistently found in possible 5' untranslated regions of sucC genes. These genes encode Succinyl coenzyme A synthetase, and are hypothesised to be regulated by the sucC RNAs. sucC genes participate in the citric acid cycle, and another gene involved in the citric acid cycle, sucA, is also predicted to be regulated by a conserved RNA structure (see sucA RNA motif and sucA-II RNA motif).
|
|
Noncoding RNA molecules play many essential roles in cells, especially in the many reactions of protein synthesis and RNA processing. Noncoding RNA include tRNA, ribosomal RNA, microRNA, snRNA and other non-coding RNA genes including about 60,000 long non-coding RNAs (lncRNAs). Although the number of reported lncRNA genes continues to rise and the exact number in the human genome is yet to be defined, many of them are argued to be non-functional. Many ncRNAs are critical elements in gene regulation and expression.
|
|
A regulator gene may encode a protein, or it may work at the level of RNA, as in the case of genes encoding microRNAs. An example of a regulator gene is a gene that codes for a repressor protein that inhibits the activity of an operator (a gene which binds repressor proteins thus inhibiting the translation of RNA to protein via RNA polymerase). In prokaryotes, regulator genes often code for repressor proteins. Repressor proteins bind to operators or promoters, preventing RNA polymerase from transcribing RNA.
|
|
The gamma-150 RNA motif is a conserved RNA structure that is found in bacteria within the order Pseudomonadales. Because gamma-150 RNAs are not consistently in 5' UTRs, the gamma-150 motif is presumed to correspond to a non-coding RNA. Experiments conducted on RNA transcripts in Pseudomonas syringae DC3000 revealed that two gamma-150 RNAs in that organism are transcribed as separate RNA molecules. The transcript length is roughly 380 nucleotides in size, which is almost twice as large as the gamma-150 motif itself.
|
|
Some viruses store their entire genomes in the form of RNA, and contain no DNA at all. Because they use RNA to store genes, their cellular hosts may synthesize their proteins as soon as they are infected and without the delay in waiting for transcription. On the other hand, RNA retroviruses, such as HIV, require the reverse transcription of their genome from RNA into DNA before their proteins can be synthesized. RNA-mediated epigenetic inheritance has also been observed in plants and very rarely in animals.
|
|
Trans-acting siRNA (abbreviated "ta-siRNA" or "tasiRNA") are a class of small interfering RNA (siRNA) that repress gene expression through post- transcriptional gene silencing in land plants. Precursor transcripts from TAS loci are polyadenylated and converted to double-stranded RNA, and are then processed into 21-nucleotide-long RNA duplexes with overhangs. These segments are incorporated into a RNA-induced silencing complex (RISC) and direct the sequence-specific cleavage of target mRNA. Ta-siRNAs are classified as siRNA because they arise from double-stranded RNA (dsRNA).
|
|
RNA is transcribed from genomic DNA in host cells and is extracted by first lysing cells then purifying RNA utilizing widely-used methods such as phenol- chloroform, silica column, and bead-based RNA extraction methods. Extraction methods vary depending on the source material. For example, extracting RNA from plant tissue requires additional reagents, such as polyvinylpyrrolidone (PVP), to remove phenolic compounds, carbohydrates, and other compounds that will otherwise render RNA unusable. To remove DNA and proteins, enzymes such as DNase and Proteinase K are used for degradation.
|
|
Yeast SRP RNA genes have a TATA box and additional intragenic promoter sequences (referred to as A- and B-blocks) which play a role in regulating transcription of the SRP gene by Pol III. In the bacteria, genes are organized in operons and transcribed by RNA polymerase. The 5′-end of the small (4.5S) SRP RNA of many bacteria is cleaved by RNase P. The ends of the Bacillus subtilis SRP RNA are processed by RNase III. So far, no SRP RNA introns have been observed.
|
|
Other genes make non-structural proteins found only in the cells the virus infects. All cells, and many viruses, produce proteins that are enzymes that drive chemical reactions. Some of these enzymes, called DNA polymerase and RNA polymerase, make new copies of DNA and RNA. A virus's polymerase enzymes are often much more efficient at making DNA and RNA than the equivalent enzymes of the host cells, but viral RNA polymerase enzymes are error-prone, causing RNA viruses to mutate and form new strains.
|
|
Lentiviral delivery of shRNA and the mechanism of RNA interference in mammalian cells. A short hairpin RNA or small hairpin RNA (shRNA/Hairpin Vector) is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). Expression of shRNA in cells is typically accomplished by delivery of plasmids or through viral or bacterial vectors. shRNA is an advantageous mediator of RNAi in that it has a relatively low rate of degradation and turnover.
|
|
RNA-dependent RNA polymerases (RdRPs) are critical components in the life cycle of double-stranded RNA (dsRNA) viruses. However, it is not fully understood how these important enzymes function during viral replication. Expression and characterization of the purified recombinant RdRP of Φ6 is the first direct demonstration of RdRP activity catalyzed by a single protein from a dsRNA virus. The recombinant Φ6 RdRP is highly active in vitro, possesses RNA replication and transcription activities, and is capable of using both homologous and heterologous RNA molecules as templates.
|
|
RdRP catalyses synthesis of the RNA strand complementary to a given RNA template. The RNA replication process is a two-step mechanism. First, the initiation step of RNA synthesis begins at or near the 3' end of the RNA template by means of a primer-independent (de novo), or a primer-dependent mechanism that utilizes a viral protein genome-linked (VPg) primer. The de novo initiation consists in the addition of a nucleoside triphosphate (NTP) to the 3'-OH of the first initiating NTP.
|
|
CRISPR-Disp modifies the CRISPR/Cas9 technology by using a catalytically inactive, i.e. nuclease deficient, Cas9 mutant (dCas9), and altering the RNA used for targeting Cas9 to a genomic location. Since sgRNAs are usually expressed by RNA polymerase III, which limits the length of the RNA domain that can be inserted, CRISPR- Display incorporates RNA polymerase II to permit expression of longer transcripts (~80–250 nucleotides) to overcome this limitation. CRISPR-Display can therefore add larger RNA domains, like natural and lncRNA domains, without affecting dCas9 localization.
|
|
LAGLIDADG RNA motifs are conserved RNA structures that were discovered by bioinformatics. These RNA motifs are associated with genes that encode endonucleases of the LAGLIDADG variety. Although group I introns are often present in self-replicating elements that use LAGLIDADG endonucleases, the known LAGLIDADG RNA motifs appear too small and structurally simple to function as a self-splicing intron. A LAGLIDADG-1 motif RNA is predicted in the fungus Trametes cingulata as well as many metagenomic sequences, which presumably are derived from other fungi.
|
|
The protein encoded by this gene is included in class IV of the sirtuin family. In humans cells, SIRT7 has only been shown to interact with two other molecules: RNA polymerase I (RNA Pol I) and upstream binding factor (UBF). SIRT7 is localized to the nucleolus and interacts with RNA Pol I. Chromatin immunoprecipitation studies demonstrate that SIRT7 localizes to rDNA, and coimmunoprecipitation shows that SIRT7 binds RNA Pol I. In addition SIRT7 interacts with UBF, a major component of the RNA Pol I initiation complex. It is not known whether or not SIRT7 is modifying RNA Pol I and/or UBF, and if so, what those modifications are.
|
|
There are no widely accepted functions for the resulting truncated RNA transcripts. However, a study in 1981 found evidence that there was a relationship between the amount of abortive transcripts produced and the time until long RNA strands are successfully produced. When RNA polymerase undergoes abortive transcription in the presence of ATP, UTP, and GTP, a complex is formed that has a much lower capacity for abortive recycling and a much higher rate of synthesis of the full-length RNA transcript. A study in 2010 did find evidence supporting that these truncated transcripts inhibit termination of RNA synthesis by a RNA hairpin-dependent intrinsic terminator.
|
|
Z-RNA to resemble, but not be identical, to that of Z-DNA.Popenda, M., J. Milecki, and R.W. Adamiak, High salt solution structure of a left-handed RNA double p. 4044-54. The structure of the complex of a Zalpha domain with Z-RNA under close to physiological salt concentrations however suggests a structure much closer to the Z-DNA conformation and points to two forms of Z-RNA (low and high salt conformations) Placido, D., B.A. Brown, 2nd, K. Lowenhaupt, A. Rich, and A. Athanasiadis, A left-handed RNA double helix bound by the Z alpha domain of the RNA-editing enzyme ADAR1. Structure, 2007.
|
|
However, it was later realized that Ochoa's enzyme did not use DNA to synthesize RNA but instead formed arbitrary sequences, and later this enzyme was found to degrade RNA in cells. Undeterred by Ochoa's findings, Hurwitz searched for a cellular RNA polymerase on his own and in 1960 he reported the isolation of RNA polymerase activity from Escherichia coli extracts. Remarkably, several other research groups reported similar discoveries at roughly the same time (Samuel B. Weiss, Audrey Stevens, and James Bonner). Hurwitz continued his research on RNA synthesis, and in 1962 Hurwitz, John J. Furth, and Monika Anders reported the purification of RNA polymerase.
|
|
ROSE RNA thermometer. RNA thermometers are structurally simple and can be made from short RNA sequences; the smallest is just 44 nucleotides and is found in the mRNA of a heat-shock protein, hsp17, in Synechocystis species PCC 6803. Generally these RNA elements range in length from 60–110 nucleotides and they typically contain a hairpin with a small number of mismatched base pairs which reduce the stability of the structure, thereby allowing easier unfolding in response to a temperature increase. Detailed structural analysis of the ROSE RNA thermometer revealed that the mismatched bases are actually engaged in nonstandard basepairing that preserves the helical structure of the RNA (see figure).
|
|
A retron is a distinct DNA sequence found in the genome of many bacteria species that codes for reverse transcriptase and a unique single-stranded DNA/RNA hybrid called multicopy single-stranded DNA (msDNA). Retron msr RNA is the non-coding RNA produced by retron elements and is the immediate precursor to the synthesis of msDNA. The retron msr RNA folds into a characteristic secondary structure that contains a conserved guanosine residue at the end of a stem loop. Synthesis of DNA by the retron-encoded reverse transcriptase (RT) results in a DNA/RNA chimera which is composed of small single-stranded DNA linked to small single-stranded RNA.
|
|
The properties of RNA make the idea of the RNA world hypothesis conceptually plausible, though its general acceptance as an explanation for the origin of life requires further evidence. RNA is known to form efficient catalysts and its similarity to DNA makes clear its ability to store information. Opinions differ, however, as to whether RNA constituted the first autonomous self-replicating system or was a derivative of a still-earlier system. One version of the hypothesis is that a different type of nucleic acid, termed pre-RNA, was the first one to emerge as a self-reproducing molecule, to be replaced by RNA only later.
|
|
In enzymology, a [RNA-polymerase]-subunit kinase () is an enzyme that catalyzes the chemical reaction :ATP + [DNA-directed RNA polymerase] \rightleftharpoons ADP + phospho-[DNA-directed RNA polymerase] Thus, the two substrates of this enzyme are ATP and DNA-directed RNA polymerase, whereas its two products are ADP and phospho-[DNA-directed RNA polymerase]. This enzyme belongs to the family of transferases, specifically those transferring a phosphate group to the sidechain oxygen atom of serine or threonine residues in proteins (protein-serine/threonine kinases). The systematic name of this enzyme class is ATP:[DNA-directed RNA polymerase] phosphotransferase. Other names in common use include CTD kinase, and STK9.
|
|
For analysis of RNA, samples should be cryogenically frozen (−196 °C) almost immediately upon collection, or stored in an RNA stabilization and preservation reagent (e.g. RNAlater). The next step is to extract the desired nucleic acids from the sample, which can be performed manually using various published extraction methods or by using one of the many commercially available DNA/RNA extraction kits. Due to the labile nature of RNA, synthesis of complementary DNA (cDNA) using extracted RNA as a template is performed for further analysis. For most molecular genetic sequencing methods of AM fungi a PCR step is required to increase the total amount of target DNA/RNA/cDNA.
|
|
Mov10 is involved in the biological processes of RNA-mediated gene silencing, transcription, transcription regulation and has hydrolase and helicase activity through ATP and RNA binding.
|
|
The XendoU-RNA complex is manganese (Mn2+)-independent. This infers that RNA binding and processing activities can be functionally separated since ions are essential for cleavage.
|
|
Metabarcoding does not use single species DNA/RNA as a starting point, but DNA/RNA from several different organisms derived from one environmental or bulk sample.
|
|
It is possible that RNA-based evolution is still taking place today. Other subcellular entities such as viruses, both DNA-based and RNA-based, do evolve.
|
|
It is the site of inhibition for antibiotics such as macrolides, chloramphenicol, clindamycin, and the pleuromutilins. It includes the 5S ribosomal RNA and 23S ribosomal RNA.
|
|
Ribonuclease E is a bacterial ribonuclease that participates in the processing of ribosomal RNA (9S to 5S rRNA) and the chemical degradation of bulk cellular RNA.
|
|
The expression of SraG was experimentally confirmed by Northern blotting which also indicated this RNA undergoes specific cleavage processing. The function of this RNA is unknown.
|
|
Each RNA segment codes for two viral proteins in opposite orientation such that the negative-sense RNA genome serves as the template for transcription of a single mRNA and the positive-sense copy of the RNA genome templates a second mRNA. The separate coding sequences of the two viral proteins are divided by an intergenic region RNA sequence that is predicted to fold into a stable hairpin structure. The extreme termini of each RNA segment contains a 19 nucleotide highly conserved sequence that is critical for recruitment of the viral replication machinery and initiation of viral mRNA transcription and genomic replication. The conserved 5' and 3' RNA termini sequences are complementary and allows each RNA segment to adopt a double- stranded RNA panhandle structure that maintains the termini in close proximity and results in a circular appearance to purified arenavirus genomic templates visualized by electron microscopy.
|
|
A remarkable feature of this clade of phages is the use of three distinct RNA polymerases during its infection cycle. A giant virion-encapsulated RNAP polymerase which is co-injected (early transcription), a heterodimeric phage RNA polymerase (middle region) and the host RNA polymerase (recognizes late promoters).
|
|
Formation of Z-RNA in living cells was suggested by experiments using anti-Z-RNA antibodies to stain fixed protozoan cells 1\. Zarling, D.A., C.J. Calhoun, C.C. Hardin, and A.H. Zarling, Cytoplasmic Z-RNA. Proc Natl Acad Sci U S A, 1987. 84(17): p. 6117-21.
|
|
Rifampicin inhibits bacterial RNA polymerase, thus it is commonly used to inhibit the synthesis of host bacterial proteins during recombinant protein expression in bacteria. RNA encoding for the recombinant gene is usually transcribed from DNA by a viral T7 RNA polymerase, which is not affected by rifampicin.
|
|
Functional RNAs are often folded, stable molecules with three-dimensional shapes rather than floppy, linear strands. Cations are essential for thermodynamic stabilization of RNA tertiary structures. Metal cations that bind RNA can be monovalent, divalent or trivalent. Potassium (K+) is a common monovalent ion that binds RNA.
|
|
Small nucleolar RNA SNORD60 (also known as U60) is a non-coding RNA that belongs to the C/D class of small nucleolar RNA (snoRNA). Most of the members of the box C/D family function in directing site-specific 2'-O-methylation of substrate RNAs.
|
|
The bacterial SroC RNA is a non-coding RNA gene of around 160 nucleotides in length. SroC is found in several enterobacterial species. This RNA interacts with the Hfq protein. SroC acts as a ‘sponge,’ and base pairs with and regulates activity of the sRNA GcvB.
|
|
These chromatin fragments were hybridized to the biotinylated probe set. Complexes containing biotin-probe + RNA of interest + DNA fragment are captured by magnetic beads labeled with streptavidin. Overview of a next generation sequencing method to characterize RNA binding sites to chromatin. Chromatin isolation by RNA purification.
|
|
RIN assessment allows a scientist to evaluate an experiment's trustworthiness and reproducibility before incurring substantial costs in performing the gene expression studies. RIN is a standard method of measuring RNA integrity and can be used to evaluate the quality of RNA produced by new RNA isolation techniques.
|
|
The RNA Characterization of Secondary Structure Motifs database (RNA CoSSMos) is a repository of three-dimensional nucleic acid PDB structures containing secondary structure motifs ( loops, hairpin loops ...).
|
|
The diversity of ionotropic glutamate receptor subunits, as well as RNA splicing, is determined by RNA editing events of the individual subunits, explaining their extremely high diversity.
|
|
The S1 domain is an essential in protein translation as it interacts with the ribosome and messenger RNA. S1 bind to RNA in a sequence specific manner.
|
|
The techniques commonly used for simultaneously measuring the concentration of a large number of different types of mRNA include Microarray, high throughput sequencing said RNA RNA-Seq.
|
|
Viral protein 1 is an RNA-dependent RNA polymerase, which cycles between the two segments and aids in the formation of ribonucleoprotein complexes with viral protein 3.
|
|
Facilitates virus attachment through interactions with glycosaminoglycans. L- RNA dependent RNA polymerase. Required for replication. Adds a methylated guanosine cap and poly(A) tail to nascent mRNA.
|
|
Purified RNase V1 is a commonly used reagent in molecular biology experiments. In conjunction with other ribonucleases that cleave single-stranded RNA after specific nucleotides or sequences – such as RNase T1 and RNase I – it can be used to map internal interactions in large RNA molecules with complex secondary structure or to perform footprinting experiments on macromolecular complexes containing RNA. RNase V1 is the only commonly used laboratory RNase that provides positive evidence for the presence of double-stranded helical conformations in target RNA. Because RNase V1 has some activity against RNA that is base-paired but single-stranded, dual susceptibility to both RNase V1 and RNase I at a single site in a target RNA molecule provides evidence of this relatively unusual conformation found in RNA loops.
|
|
Genome of Bunyamwera virus The genetic structure of Bunyamwera orthobunyavirus is typical for Bunyavirales viruses, which are an order of enveloped negative-sense, single-stranded RNA viruses with a genome split into three parts—Small (S), Middle (M), and Large (L). The L RNA segment encodes an RNA-dependent RNA polymerase (L protein), the M RNA segment encodes two surface glycoproteins (Gc and Gn) and a nonstructural protein (NSm), while the S RNA segment encodes a nucleocapsid protein (N) and, in an alternative overlapping reading frame, a second nonstructural protein (NSs). The genomic RNA segments are encapsidated by copies of the N protein in the form of ribonucleoprotein (RNP) complexes. The N protein is the most abundant protein in virus particles and infected cells and, therefore, the main target in many serological and molecular diagnostics.
|
|
Chandipura vesiculovirus is an enveloped RNA virus with an approximate genome length of ~11 kb. Viral genome codes for five polypeptides, namely, Nucleocapsid protein N, Phosphoprotein P, Matrix protein M, Glycoprotein G and Large protein L in five monocistronic mRNAs. N protein encapsidates genome RNA into a nuclease-resistant form to protect in from cellular RNAse function. L and P protein together forms viral RNA dependent RNA polymerase; where catalytic functions for RNA polymerization, Capping and Poly-A polymerase resides within the L protein and P acts as a transcriptional activator.
|
|
The structure of several Piwi and Argonaute proteins (Ago) have been solved. Piwi proteins are RNA-binding proteins with 2 or 3 domains: The N-terminal PAZ domain binds the 3'-end of the guide RNA; the middle MID domain binds the 5'-phosphate of RNA; and the C-terminal PIWI domain acts as an RNase H endonuclease that can cleave RNA. The small RNA partners of Ago proteins are microRNAs (miRNAs). Ago proteins utilize miRNAs to silence genes post-transcriptionally or use small-interfering RNAs (siRNAs) in both transcription and post-transcription silencing mechanisms.
|
|
The Actino-pnp RNA motif is a conserved structure found in actinobacteria that is apparently in the 5' untranslated regions of genes predicted to encode exoribonucleases. The RNA element's function is likely analogous to an RNA structure found upstream of polynucleotide phosphorylase genes in E. coli and related enterobacteria. In this latter system, the polynucleotide phosphorlyase gene regulates its own expression levels by a feedback mechanism that involves its activity upon the RNA structure. However, the E. coli RNA appears to be structurally unrelated to the Actino-pnp motif.
|
|
Antisense RNA-type addiction modules use a regulatory strand of RNA which is at least partially "antisense" (having complementary base pair encoding) to bind to toxin RNA, and thus prevent toxin translation. This antisense RNA molecule plays the role of antitoxin, similar to the proteic equivalent described above, and is similarly degraded at a faster rate than the toxin mRNA it inhibits. In addition, the transcription of the antitoxin RNA is heavily upregulated by a strong promoter which ensures excess antitoxin in cells which have a functioning addiction module.
|
|
Sequence library construction can be performed using a variety of different kits depending on the high-throughput sequencing platform being employed. However, there are several common steps for small RNA sequencing preparation. Total RNA Isolation In a given sample all the RNA is extracted and isolated using an isothiocyanate/phenol/chloroform (GITC/phenol) method or a commercial product such as Trizol (Invitrogen) reagent. A starting quantity of 50-100 μg total RNA, 1 g of tissue typically yields 1 mg of total RNA, is usually required for gel purification and size selection.
|
|
Short-RNA transfection is routinely used in biological research to knock down the expression of a protein of interest (using siRNA) or to express or block the activity of a miRNA (using short RNA that acts independently of the cell's RNAi machinery, and therefore is not referred to as siRNA). While DNA-based vectors (viruses, plasmids) that encode a short RNA molecule can also be used, short-RNA transfection does not risk modification of the cell's DNA, a characteristic that has led to the development of short RNA as a new class of macromolecular drugs.
|
|
The RNA-induced silencing complex, or RISC, is a multiprotein complex, specifically a ribonucleoprotein, which incorporates one strand of a single- stranded RNA (ssRNA) fragment, such as microRNA (miRNA), or double-stranded small interfering RNA (siRNA). The single strand acts as a template for RISC to recognize complementary messenger RNA (mRNA) transcript. Once found, one of the proteins in RISC, called Argonaute, activates and cleaves the mRNA. This process is called RNA interference (RNAi) and it is found in many eukaryotes; it is a key process in gene silencing and defense against viral infections.
|
|
Small nucleolar RNA TBR4 is a non-coding RNA (ncRNA) molecule identified in Trypanosoma brucei which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA TBR4 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA TBR2 is a non-coding RNA (ncRNA) molecule identified in Trypanosoma brucei which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA TBR2 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
The RNA degradosome is a huge multi-enzyme association that is involved in RNA metabolism and post-transcriptional control of gene expression in numerous bacteria such as Escherichia coli and Pseudoalteromonas haloplanktis. The multi-protein complex also serves as a machine for processing structured RNA precursors in the course of their maturation. RNA helicase is considered to help in the process of degradation to develop the double helix structure in RNA stem-loops. Occasionally, copurification of rRNA with degradosome is appreciated, which suggests that the complex may take part in rRNA and mRNA degradation.
|
|
Human DEAD-box RNA helicase This image represents the different promoter sequences and accessory domains that aid in RNA unwinding (local strand separation). The regions in red are ATP binding domains and the regions in yellow are RNA interaction domains. Specific sequences termed DEAD box proteins are also present that help catalyze reactions in which ATP does not need to be directly hydrolyzed, as long as it binds to the domains on the strand. RNA helicases are essential for most processes of RNA metabolism such as ribosome biogenesis, pre-mRNA splicing, and translation initiation.
|
|
The cell imports the virus by endocytosis. In the acidic endosome, part of the haemagglutinin protein fuses the viral envelope with the vacuole's membrane, releasing the viral RNA (vRNA) molecules, accessory proteins and RNA-dependent RNA polymerase into the cytoplasm (Stage 2). These proteins and vRNA form a complex that is transported into the cell nucleus, where the RNA-dependent RNA polymerase begins transcribing complementary positive-sense cRNA (Steps 3a and b). The cRNA is either exported into the cytoplasm and translated (step 4), or remains in the nucleus.
|
|
Dicer, also known as endoribonuclease Dicer or helicase with RNase motif, is an enzyme that in humans is encoded by the DICER1 gene. Being part of the RNase III family, Dicer cleaves double-stranded RNA (dsRNA) and pre-microRNA (pre-miRNA) into short double-stranded RNA fragments called small interfering RNA and microRNA, respectively. These fragments are approximately 20-25 base pairs long with a two-base overhang on the 3' ends. Dicer facilitates the activation of the RNA-induced silencing complex (RISC), which is essential for RNA interference.
|
|
Small interfering RNA (siRNA) are produced and function in a similar manner to miRNA by cleaving double-stranded RNA with Dicer into smaller fragments, 21 to 23 nucleotides in length. Both miRNAs and siRNAs activate the RNA-induced silencing complex (RISC), which finds the complementary target mRNA sequence and cleaves the RNA using RNase. This in turn silences the particular gene by RNA interference. siRNAs and miRNAs differ in the fact that siRNAs are typically specific to the mRNA sequence while miRNAs aren't completely complementary to the mRNA sequence.
|
|
This observation suggested a Dicer specific role in retinal health that was independent of the RNAi pathway and thus not a function of si/miRNA generation. A form of RNA called Alu RNA (the RNA transcripts of alu elements)) was found to be elevated in patients with insufficient Dicer levels. These non coding strands of RNA can loop forming dsRNA structures that would be degraded by Dicer in a healthy retina. However, with insufficient Dicer levels, the accumulation of alu RNA leads to the degeneration of RPE as a result of inflammation.
|
|
The C-terminus of RPB1 is appended to form the C-terminal domain (CTD). The carboxy-terminal domain of RNA polymerase II typically consists of up to 52 repeats of the sequence Tyr-Ser-Pro-Thr-Ser-Pro-Ser. The domain stretches from the core of the RNAPII enzyme to the exit channel, this placement is effective due to its inductions of "RNA processing reactions, through direct or indirect interactions with components of the RNA processing machinery". The CTD domain does not exist in RNA Polymerase I or RNA Polymerase III.
|
|
The RNA Polymerase CTD was discovered first in the laboratory of C.J.Ingles at the University of Toronto and also in the laboratory of J Corden at Johns Hopkins University during the processes of sequencing the DNA encoding the RPB1 subunit of RNA polymerase from Yeast and Mice respectively. Other proteins often bind the C-terminal domain of RNA polymerase in order to activate polymerase activity. It is the protein domain that is involved in the initiation of transcription, the capping of the RNA transcript, and attachment to the spliceosome for RNA splicing.
|
|
The sigma factor functions in aiding in promoter recognition, correct placement of RNA polymerase, and beginning unwinding at the start site. After the sigma factor performs its required function, it dissociates, while the catalytic portion remains on the DNA and continues transcription. Additionally, RNA polymerase contains a core Mg+ ion that assists the enzyme with its catalytic properties. RNA polymerase works by catalyzing the nucleophilic attack of 3’ OH of RNA to the alpha phosphate of a complementary NTP molecule to create a growing strand of RNA from the template strand of DNA.
|
|
Most known RNA thermometers are located in the 5′ untranslated region (UTR) of messenger RNA encoding heat shock proteins—though it has been suggested this fact may be due, in part, to sampling bias and inherent difficulties of detecting short, unconserved RNA sequences in genomic data. Though predominantly found in prokaryotes, a potential RNA thermometer has been found in mammals including humans. The candidate thermosensor heat shock RNA-1 (HSR1) activates heat-shock transcription factor 1 (HSF1) and induces protective proteins when cell temperature exceeds 37 °C (body temperature), thus preventing the cells from overheating.
|
|
This causes the breakdown of VP7 trimers into single protein subunits, leaving the VP2 and VP6 protein coats around the viral dsRNA, forming a double-layered particle (DLP). The eleven dsRNA strands remain within the protection of the two protein shells and the viral RNA-dependent RNA polymerasecreates mRNA transcripts of the double-stranded viral genome. By remaining in the core, the viral RNA evades innate host immune responses called RNA interference that are triggered by the presence of double-stranded RNA. During the infection, rotavirus produces mRNA for both protein biosynthesis and gene replication.
|
|
Antisense oligonucleotides are single strands of DNA or RNA that are complementary to a chosen sequence. In the case of antisense RNA they prevent protein translation of certain messenger RNA strands by binding to them, in a process called hybridization. Antisense oligonucleotides can be used to target a specific, complementary (coding or non-coding) RNA. If binding takes place this hybrid can be degraded by the enzyme RNase H. RNase H is an enzyme that hydrolyzes RNA, and when used in an antisense oligonucleotide application results in 80-95% down-regulation of mRNA expression.
|
|
Z12 small nucleolar RNA is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. Z12 snoRNA belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Z30 small nucleolar RNA, also known as SNORD7, is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. Z30 snoRNA belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
RNA degradation has particular importance in regulation of expression in eukaryotic cells where mRNA has to travel significant distances before being translated. In eukaryotes, RNA is stabilised by certain post-transcriptional modifications, particularly the 5′ cap and poly-adenylated tail. Intentional degradation of mRNA is used not just as a defence mechanism from foreign RNA (normally from viruses) but also as a route of mRNA destabilisation. If an mRNA molecule has a complementary sequence to a small interfering RNA then it is targeted for destruction via the RNA interference pathway.
|
|
Antisense RNA-based treatment (also known as gene silencing therapy) involves (a) identifying bacterial genes that encode essential proteins (eg. the Pseudomonas aeruginosa genes acpP, lpxC, and rpsJ), (b) synthesizing single stranded RNA that is complementary to the mRNA encoding these essential proteins, and (c) delivering the single stranded RNA to the infection site using cell-penetrating peptides or liposomes. The antisense RNA then hybridizes with the bacterial mRNA and blocks its translation into the essential protein. Antisense RNA-based treatment has been shown to be effective in in vivo models of P. aeruginosa pneumonia.
|
|
The relative affinities of the proteins for DNA and RNA vary with solution conditions and are inversely correlated, so that conditions promoting strong DNA binding result in weak RNA binding. RNA binding protein domains in other proteins that are similar to the RNA binding domain of protein K are called K-homology or KH domains. Protein K has been the subject of study related to colorectal cancer, in which an RNA editing event inducing the expression of an isoform containing a point mutation was found to be specific to cancerous cells.
|
|
HCV genome Nonstructural protein 5B (NS5B) is a viral protein found in the hepatitis C virus (HCV). It is an RNA-dependent RNA polymerase, having the key function of replicating HCV's viral RNA by using the viral positive RNA strand as a template to catalyze the polymerization of ribonucleoside triphosphates (rNTP) during RNA replication. Several crystal structures of NS5B polymerase in several crystalline forms have been determined based on the same consensus sequence BK (HCV-BK, genotype 1). The structure can be represented by a right hand shape with fingers, palm, and thumb.
|
|
Small nucleolar RNA TBR12 is a non-coding RNA (ncRNA) molecule identified in Trypanosoma brucei which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA TBR12 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA TBR6 is a non-coding RNA (ncRNA) molecule identified in Trypanosoma brucei which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA TBR6 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small Nucleolar RNA SNORD23 (also known as HBII-115) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD23 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD75 (also known as U75) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. U75 (SNORD75) belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD88 (also known as HBII-180) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD88 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD92 (also known as HBII-316) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD92 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Mature messenger RNA, often abbreviated as mature mRNA is a eukaryotic RNA transcript that has been spliced and processed and is ready for translation in the course of protein synthesis. Unlike the eukaryotic RNA immediately after transcription known as precursor messenger RNA, mature mRNA consists exclusively of exons and has all introns removed. Mature mRNA is also called "mature transcript", "mature RNA" or "mRNA". The production of a mature mRNA molecule occurs in 3 steps: # During capping, a 7-methylguanosine residue is attached to the 5'-terminal end of the primary transcripts.
|
|
Small Nucleolar RNA SNORD100 (also known as HBII-429) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD100 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD110 (also known as HBII-55) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. HBII-55 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD111 (also known as HBII-82) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD111 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD93 (also known as HBII-336) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD93 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD98 (also known as HBII-419) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD98 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Small Nucleolar RNA SNORD99 (also known as HBII-420) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNORD99 belongs to the C/D box class of snoRNAs which contain the C (UGAUGA) and D (CUGA) box motifs.
|
|
Octopuses and other coleoid cephalopods are capable of greater RNA editing (which involves changes to the nucleic acid sequence of the primary transcript of RNA molecules) than any other organisms. Editing is concentrated in the nervous system and affects proteins involved in neural excitability and neuronal morphology. More than 60% of RNA transcripts for coleoid brains are recoded by editing, compared to less than 1% for a human or fruit fly. Coleoids rely mostly on ADAR enzymes for RNA editing, which requires large double-stranded RNA structures to flank the editing sites.
|
|
Small nucleolar RNA Z151 (homologous to R11) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z151 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA snoR639 (also known as snoH1) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. snoR639 was originally identified in a study of Drosophila melanogaster minifly (mfl) gene; snoR639 resides in the intron of this gene.
|
|
Z6 small nucleolar RNA is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. Z6 snoRNA belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Foot- and-mouth disease virus genome and RNA structural elements Genomic RNAs of picornaviruses possess multiple RNA elements and they are required for both negative and plus strand RNA synthesis. The cis acting replication(cre) element is required for replication. The stem-loop-structure that contains the cre is independent of position but changes with location between virus types when it has been identified. Also, the 3’ end elements of viral RNA are significant and efficient for RNA replication of picornaviruses. The 3’ end of picornavirus contains poly(A) tract which be required for infectivity.
|
|
Small nucleolar RNA Z159/U59 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z159/U59 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z161 (homologous to snoRNA Z228) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z161 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z163 (homologous to snoRNA Z177) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z163 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z168/Z174 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z168/Z174 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Cm2645 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Cm2645 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Cm3227 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Cm3227 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Cm788 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell, which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Cm788 belongs to the C/D box class of snoRNAs, which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Gm1083 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Gm1083 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Gm3113 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Gm3113 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Gm3255 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Gm3255 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Um3344 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Um3344 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R12 (also known as snoR12) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoR12 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R16 is a non-coding RNA (ncRNA) molecule identified in plants which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA R16 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R20 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA R20 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R21 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA R21 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R38 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA R38 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R43 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA R43 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA TBR17 is a non-coding RNA (ncRNA) molecule identified in Trypanosoma brucei which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA TBR17 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA TBR7 is a non-coding RNA (ncRNA) molecule identified in Trypanosoma brucei which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA TBR7 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA U2-19 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA U2-19 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA U2-30 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA U2-30 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z101 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z101 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z103 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z103 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z105 (also known as snoR7) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z105 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z112 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z112 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z119 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z119 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z122 (also known as snoR72Y) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z122 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z155 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z155 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z162 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z162 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z165 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z165 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z169 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z169 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z173 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z173 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z175 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z175 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z178 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z178 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z182 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z182 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z185 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z185 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z188 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z188 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z194 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z194 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z206 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z206 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
U98 small nucleolar RNA also is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide" RNA. U98 belongs to the H/ACA box class of snoRNAs which are thought to guide the sites of modification of uridines to pseudouridines, the target for this family is unknown.
|
|
Small nucleolar RNA R66 (also known as snoR66) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoR66 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R79 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA R79 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA snoM1 is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. M1 is a predicted to belong to the H/ACA box class of snoRNAs which are thought to guide the sites of modification of uridines to pseudouridines.
|
|
Small nucleolar RNA snoR1 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA snoR1 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R28 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA R28 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA snoR60 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA snoR60 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z196/R39/R59 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z196/R39/R59 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z221 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z221 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z223 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z223 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z247 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z247 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z256 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z256 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z266 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z266 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z267 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z267 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z278 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z278 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z279 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z279 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z39 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z39 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z40 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z40 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z43 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z43 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z50 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z50 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z118/Z121/Z120 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z118/Z121/Z120 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA snR52 (homologous to Z13) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z13 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA J26 is a non-coding RNA (ncRNA) molecule identified in rice (Oryza sativa) which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. J26 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA J33 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA J33 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA MBII-202 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA MBII-202 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me18S-Gm1358 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me18S-Gm1358 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me18S-Um1356 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me18S-Um1356 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Am2589 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Am2589 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Me28S-Am982 is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Me28S-Am982 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA SNORD54 (also known as U54) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA SNORD54 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
The Alanine-World-Hypothesis assumes that known life biochemistry originated within the frame of the old RNA world ("GC code"). The RNA world hypothesis, if true, has important implications for the definition of life. For most of the time that followed Watson and Crick's elucidation of DNA structure in 1953, life was largely defined in terms of DNA and proteins: DNA and proteins seemed the dominant macromolecules in the living cell, with RNA only aiding in creating proteins from the DNA blueprint. The RNA world hypothesis places RNA at center-stage when life originated.
|
|
MODOMICS is a comprehensive database that contains information about RNA modifications. MODOMICS provides the following information: the chemical structure of the modified RNAs, the RNA modifying pathways, the location of the modifications in the RNA sequences, the enzymes responsible for the modifications and liquid chromatography/mass spectrometry(LC/MS) data of the modified RNAs. As of November 2017, the database contained 163 different RNA modifications, as well as 340 different enzymes and cofactors involved in the modifications. This database classifies RNA modifying pathways according to their starting point.
|
|
The success of DNA nanotechnology has allowed designers to develop RNA nanotechnology as a growing discipline. RNA nanotechnology combines the simplistic design and manipulation characteristic of DNA, with the additional flexibility in structure and diversity in function similar to that of proteins. RNA’s versatility in structure and function, favorable in vivo attributes, and bottom-up self-assembly is an ideal avenue for developing biomaterial and nanoparticle drug delivery. Several techniques were developed to construct these RNA nanoparticles, including RNA cubic scaffold, templated and non-templated assembly, and RNA origami.
|
|
Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events.
|
|
NS2B protein, a transmembrane protein, directly interacts with NS3 which is a soluble protein anchored to the membrane. With its protease activity and RNA helicase activity, the NS3 protein is involved in viral polyprotein processing and viral RNA replication. NS5 plays a role in the replication of the viral genomic RNA and the formation of the 5’-cap structure for protein translation with its RNA dependent and RNA polymerase (RdRp) activity and methyltransferase activity. The 5′-end possesses a type I cap (m7GpppAmp) that is not seen in viruses of the other genera.
|
|
Phenotype may also be determined by the number of RNA molecules, as more RNA transcripts lead to a greater expression of protein. Short tails of repetitive nucleic acids are often added to the ends of RNA molecules in order to prevent degradation, effectively increasing the number of RNA strands able to be translated into protein. During mammalian liver regeneration RNA molecules of growth factors increase in number due to the addition of signaling tails. With more transcripts present the growth factors are produced at a higher rate, aiding the rebuilding process of the organ.
|
|
The molecular basis of high error rates is the limited template-copying fidelity of RNA-dependent RNA polymerases (RdRps) and RNA-dependent DNA polymerases (also termed reverse transcriptases, RTs). In addition, these enzymes are defective in proofreading because they lack a 3’ to 5’ exonuclease domain present in replicative cellular DNA polymerases. Also, postreplicative-repair pathways, abundant to correct genetic lesions in replicating cellular DNA, appear as ineffective for double-stranded RNA or RNA-DNA hybrids. The presence of a proofreading-repair activity in coronaviruses increases their copying accuracy in about 15-fold.
|
|
Figure 5: A) Human telomerase RNA (hTR) is present in the cell and can be targeted. B) 2-5 anti-hTR oligonucleotides is a specialized antisense oligo that can bind to the telomerase RNA. C) Once bound, the 2-5 anti-hTR oligonucleotide recruits RNase L to the sequence. Once recruited, the RNase L creates a single cleavage in the RNA (D) and causes dissociation of the RNA sequence.
|
|
Hydrolytic exoribonucleases are classified under EC number 3.1 and phosphorolytic exoribonucleases under EC number 2.7.7. As the phosphorolytic enzymes use inorganic phosphate to cleave bonds they release nucleotide diphosphates, whereas the hydrolytic enzymes (which use water) release nucleotide monosphosphates. Exoribonucleases exist in all kingdoms of life, the bacteria, archaea, and eukaryotes. Exoribonucleases are involved in the degradation of many different RNA species, including messenger RNA, transfer RNA, ribosomal RNA and miRNA.
|
|
Although RNA binding proteins may regulate post transcriptionally large amount of the transcriptome, the targeting of a single gene is of interest to the scientific community for medical reasons, this is RNA interference and microRNAs which are both examples of posttranscriptional regulation, which regulate the destruction of RNA and change the chromatin structure. To study post-transcriptional regulation several techniques are used, such as RIP-Chip (RNA immunoprecipitation on chip).
|
|
Szybalski's rule says that lower-protein particles like viruses contain more purines than pyrimidine in their nucleic acid sequence. This is to prevent double-stranded RNA formation of one or two separate RNA strand that have complementary regions. The formation of a double-stranded RNA is not efficient for viruses as it may delay or stop RNA replication or protein formation. The rule is named for Wacław Szybalski.
|
|
An example of an RNA stem-loop. If now a second RNA stem-loop has complementary base-sequence, the two loops can base pair resulting in a kissing loop. This animated GIF shows two RNA loops (orange and green) bind to each other in a structure called a kissing loop. The two RNA loops interact through stacking interactions and through hydrogen bonding (interacting bases shown in space-filling representation).
|
|
SINEs exploit LINE transposition components despite LINE-binding proteins prefer binding to LINE RNA. SINEs cannot transpose by themselves because they cannot encode SINE transcripts. They usually consist of parts derived from tRNA and LINEs. The tRNA portion contains an RNA polymerase III promoter which the same kind of enzyme as RNA polymerase II. This makes sure the LINE copies would be transcribed into RNA for further transposition.
|
|
118; Collier p. 78 ; RNA viruses: Replication of RNA viruses usually takes place in the cytoplasm. RNA viruses can be placed into four different groups depending on their modes of replication. The polarity (whether or not it can be used directly by ribosomes to make proteins) of single-stranded RNA viruses largely determines the replicative mechanism; the other major criterion is whether the genetic material is single-stranded or double-stranded.
|
|
T7 polymerase is a representative member of the single-subunit DNA-dependent RNAP (ssRNAP) family. Other members include phage T3 and SP6 RNA polymerases, the mitochondrial RNA polymerase (POLRMT), and the chloroplastic ssRNAP. The ssRNAP family is structurally and evolutionarily distinct from the multi- subunit family of RNA polymerases (including bacterial and eukaryotic sub- families). In contrast to bacterial RNA polymerases, T7 polymerase is not inhibited by the antibiotic rifampicin.
|
|
In biology, a gene is a sequence of nucleotides in DNA or RNA that encodes the synthesis of a gene product, either RNA or protein. During gene expression, the DNA is first copied into RNA. The RNA can be directly functional or be the intermediate template for a protein that performs a function. The transmission of genes to an organism's offspring is the basis of the inheritance of phenotypic trait.
|
|
During transcription, a DNA sequence is read by an RNA polymerase, which produces a complementary, antiparallel RNA strand called a primary transcript. Transcription proceeds in the following general steps: #RNA polymerase, together with one or more general transcription factors, binds to promoter DNA. #RNA polymerase generates a transcription bubble, which separates the two strands of the DNA helix. This is done by breaking the hydrogen bonds between complementary DNA nucleotides.
|
|
Ribozymes have been proposed and developed for the treatment of disease through gene therapy (3). One major challenge of using RNA based enzymes as a therapeutic is the short half-life of the catalytic RNA molecules in the body. To combat this, the 2’ position on the ribose is modified to improve RNA stability. One area of ribozyme gene therapy has been the inhibition of RNA-based viruses.
|
|
The importance of these non-coding regions is supported by evolutionary reasoning, as natural selection would have otherwise eliminated this unusable RNA. It is important to distinguish the 5' and 3' UTRs from other non-protein-coding RNA. Within the coding sequence of pre-mRNA, there can be found sections of RNA that will not be included in the protein product. These sections of RNA are called introns.
|
|
La is involved in diverse aspects of RNA metabolism, including binding and protecting 3-prime UUU (OH) elements of newly RNA polymerase III-transcribed RNA, processing 5-prime and 3-prime ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. La protein was originally defined by its reactivity with autoantibodies from patients with Sjögren's syndrome and systemic lupus erythematosus.
|
|
During the initial transcription phase, the RNA polymerase searches for a promoter region on the DNA template strand. Once the RNA polymerase binds to this region, it begins to “read” the template DNA strand in the 3’ to 5’ direction. RNA polymerase attaches RNA bases complementary to the template DNA strand (Uracil will be used instead of Thymine). The new nucleotide bases are bonded to each other covalently.
|
|
Regions of the U17 RNA are complementary to rRNA and act as guides for RNA/RNA interactions, although these regions do not seem to be well conserved between organisms. There is evidence that SNORA73 (isoforms: SNORA73A and SNORA73B) functions as a regulator of chromatin function. SNORA73 is chromatin-associated RNA (caRNA) and stably linked to chromatin. Notably, SNORA73 can bind to PARP1, leading to the activation of its ADPRylation (PAR) function.
|
|
The RNA tectonics methodology. Nadrian Seeman was the first one who proposed that DNA could be used as material for generating nanoscopic self-assembling structures. This concept was extended to RNA by Jaeger and collaborators in 2000 by taking advantage of the concept of RNA tectonics initially proposed by Jaeger and Westhof and collaborators in 1996. To design a tectoRNA, the deep knowledge of RNA tertiary structure is required.
|
|
The chemical properties of RNA make large RNA molecules inherently fragile, and they can easily be broken down into their constituent nucleotides through hydrolysis. These limitations do not make use of RNA as an information storage system impossible, simply energy intensive (to repair or replace damaged RNA molecules) and prone to mutation. While this makes it unsuitable for current 'DNA optimised' life, it may have been acceptable for more primitive life.
|
|
The RNA world hypothesis is supported by RNA's ability to store, transmit, and duplicate genetic information, as DNA does. RNA can act as a ribozyme, a special type of enzyme. Because it can perform the tasks of both DNA and enzymes, RNA is believed to have once been capable of supporting independent life forms. Some viruses use RNA as their genetic material, rather than DNA.Patton, John T. Editor (2008).
|
|
Exogenous retroviruses are infectious RNA- or DNA-containing viruses that are transmitted from one organism to another. In the Baltimore classification system, which groups viruses together based on their manner of messenger RNA synthesis, they are classified into two groups: Group VI: single-stranded RNA viruses with a DNA intermediate in their life cycle, and Group VII: double- stranded DNA viruses with an RNA intermediate in their life cycle.
|
|
Viruses in Orthornavirae have three different types of genomes: dsRNA, +ssRNA, and -ssRNA. Single-stranded RNA viruses have either a positive or negative sense strand, and dsRNA viruses have both. This structure of the genome is important in terms of transcription to synthesize viral mRNA as well as replication of the genome, both of which are carried out by the viral enzyme RNA-dependent RNA polymerase (RdRp), also called RNA replicase.
|
|
Katalin Karikó (born 17 January 1955 in Szolnok, Hungary) is a Hungarian biochemist who specializes in RNA-mediated mechanisms. Her research has been the development of vitro-transcribed mRNA for protein therapies. She currently serves as the Senior Vice President at BioNTech RNA Pharmaceuticals. Karikó's work includes scientific research of RNA-mediated immune activation resulting in the co-discovery of the nucleoside modifications that suppress the immunogenicity of RNA.
|
|
The ssNA-helicase RNA motif is a conserved RNA structure that was discovered by bioinformatics. Although the ssNA-helicase motif was published as an RNA candidate, there is some reason to suspect that it might function as a single- stranded DNA. In terms of secondary structure, RNA and DNA are difficult to distinguish when only sequence information is available. ssNA-helicase motif RNAs are found in Firmicutes and Actinobacteria.
|
|
The Transposase-2 RNA motif is a conserved RNA structure that was discovered by bioinformatics. These RNAs are usually located nearby to genes that encode transposases, which are the main component of transposons. Many kinds of transposon are found adjacent to inverted repeats, which could be mistaken for simple RNA secondary structures. Therefore Transposase-2 RNAs could reflect this side effect of transposon replication, and not encode a separate RNA.
|
|
MeRIPseq stands for methylated RNA immunoprecipitation sequencing, which is a method for detection of post-transcriptional RNA modifications. It is also called m6A-seq. A variation of the MerIP-seq method was coined by Benjamin Delatte and colleagues in 2016. This variant, called hMerIP-seq (hydroxymethylcytosine RNA immunoprecipitation), uses an antibody that specifically recognizes 5-hydroxymethylcytosine, a modified RNA base affecting in vitro translation and brain development in Drosophila.
|
|
Therefore, this GOLLD RNA presumably serves a function that is useful to the phage during this process. GOLLD RNAs are often located near transfer RNAs (tRNAs), and in some cases a tRNA is predicted to be inside the GOLLD RNA structure itself. However, the biological reason underlying this association is not understood. A more recently discovered large bacterial RNA, named the ROOL RNA motif, shares properties with GOLLD RNAs.
|
|
Left: DNA (DAPI)-stained nucleus. Arrow indicates the location of Barr body(Xi). Right: DNA associated histones protein detected The figure shows confocal microscopy images from a combined RNA-DNA FISH experiment for Xist in fibroblast cells from adult female mouse, demonstrating that Xist RNA is coating only one of the X-chromosomes. RNA FISH signals from Xist RNA are shown in red color, marking the inactive X-chromosome (Xi).
|
|
Preribosomal RNA (pre-rRNA) represents a small class of RNA that is copied from DNA representing the genome sequence. However the pre-rRNA cannot be used for protein production until splicing of the introns occurs, forming a new bond between the exons and resulting in mature ribosomal RNA (rRNA).
|
|
Viral replication is cytoplasmic, and is lysogenic. Entry into the host cell is achieved by penetration into the host cell. Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription, using the premature termination model of subgenomic RNA transcription is the method of transcription.
|
|
In molecular biology, the Avian encephalitis virus cis-acting replication element (CRE) is an s an RNA element which is found in the coding region of the RNA-dependent RNA polymerase in Avian encephalitis virus (AEV). It is structurally similar to the Hepatitis A virus cis-acting replication element.
|
|
Trans-Spliced Exon Coupled RNA End Determination (TEC-RED) is a transcriptomic technique that, like SAGE, allows for the digital detection of messenger RNA sequences. Unlike SAGE, detection and purification of transcripts from the 5’ end of the messenger RNA require the presence of a trans-spliced leader sequence.
|
|
TopHat is an open-source bioinformatics tool for the throughput alignment of shotgun cDNA sequencing reads generated by transcriptomics technologies (e.g. RNA-Seq) using Bowtie first and then mapping to a reference genome to discover RNA splice sites de novo. TopHat aligns RNA-Seq reads to mammalian-sized genomes.
|
|
The virus genome consists of three segments of negative-stranded RNA; the large (L) segment encodes the viral RNA-dependent RNA polymerase, the medium (M) segment encodes the envelope glycoproteins Gn and Gc (cotranslationally cleaved from a glycoprotein precursor), and the small (S) segment encodes the nucleocapsid (N) protein.
|
|
DNA-directed RNA polymerases I, II, and III subunit RPABC3 is a protein that in humans is encoded by the POLR2H gene. This gene encodes one of the essential subunits of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III.
|
|
The tymoviruses/pomovirusesfamily tRNA-like 3' UTR element is an RNA element found in the 3' UTR of some viruses. This element acts in conjunction with UPSK RNA and a 5'-cap to enhance translation. The secondary structure of this RNA element is a cloverleaf that resembles tRNA.
|
|
Exoribonuclease H () is an enzyme. This enzyme catalyses the following chemical reaction : 3'-end directed exonucleolytic cleavage of viral RNA-DNA hybrid This is a secondary reaction to the RNA 5'-end directed cleavage 13-19 nucleotides from the RNA end performed by EC 3.1.26.13 (retroviral ribonuclease H).
|
|
The diversity of the subunits is determined, as well as RNA splicing, by RNA editing events of the individual subunits. This give rise to the necessary diversity of the receptors. GluR4 is a gene product of the GRIA4 gene, and its pre-mRNA is subject to RNA editing.
|
|
TBP's C-terminus composes of a helicoidal shape that (incompletely) complements the T-A-T-A region of DNA. This incompleteness allows DNA to be passively bent on binding. For information on the use of TBP in cells see: RNA polymerase I, RNA polymerase II, and RNA polymerase III.
|
|
Steroid receptor RNA activator 1 also known as steroid receptor RNA activator protein (SRAP) is a protein that in humans is encoded by the SRA1 gene. The mRNA transcribed from the SRA1 gene is a component of the ribonucleoprotein complex containing NCOA1. This functional RNA also encodes a protein.
|
|
Kirkegaard and Baltimore presented evidence that RNA-dependent RNA polymerase (RdRP) catalyzes recombination by a copy choice mechanism in which the RdRP switches between (+)ssRNA templates during negative strand synthesis. Recombination in RNA viruses appears to be an adaptive mechanism for transmitting an undamaged genome to virus progeny.
|
|
Cdc14 also appears to inhibit RNA polymerase I, which helps allow complete chromosome disjunction by eliminating ribosomal RNA (rRNA) transcripts that otherwise would block condensin binding to rDNA.
|
|
Internal Ribosome Entry Site (IRES) are RNA structures that allow cap independent initiation of translation, and are able to initiate translation in the middle of a messenger RNA.
|
|
The tyrT operon consists of an upstream activation sequence, the gene for the tyrosine tRNA called tRNA1Tyr, and an RNA called rtT RNA which has an unknown function.
|
|
Scherrer obtained his PhD in biochemistry from Swiss Institute of Technology, Zurich (ETH). He worked as a research assistant for James Darnell at MIT, where in 1962 he discovered the existence of giant pre-ribosomal and pre- messenger RNA in animal cells,Scherrer, Klaus; Darnell, James E (1962) »Sedimentation characteristics of rapidly labelled RNA from HeLa cells » Biochem Biophys Res Commun 7, 486–489Scherrer, Klaus (2003) « Historical review: The discovery of ‘giant’ RNA and RNA processing: 40 years of enigma », In Trends in Biochemical Sciences 28, 566-571 and observed for the first time the processing of pre-ribosomal RNA (pre-rRNA) into functional rRNA.Scherrer, Klaus; Lathman,H, Darnell, James E (1962) « Demonstration of an Unstable RNA and of a Precursor to Ribosomal RNA in Hela Cells» in Proc. Natl. Acad. Sci. USA, 49, 240–24,8 These discoveries made it possible to understand a fundamental process in nucleated cells, the synthesis of precursor RNA that is then metabolized in order to extract the information to be expressed.
|
|
Transfer-messenger RNA (abbreviated tmRNA, also known as 10Sa RNA and by its genetic name SsrA) is a bacterial RNA molecule with dual tRNA-like and messenger RNA-like properties. The tmRNA forms a ribonucleoprotein complex (tmRNP) together with Small Protein B (SmpB), Elongation Factor Tu (EF-Tu), and ribosomal protein S1. In trans-translation, tmRNA and its associated proteins bind to bacterial ribosomes which have stalled in the middle of protein biosynthesis, for example when reaching the end of a messenger RNA which has lost its stop codon. The tmRNA is remarkably versatile: it recycles the stalled ribosome, adds a proteolysis-inducing tag to the unfinished polypeptide, and facilitates the degradation of the aberrant messenger RNA.
|
|
RNA molecules shorter than about 25nt largely evade detection by the innate immune system, which is triggered by longer RNA molecules. Most cells of the body express proteins of the innate immune system, and upon exposure to exogenous long RNA molecules these proteins initiate signaling cascades that result in inflammation. This inflammation hypersensitizes the exposed cell and nearby cells to subsequent exposure. As a result, while a cell can be repeatedly transfected with short RNA with few non-specific effects, repeatedly transfecting cells with even a small amount of long RNA can cause cell death unless measures are taken to suppress or evade the innate immune system (see "Long-RNA transfection" below).
|
|
Like other positive sense single-stranded RNA viruses, Chronic bee paralysis virus replicates in the cytoplasm of honeybee cells. The first large (+) RNA fragment in the CBPV genome likely encodes for an RNA-dependent RNA polymerase, which makes many copies of viral RNA. After many copies of the genome have been produced, the honey bee host's cellular processes will translate the viral RNA into functional proteins which can cause propagation of the virus inside the host. The virus replicates at the highest levels in the head of the honeybee, reaching an average of 107 copies of the virus in an infected worker bee head and as many as 1011 copies of the virus in an infected queen bee head.
|
|
The discovery of catalytic RNA (ribozymes) showed that RNA could both encode genetic information (like DNA) and catalyze specific biochemical reactions (like protein enzymes). This realization led to the RNA World Hypothesis, a proposal that RNA may have played a critical role in prebiotic evolution at a time before the molecules with more specialized functions (DNA and proteins) came to dominate biological information coding and catalysis. Although it is not possible for us to know the course of prebiotic evolution with any certainty, the presence of functional RNA molecules with common ancestry in all modern-day life forms is a strong argument that RNA was widely present at the time of the last common ancestor.
|
|
Negative-strand RNA viruses (-ssRNA viruses) are a group of related viruses that have negative-sense, single-stranded genomes made of ribonucleic acid. They have genomes that act as complementary strands from which messenger RNA (mRNA) is synthesized by the viral enzyme RNA-dependent RNA polymerase (RdRp). During replication of the viral genome, RdRp synthesizes a positive-sense antigenome that it uses as a template to create genomic negative-sense RNA. Negative-strand RNA viruses also share a number of other characteristics: most contain a viral envelope that surrounds the capsid, which encases the viral genome, -ssRNA virus genomes are usually linear, and it is common for their genome to be segmented.
|
|
MALAT1-associated small cytoplasmic RNA, also known as mascRNA, is a non- coding RNA found in the cytosol. This is a small RNA, roughly 53–61 nucleotides in length, that is processed from a much longer ncRNA called MALAT1 by an enzyme called RNase P. This RNA is expressed in many different human tissues, is highly conserved by evolution and shares a remarkable similarity to tRNA which is also produced by RNase P, yet this RNA is not aminoacylated in HeLa cells. The primary transcript, MALAT1 (metastasis associated lung adenocarcinoma transcript 1), appears to be upregulated in several malignant cancers. Another small RNA that is homologous to mascRNA, called menRNA, is processed from another long ncRNA called MEN beta.
|
|
The double-stranded RNA-binding motif (dsRM, dsRBD), a 70–75 amino-acid domain, plays a critical role in RNA processing, RNA localization, RNA interference, RNA editing, and translational repression. All three structures of the domain solved as of 2005 possess uniting features that explain how dsRMs only bind to dsRNA instead of dsDNA. The dsRMs were found to interact along the RNA duplex via both α-helices and β1-β2 loop. Moreover, all three dsRBM structures make contact with the sugar-phosphate backbone of the major groove and of one minor groove, which is mediated by the β1-β2 loop along with the N-terminus region of the alpha helix 2.
|
|
Positive-strand RNA viruses (+ssRNA viruses) are a group of related viruses that have positive-sense, single-stranded genomes made of ribonucleic acid. The positive-sense genome can act as messenger RNA (mRNA) and can be directly translated into viral proteins by the host cell's ribosomes. Positive-strand RNA viruses encode an RNA-dependent RNA polymerase (RdRp) which is used during replication of the genome to synthesize a negative-sense antigenome that is then used as a template to create a new positive-sense viral genome. Positive- strand RNA viruses are divided between the phyla Kitrinoviricota, Lenarviricota, and Pisuviricota (specifically classes Pisoniviricetes and Stelpavirictes) all of which are in the kingdom Orthornavirae and realm Riboviria.
|
|
The firm's RNA editing technology, called Axiomer, can make targeted single nucleotide changes to RNA. One of the company’s lead candidates, QR-110, is being developed to treat LCA10. The substance acts by binding the mutated section of the RNA which will allow a formation of a normal CEP290 protein.
|
|
This is a visual representation of a molecule of RNA. In the 1970’s, he began his work on RNA. Uhlenbeck published many articles on the structure of RNA and its properties. One of his most cited articles is, “The Improved estimation of secondary structure in ribonucleic acids,” published in 1973.
|
|
The Rhodo-rpoB RNA motif is a conserved RNA structure that was discovered by bioinformatics. Rhodo-rpoB motifs are found in Rhodobacterales. Rhodo-rpoB motif RNAs likely function as cis-regulatory elements, in view of their positions upstream of protein-coding genes. The apparently regulated genes encode subunits of RNA polymerase.
|
|
The non-coding RNA were identified as antisense RNA and long non-coding RNAs (lncRNA), poorly understood classes of regulatory RNA. The first published sequence of the mouse genome utilized the annotations established by FANTOM. Other efforts were able to describe entire protein families, such as the G protein-coupled receptors.
|
|
Genome of family Totiviridae The genome is composed of a monopartite, linear double-stranded RNA molecule of 4.6–6.7 kilobases. It contains two overlapping open reading frames (ORF) – gag and pol – which respectively encode the capsid protein and the RNA-dependent RNA polymerase. Some totiviruses contain a third small potential ORF.
|
|
Structure of E. coli's DnaG RNA Polymerase Domain. The highly conserved basic residues, Arg146, Arg221, and Lys229 are shown in yellow. This image was rendered from PDB 1DD9. As its name suggests, the RNA polymerase domain (RNAP) of DnaG is responsible for synthesizing the RNA primers on the single stranded DNA.
|
|
The M1 protein is a matrix protein of the influenza virus. It forms a coat inside the viral envelope. This is a bifunctional membrane/RNA-binding protein that mediates the encapsidation of RNA-nucleoprotein cores into the membrane envelope. It is therefore required that M1 binds both membrane and RNA simultaneously.
|
|
In eukaryotes endoV is primarily a ribonuclease and cleaves single-stranded RNA at the 3' position relative to an inosine base, which may be present due to RNA editing by deaminase enzymes. The human endoV localizes to the cytoplasm and nucleoli, suggesting a possible role in processes involving ribosomal RNA.
|
|
In enzymology, a polynucleotide adenylyltransferase () is an enzyme that catalyzes the chemical reaction :ATP + RNA-3'OH \rightleftharpoons pyrophosphate + RNApA-3'OH Thus, the two substrates of this enzyme are ATP and RNA, whereas its two products are pyrophosphate and RNA with an extra adenosine nucleotide at its 3' end.
|
|
CRISPR/Cas13a (formerly C2c2) from the bacterium Leptotrichia shahii is an RNA-guided CRISPR system that targets sequences in RNA rather than DNA. PAM is not relevant for an RNA-targeting CRISPR, although a guanine flanking the target negatively affects efficacy, and has been designated a "protospacer flanking site" (PFS).
|
|
TNA is simpler than RNA and can be synthesized from a single starting material. TNA is able to transfer back and forth information with RNA and with strands of itself that are complementary to the RNA. TNA has been shown to fold into tertiary structures with discrete ligand-binding properties.
|
|
RNA polymerase III transcribes 5S rRNA, transfer RNA (tRNA) genes, and some small non-coding RNAs (e.g., 7SK). Transcription ends when the polymerase encounters a sequence called the terminator.
|
|
Probable ATP-dependent RNA helicase DDX5 also known as DEAD box protein 5 or RNA helicase p68 is an enzyme that in humans is encoded by the DDX5 gene.
|
|
The lab also studies the dynamic mechanism of RNA splicing, the RNA-binding proteins that determine exonic specificity, and snRNAs that are important regulators of splicing and mRNA maturation.
|
|
Boronate affinity electrophoresis utilizes boronic acid infused acrylimide gels to purify NAD- RNA. This purification allows for researchers to easily measure the kinetic activity of NAD-RNA decapping enzymes.
|
|
Selection of promoters by RNA polymerase is dependent on the sigma factor that associates with it. They are also found in plant chloroplasts as a part of the bacteria-like plastid-encoded polymerase (PEP). The sigma factor, together with RNA polymerase, is known as the RNA polymerase holoenzyme. Every molecule of RNA polymerase holoenzyme contains exactly one sigma factor subunit, which in the model bacterium Escherichia coli is one of those listed below.
|
|
When incorporated into DNA or RNA molecules by DNA/RNA polymerase, 5-(3-aminoallyl)-UTP provide a reactive group for the addition of other chemical groups. Thus aminoallyl modified DNA or RNA can be labeled with any compound which has an amine-reactive group. aa-NTPs incorporated into DNA/RNA in combination with a secondary dye coupling reagents can probe for an array analysis. cDNA relies on aminoallyl labeling for detection purposes.
|
|
The msiK RNA motif describes a conserved RNA structure discovered using bioinformatics. The RNA is always found in the presumed 5' untranslated regions of genes annotated as msiK, and is therefore hypothesized to be an RNA-based cis-regulatory element that regulates these genes. MsiK, the protein encoded by msiK genes, is the ATPase subunit within certain ABC-type membrane transporter proteins. MsiK is thought to allow the import of multiple kinds of complex sugars.
|
|
The Moco-II RNA motif is a conserved RNA structure identified by bioinformatics. However, only 8 examples of the RNA motif are known. The RNAs are potentially in the 5' untranslated regions of genes related to molybdenum cofactor (Moco), specifically a gene that encodes a molybdenum-binding domain and a nitrate reductase, which uses Moco as a cofactor. Thus the RNA might be involved in the regulation of genes based on Moco levels.
|
|
RNA, ribosomal 2, also known as RNR2, is a human gene coding for ribosomal RNA. Genes for ribosomal RNA are clustered on the short arms of chromosomes 13 (RNR1), 14 (RNR2), 15 (RNR3), 20 (RNR4), 21 (RNR5). The gene for RNR2 exists in multiple copies on chromosome 14. Each gene cluster contains 30–40 copies and encodes a 45S RNA product that is then processed to form 18S, 5.8S and 28S rRNA.
|
|
This RNA modification databases are a compilation of databases and web portals and servers used for RNA modification. RNA modification occurs in all living organisms, and is one of the most evolutionarily conserved properties of RNAs. More than 100 different types of RNA modifications have been characterized across all living organisms. It can affect the activity, localization as well as stability of RNAs, and has been linked with human cancer and diseases.
|
|
The RNA exosome is a biomolecular cage that has nuclease activity which catalyzes the breakdown of RNA molecules. Shown above is the whole RNA exosome with a helical protein framework and a central chamber where RNA degradation takes place. Depicted is the tobacco mosaic virus protein coat; virus protein coats known as capsids are examples of macromolecular cages in nature. The protein shell encapsulates a hollow chamber which contains the viral genomic information.
|
|
Unlike RNA, DNA polymerases cannot synthesize DNA from a template strand. Synthesis must be initiated by a short RNA segment, known as RNA primer, synthesized by Primase in the 5' to 3' direction. DNA synthesis then occurs by the addition of a dNTP to the 3' hydroxyl group at the end of the preexisting DNA strand or RNA primer. Secondly, DNA polymerases can only add new nucleotides to the preexisting strand through hydrogen bonding.
|
|
RNA, U4atac small nuclear (U12-dependent splicing) is a small nuclear RNA that in humans is encoded by the RNU4ATAC gene. The small nuclear RNA (snRNA) encoded by this gene is part of the U12-dependent minor spliceosome complex. In addition to the encoded RNA, this ribonucleoprotein complex consists of U11, U12, U5, and U6atac snRNAs. The U12-dependent spliceosome is required for the splicing of approximately 700 specific introns in the human genome.
|
|
The genus is one of 6 genera in subfamily orthoretrovirinae which together with genus Spumavirus form family retroviridae of all RNA retroviruses (RNA viruses which use a DNA intermediate). The order to which family retroviridae belongs is not specified. The taxonomic relationship between RNA retroviruses and other RNA viruses and DNA viruses has not been specified. SIV retroviruses are in group vi (positive-sense single-stranded retroviruses) of the Baltimore classification system.
|
|
The NS3 protein encodes a RNA triphosphatase within its helicase domain. It uses the helicase ATP hydrolysis site to remove the γ-phosphate from the 5′ end of the RNA. The N-terminal domain of the non-structural protein 5 (NS5) has both the N7-methyltransferase and guanylyltransferase activities necessary for forming mature RNA cap structures. RNA binding affinity is reduced by the presence of ATP or GTP and enhanced by S-adenosyl methionine.
|
|
A common divalent ion that binds RNA is magnesium (Mg2+). Other ions including sodium (Na+), calcium (Ca2+) and manganese (Mn2+) have been found to bind RNA in vivo and in vitro. Multivalent organic cations such as spermidine or spermine are also found in cells and these make important contributions to RNA folding. Trivalent ions such as cobalt hexamine or lanthanide ions such as terbium (Tb3+) are useful experimental tools for studying metal binding to RNA.
|
|
LVX does not have a known vector, but it most likely spreads and enters the cell through mechanical inoculation by insects. The replication of LVX, like other ssRNA(+) viruses, occurs in the cytoplasm of cells. Once the virus enters into the host cell, the virus is uncoated and releases the viral genome RNA into the cytoplasm. The viral monocistronic RNA is then translated into RNA-dependent RNA polymerase, encoded by the 5’-proximal ORF.
|
|
NTPs are also energy producing molecules that provide the fuel that drives chemical reactions in the cell. Multiple RNA polymerases can be active at once, meaning many strands of mRNA can be produced very quickly. RNA polymerase moves down the DNA rapidly at approximately 40 bases per second. Due to the quick nature of this process, DNA is continually unwound ahead of RNA polymerase and then rewound once RNA polymerase moves along further.
|
|
The genome is composed a single strand of negative sense RNA in three parts - small (S), medium (M0 and large(L). The L segment RNA is 12,330 nucleotides (nt) in length and encodes one open reading frame (ORF) of 4,050 amino acids. There is a non coding regions: the 5′ region of 40 nt and the 3′ region of 137 nt. This open reading frame encodes several modules including a RNA-dependent RNA polymerase.
|
|
Research in 2006 indicated that centrosomes from Atlantic surf clam eggs contain RNA sequences. The sequences identified were found in "few to no" other places in the cell, and do not appear in existing genome databases. One identified RNA sequence contains a putative RNA polymerase, leading to the hypothesis of an RNA based genome within the centrosome. However, subsequent research has shown that centrosome do not contain their own DNA-based genomes.
|
|
Several subunits of eIF3 contain RNA recognition motifs (RRMs) and other RNA binding domains to form a multisubunit RNA binding interface through which eIF3 interacts with cellular and viral IRES mRNA, including the HCV IRES. eIF3 has also been shown to specifically bind m6A modified RNA within 5'UTRs to promote cap-independent translation. All five core subunits of budding yeast's eIF3 are present in heat-induced stress granules, along with several other translation factors.
|
|
1914282117 have obtained an RNA polymerase ribozyme by in vitro evolution that has an unprecedented level of activity in copying complex RNA molecules. However, this ribozyme is unable to copy itself and its RNA products have a high mutation rate. Nevertheless, progress continues to be made towards the goal of obtaining, by in vitro evolution, an accurate, efficient self-reproducing RNA polymerase ribozyme in order to improve understanding of the early evolution of life.
|
|
Scientists have started to distinguish functional RNA (fRNA) from ncRNA, to describe regions functional at the RNA level that may or may not be stand-alone RNA transcripts. This implies that fRNA (such as riboswitches, SECIS elements, and other cis-regulatory regions) is not ncRNA. Yet fRNA could also include mRNA, as this is RNA coding for protein, and hence is functional. Additionally artificially evolved RNAs also fall under the fRNA umbrella term.
|
|
Inactivation of one of the X chromosomes is initiated by a long non coding RNA called Xist. This lncRNA is expressed on the same chromosome it represses, known as working in cis. Recent research has shown that a repeat element in the RNA of Xist causes PRC2 to bind to the RNA. Another part of the RNA binds to the X-chromosome positioning PRC2 such that it can methylate various regions on the X-chromosome.
|
|
DNA-directed RNA polymerase II subunit RPB2 is an enzyme that in humans is encoded by the POLR2B gene. This gene encodes the second largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit, in combination with at least two other polymerase subunits, forms a structure within the polymerase that maintains contact in the active site of the enzyme between the DNA template and the newly synthesized RNA.
|
|
Upon initiation of a pulse-chase experiment the medium is switched from medium(1) to medium(2). The two media must only differ in their isotope content. Thereby it is possible to distinguish between RNA molecules already existent before experiment initiation (= RNA molecules grown in medium(1)) and RNA molecules that are newly transcribed after experiment initiation (= RNA molecules grown in medium(2)). This allows the detailed study of modification dynamics in vivo.
|
|
Secondary and three-dimensional structures of RNA are formed and stabilized through non-canonical base pairs. Base pairs make up many secondary structural blocks which aid the folding of RNA complexes and three dimensional structures. The overall folded RNA is stabilized by the tertiary and secondary structures canonically base pairing together. Due to the many non-canonical base pairs there are an unlimited amount of structures which allow for the diverse functions of RNA.
|
|
The C0343 RNA is a bacterial non-coding RNA of 74 nucleotides in length that is found between the ydaN and dbpA genes in the genomes of Escherichia coli and Shigella flexneri, Salmonella enterica and Salmonella typhimurium. This ncRNA was originally identified in E.coli using high-density oligonucleotide probe arrays (microarray). The function of this ncRNA is unknown. FnrS RNA was later found to be transcribed from the same intergenic region as C0343 RNA.
|
|
There are six steps in the mechanism of TFIIB action in the formation of the PIC and transcription initiation: #RNA polymerase II is recruited to DNA through the TFIIB B core and B ribbon. #RNA polymerase II unwinds DNA, aided by the TFIIB B linker and B reader (open complex formation). #RNA polymerase II selects a transcription start site, aided by the TFIIB B reader. #RNA polymerase II forms the first phosphodiester bond.
|
|
U1 spliceosomal RNA is the small nuclear RNA (snRNA) component of U1 snRNP (small nuclear ribonucleoprotein), an RNA-protein complex that combines with other snRNPs, unmodified pre-mRNA, and various other proteins to assemble a spliceosome, a large RNA-protein molecular complex upon which splicing of pre- mRNA occurs. Splicing, or the removal of introns, is a major aspect of post- transcriptional modification, and takes place only in the nucleus of eukaryotes.
|
|
The reason being that vault RNAs generally have two very well conserved sequences, surrounded by regions of high variability. This tool is significant not only because it has helped advance the research of vault RNA, but also because of its other applications within the RNA field. Vault RNAs are not the only kind of RNA with this type of semi-conserved/highly variable structure, other notable RNAs include RNAse P, RNAse MRP, and 7SK RNA.
|
|
The SraB RNA is a small non-coding RNA discovered in E. coli during a large scale experimental screen. The 14 novel RNAs discovered were named 'sra' for small RNA, examples include SraC, SraD and SraG. This ncRNA was found to be expressed only in stationary phase. The exact function of this RNA is unknown but it has been shown to affect survival of Salmonella enterica to antibiotic administration in egg albumin.
|
|
SL2 RNA is a non-coding RNA involved in trans splicing in lower eukaryotes. Trans-splicing is a form of RNA processing. The acquisition of a spliced leader from an SL RNA is an inter-molecular reaction which precisely joins exons derived from separately transcribed RNAs. Approximately 25% of C. elegans genes are organised into polycistronic transcription units and the presence of SL2 on an mRNA is an indication the gene is in an operon.
|
|
Like DNA, RNA can carry genetic information. RNA viruses have genomes composed of RNA that encodes a number of proteins. The viral genome is replicated by some of those proteins, while other proteins protect the genome as the virus particle moves to a new host cell. Viroids are another group of pathogens, but they consist only of RNA, do not encode any protein and are replicated by a host plant cell's polymerase.
|
|
Some RNA molecules play an active role within cells by catalyzing biological reactions, controlling gene expression, or sensing and communicating responses to cellular signals. One of these active processes is protein synthesis, a universal function in which RNA molecules direct the synthesis of proteins on ribosomes. This process uses transfer RNA (tRNA) molecules to deliver amino acids to the ribosome, where ribosomal RNA (rRNA) then links amino acids together to form coded proteins.
|
|
The most prominent examples of non-coding RNAs are transfer RNA (tRNA) and ribosomal RNA (rRNA), both of which are involved in the process of translation. There are also non-coding RNAs involved in gene regulation, RNA processing and other roles. Certain RNAs are able to catalyse chemical reactions such as cutting and ligating other RNA molecules, and the catalysis of peptide bond formation in the ribosome; these are known as ribozymes.
|
|
However, the varied and nuanced role of RNA silencing in the regulation of gene expression remains an ongoing scientific inquiry. A range of diverse functions have been proposed for a growing number of characterized small RNA sequences—e.g., regulation of developmental, neuronal cell fate, cell death, proliferation, fat storage, haematopoietic cell fate, insulin secretion. RNA silencing functions by repressing translation or by cleaving messenger RNA (mRNA), depending on the amount of complementarity of base-pairing.
|
|
The Thermales-rpoB RNA motif is a conserved RNA structure that was discovered by bioinformatics. Thermales-rpoB motifs are found in Thermales. Thermales- rpoB motif RNAs likely function as cis-regulatory elements, in view of their positions upstream of protein-coding genes, which invariably encode subunits of RNA polymerase. Such genes are also believed to be regulated by the Rhodo- rpoB RNA motif, although these two motifs occur in quite diverged lineages of bacteria.
|
|
MDA5 is able to detect long dsRNA, the genomic RNA of dsRNA viruses as well as replicative intermediates of both positive and negative sense RNA viruses. MDA5 has also been shown to interact with a number of chemical modifications of RNA. The eukaryotic messenger RNA, for example, is often methylated at the 2’-O position of the first and second nucleotide behind the 5’ cap. These structures are termed cap1 and cap2 respectively.
|
|
There is also evidence that RNA within stress granules is more compacted compared to RNA in the cytoplasm and that the RNA is preferentially post-translationally modified by N6-methyladenosine (m6A) on its 5' ends. Recent work has shown that the highly abundant translation initiation factor and DEAD-box protein eIF4A limits stress granule formation. It does so through its ability to bind ATP and RNA, acting analogously to protein chaperones like Hsp70.
|
|
Originally, transcriptome-wide RNA abundance could only be assessed using methods such as DNA microarrays or serial analysis of gene expression (SAGE). These methods are prohibitive in differing regards; microarrays, while cheap, provide inconsistent results and SAGE is based on sanger sequencing, which provides limited throughput. Using second generation sequencing, instead of measuring relative hybridization of sequences to probes in the case of microarrays or sequencing short segments in the case of SAGE, a researcher can simply sequence the bulk RNA within a sample and measure relative abundances of specific types of RNA by comparing the number of times each RNA molecule was sequenced in a given sample. Normally, in a traditional RNA-seq, microarray, or SAGE experiment RNA is extracted from a biological sample such as cultured cells, and the RNA is analyzed using the chosen method.
|
|
While the terms have sometimes been used interchangeably in the literature, RNAi is generally regarded as a branch of RNA silencing. To the extent it is useful to craft a distinction between these related concepts, RNA silencing may be thought of as referring to the broader scheme of small RNA related controls involved in gene expression and the protection of the genome against mobile repetitive DNA sequences, retroelements, and transposons to the extent that these can induce mutations. The molecular mechanisms for RNA silencing were initially studied in plants but have since broadened to cover a variety of subjects, from fungi to mammals, providing strong evidence that these pathways are highly conserved. At least three primary classes of small RNA have currently been identified, namely: small interfering RNA (siRNA), microRNA (miRNA), and piwi- interacting RNA (piRNA).
|
|
It has been suggested this mechanism acts as a 'self-reinforcing feedback loop' as the degraded nascent transcripts are used by RNA-dependent RNA polymerase (RdRp) to generate more siRNAs.
|
|
The genome encodes 3 to 6 proteins including a coat protein located at the 3' end and an RNA-dependent RNA polymerase located at the 5' end of the genome.
|
|
The discovery of discontinuous genes and RNA splicing was entirely unexpected by the community of RNA biologists, and stands as one of the most shocking findings in molecular biology research.
|
|
This gene product may be seen to play a dual role in both regulating CDK and RNA polymerase II (RNAP2) activities. Cyclin K only uses RNA recruitment to activate transcription.
|
|
Active research is on-going to determine the secondary structure of RNA molecules, with approaches including both experimental and computational methods (see also the List of RNA structure prediction software).
|
|
The nonstructural proteins (nsP) play different functions in the virus cycle. The nsP1 is an mRNA-capping enzyme, nsP2 has protease activity, and nsP4 is a RNA-direct RNA polymerase.
|
|
DNA strands and nascent RNA chain exit from separate channels; the two DNA strands reunite at the trailing end of the transcription bubble while the single strand RNA emerges alone.
|
|
Topo I phosphorylates S2F/ASF increasing the SR proteins affinity for RNA poly II moving S2F/ASF from the Topo I back to RNA poly II allowing elongation to continue.
|
|
Other extraction methods are possible and sometimes needed (e.g. for yeast). RNA is then isolated by Phenol-Chloroform extraction and iso-Propanol precipitation. Further purification of specific RNA species (e.g.
|
|
A further RNA element, SscA RNA, was also identified. The HgcC gene product was experimentally validated by Northern blot and RACE-PCR analysis. The function of this ncRNA is unknown.
|
|
By allowing users to control parameters such as droplet size, droplet frequency, temperature, agitation and timing, innovation is unlocked. The Nadia platform enbales applications such as single cell RNA-Seq (scRNA-Seq), single nuclei RNA-Seq (sNuc-Seq), plant protoplast RNA-Seq (ppRNA-Seq) and the encapsulation of cells in Agarose beads.
|
|
In molecular biology, AfaR small RNA is an Hfq-dependent small RNA produced by the bacterium Escherichia coli. It is an Hfq-dependent RNA which downregulates AfaD-VIII invasin translation by binding to and initiating cleavage of its mRNA. The transcription of AfaR is dependent on the stress response sigma factor sigma E.
|
|
Spheroidal particles each have two copies of RNA 4. The nucleotide sequence of the complete genome has been determined and the length of the genome is 8274 nucleotides ( or 9155 including the subgenomic RNA). RNA 1, 2, 3 and 4 are respectively 3644 (3.65kb), 2593 (2.6kb), 2037 (2.2kb) and 881 (0.88kb) nucleotides long.
|
|
This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains four conserved cysteines characteristic of an atypical zinc-binding domain. Like its counterpart in yeast, this subunit may be shared by the other two DNA-directed RNA polymerases.
|
|
Inside the capsid lies the (+)ssRNA genome consisting of around 3000 nucleotides. The genome is divided into three parts (RNA-1-3) with a subgenomic portion referred to as RNA4. RNA-1, with a heavy density, is surrounded by its own capsid. RNA-2, with a light density, also has its own capsid.
|
|
In molecular biology the ArcZ RNA (also known as RyhA and SraH) is a small non-coding RNA (ncRNA). It is the functional product of a gene which is not translated into protein. ArcZ is an Hfq binding RNA that functions as an antisense regulator of a number of protein coding genes.
|
|
The exact role of H19 RNA within the cell is currently not known. There are various known substances and conditions that are known to activate H19 transcription and there are various known effects of H19 RNA on cell cycle activity/status, although precisely how H19 RNA exerts these effects is still unknown.
|
|
The 6A RNA motif is a conserved RNA structure that was discovered by bioinformatics. 6A motifs are found in Actinobacteria, Firmicutes AND Fusobacteria. 6A RNAs likely function in trans as sRNAs, and contain a pseudoknot. The 6A RNA motif was named after 6 A (adenosine) nucleotides that are highly conserved in the structure.
|
|
Gag proteins bind to copies of the virus RNA genome to package them into new virus particles. HIV-1 and HIV-2 appear to package their RNA differently. HIV-1 will bind to any appropriate RNA. HIV-2 will preferentially bind to the mRNA that was used to create the Gag protein itself.
|
|
The Lacto-3 RNA motif is a conserved RNA structure that was discovered by bioinformatics. Lacto-3 motif RNAs are found in a wide variety of organisms classified under Lactobacillales. Lacto-3 RNAs likely function in trans as small RNAs, and no organism is predicted to contain more than one Lacto-3 RNA.
|
|
Stylized rendering of the full-length hammerhead ribozyme RNA molecule The hammerhead ribozyme is an RNA motif that catalyzes reversible cleavage and ligation reactions at a specific site within an RNA molecule. It is one of several catalytic RNAs (ribozymes) known to occur in nature. It serves as a model system for research on the structure and properties of RNA, and is used for targeted RNA cleavage experiments, some with proposed therapeutic applications. Named for the resemblance of early secondary structure diagrams to a hammerhead shark, hammerhead ribozymes were originally discovered in two classes of plant virus-like RNAs: satellite RNAs and viroids.
|
|
Also, many critical cofactors (ATP, Acetyl-CoA, NADH, etc.) are either nucleotides or substances clearly related to them. The catalytic properties of RNA had not yet been demonstrated when the hypothesis was first proposed, but they were confirmed by Thomas Cech in 1986. One issue with the RNA world hypothesis is that synthesis of RNA from simple inorganic precursors is more difficult than for other organic molecules. One reason for this is that RNA precursors are very stable and react with each other very slowly under ambient conditions, and it has also been proposed that living organisms consisted of other molecules before RNA.
|
|
Pseudouridine (abbreviated by the Greek letter psi- Ψ or the letter Q) is an isomer of the nucleoside uridine in which the uracil is attached via a carbon- carbon instead of a nitrogen-carbon glycosidic bond. (In this configuration, uracil is sometimes referred to as 'pseudouracil'.) Pseudouridine is the most abundant RNA modification in cellular RNA. After transcription and following synthesis, RNA can be modified with over 100 chemically distinct modifications. These can potentially regulate RNA expression post- transcriptionally, in addition to the four standard nucleotides and play a variety of roles in the cell including translation, localization and stabilization of RNA.
|
|
The number of manuscripts on PubMed featuring RNA-Seq is still increasing. RNA-Seq was first developed in mid 2000s with the advent of next-generation sequencing technology. The first manuscripts that used RNA-Seq even without using the term includes those of prostate cancer cell lines (dated 2006), Medicago truncatula (2006), maize (2007), and Arabidopsis thaliana (2007), while the term "RNA-Seq" itself was first mentioned in 2008. The number of manuscripts referring to RNA-Seq in the title or abstract (Figure, blue line) is continuously increasing with 6754 manuscripts published in 2018 (link to PubMed search).
|
|
Retroviruses were shown to have a single-stranded RNA genome and to replicate via a DNA intermediate, the reverse of the usual DNA-to-RNA transcription pathway. They encode a RNA-dependent DNA polymerase (reverse transcriptase) that is essential for this process. Some retroviruses can cause diseases, including several that are associated with cancer, and HIV-1 which causes AIDS. Reverse transcriptase has been widely used as an experimental tool for the analysis of RNA molecules in the laboratory, in particular the conversion of RNA molecules into DNA prior to molecular cloning and/or polymerase chain reaction (PCR).
|
|
Riboswitches demonstrate that naturally occurring RNA can bind small molecules specifically, a capability that many previously believed was the domain of proteins or artificially constructed RNAs called aptamers. The existence of riboswitches in all domains of life therefore adds some support to the RNA world hypothesis, which holds that life originally existed using only RNA, and proteins came later; this hypothesis requires that all critical functions performed by proteins (including small molecule binding) could be performed by RNA. It has been suggested that some riboswitches might represent ancient regulatory systems, or even remnants of RNA-world ribozymes whose bindings domains are conserved.
|
|
Even in resting cells, RNA is degraded in a steady state, and the nucleotide products of this process are later reused for fresh rounds of nucleic acid synthesis. RNA turnover is very important for gene regulation and quality control. All organisms have various tools for RNA degradation, for instance ribonucleases, helicases, 3'-end nucleotidyltransferases (which add tails to transcripts), 5'-end capping and decapping enzymes and assorted RNA- binding proteins that help to model RNA for presentation as substrate or for recognition. Frequently, these proteins associate into stable complexes in which their activities are coordinate or cooperative.
|
|
Many of these RNA metabolism proteins are represented in the components of the multi-enzyme RNA degradosome of Escherichia coli, which is constituted by four basic components: the hydrolytic endo-ribonuclease RNase E, the phosphorolytic exo- ribonuclease PNPase, the ATP-dependent RNA helicase (RhIB) and a glycolytic enzyme enolase. The RNA degradosome was discovered in two different laboratories while they were working on the purification and characterization of E. coli, RNase E and the factors that could have an influence on the activity of the RNA-degrading enzymes, concretely, PNPase. It was found while two of its major compounds were being studied.
|
|
Then RNA Polymerase PA cleaves off the cellular mRNA near the 5′ end and uses this capped fragment as a primer for transcribing the rest of the viral RNA genome in viral mRNA. This is due to the need of mRNA to have a 5′ cap in order to be recognized by the cell's ribosome for translation. Since RNA proofreading enzymes are absent, the RNA-dependent RNA transcriptase makes a single nucleotide insertion error roughly every 10 thousand nucleotides, which is the approximate length of the influenza vRNA. Hence, nearly every newly manufactured influenza virus will contain a mutation in its genome.
|
|
RNA ladders composed of RNA molecular- weight size markers were initially developed by using the synthetic circle method to produce different-sized markers. This technique was improved upon by inventor Eric T. Kool to use circular DNA vectors as a method for producing RNA molecular-weight size markers. As referred to as the rolling circle method, the improvements of this technique stems from its efficiency in synthesizing RNA oligonucleotides. From the circular DNA template, single- stranded RNA varying in length from 4-1500 bp can be produced without the need for primers and by recycling nucleotide triphosphate.
|
|
Arcturus Therapeutics' primary technology platform for RNA therapeutics is called LUNAR a novel Lipid-enabled nanoparticle. LUNAR is a multi-component drug delivery system that enables scientists to target specific cells inside the body and deliver a payload of RNA into the cells cytosol. Once release of the RNA into the cytosol occurs, the normal translational machinery of the cell can interact with the RNA to make functional protein that delivers a therapeutic effect. ARCT-810, the company’s lead product utilizes Arcturus' LUNAR lipid-mediated delivery platform intended to safely and effectively deliver OTC messenger RNA to liver cells.
|
|
Start with single-stranded RNA, and create a pattern of stem-loop structures by adding copies of the MS2 RNA-binding sequences to a noncoding region. The MS2 protein must be fused with GFP and bonded to an mRNA, a complex that contains the MS2’s RNA-binding sequence copies. The MS2-GFP fusion protein was expressed by transferring it to a cell with a plasmid (Robert Singer’s lab). The signal encodes within RNA and the signal presences of the nuclear localization signal (NLS) within GFP-MS2 are two signals that introduce from EGFP-MS2-RNA complexes.
|
|
They have been reported to associate with RNase P RNA, suggesting a role in transfer RNA processing, but their function in archaea in this process (and possibly processing other RNA such as ribosomal RNA) is mostly unknown. One of the two main branches of archaea, the crenarchaeotes have a third known type of archaeal LSm protein, Sm3. This is a two-domain protein with a N-terminal LSm domain that forms a homoheptamer ring. Nothing is known about the function of this LSm protein, but presumably it interacts with, and probably helps process, RNA in these organisms.
|
|
The exposed, single-stranded DNA is referred to as the "transcription bubble." RNA polymerase, assisted by one or more general transcription factors, then selects a transcription start site in the transcription bubble, binds to an initiating NTP and an extending NTP (or a short RNA primer and an extending NTP) complementary to the transcription start site sequence, and catalyzes bond formation to yield an initial RNA product. In bacteria, RNA polymerase holoenzyme consists of five subunits: 2 α subunits, 1 β subunit, 1 β' subunit, and 1 ω subunit. In bacteria, there is one general RNA transcription factor known as a sigma factor.
|
|
RNA polymerase core enzyme binds to the bacterial general transcription (sigma) factor to form RNA polymerase holoenzyme and then binds to a promoter. (RNA polymerase is called a holoenzyme when sigma subunit is attached to the core enzyme which is consist of 2 α subunits, 1 β subunit, 1 β' subunit only). In archaea and eukaryotes, RNA polymerase contains subunits homologous to each of the five RNA polymerase subunits in bacteria and also contains additional subunits. In archaea and eukaryotes, the functions of the bacterial general transcription factor sigma are performed by multiple general transcription factors that work together.
|
|
The Moco RNA motif is a conserved RNA structure that is presumed to be a riboswitch that binds molybdenum cofactor or the related tungsten cofactor. Genetic experiments support the hypothesis that the Moco RNA motif corresponds to a genetic control element that responds to changing concentrations of molybdenum or tungsten cofactor. As these cofactors are not available in purified form, in vitro binding assays cannot be performed. However, the genetic data, complex structure of the RNA and the failure to detect a protein involved in the regulation suggest that the Moco RNA motif corresponds to a class of riboswitches.
|
|
Z18 small nucleolar RNA (also known as SNORD74 and U74) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. Z18 snoRNA belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Each spliceosome is composed of five small nuclear RNAs (snRNA) and a range of associated protein factors. When these small RNAs are combined with the protein factors, they make RNA- protein complexes called snRNPs ( _s_ mall _n_ uclear _r_ ibo _n_ ucleo _p_ roteins, pronounced "snurps"). The snRNAs that make up the major spliceosome are named U1, U2, U4, U5, and U6, so-called because they are rich in uridine, and participate in several RNA-RNA and RNA-protein interactions. The canonical assembly of the spliceosome occurs anew on each pre-mRNA (also known as heterogeneous nuclear RNA).
|
|
Small Nucleolar RNA SNORD94 (also known as U94) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. SNOR94 is a member of the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA U6-53 (also known as MBII-28) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA U6-53 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z41 (homologous to R32 and R81) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z41 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA Z110 (homologous to Z27 and R31) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z110 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Genome organization and proteins of enteroviruses and aphthoviruses Picornaviruses are classed under Baltimore's viral classification system as group IV viruses as they contain a single stranded, positive sense RNA genome. Their genome ranges between 6.7 and 10.1 (kilobases) in length. Like most positive sense RNA genomes, the genetic material alone is infectious; although substantially less virulent than if contained within the viral particle, the RNA can have increased infectivity when transfected into cells. The genome RNA is unusual because it has a protein on the 5' end that is used as a primer for transcription by RNA polymerase.
|
|
Small nucleolar RNA Z152 (homologous to R70 and R12) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z152 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
The anchor of the RNase E to the 5′-monophosphorylated end of these substrates orients the enzyme for directional cleavages that occur in a processive mode. In the absence of RNA, the S1 subdomain and 5′ sensing site of RNase E are both exposed to the surrounding solvent, allowing RNA to bind readily. In the presence of RNA, target RNA binds to the combined S1 subdomain and 5′ sensor in the open configuration. The RNA is anchored primarily by the binding affinity of the 5′ sensor and oriented by the hydrophobic surface patch on the S1 subdomain.
|
|
Small nucleolar RNA Z157 (homologous to R69 and R10) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z157 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Samm nucleolar RNA R160 (also known as snoR160) is a non-coding RNA (ncRNA) molecule identified in plants which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoR160 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R24 (also known as snoRNA R24) is a non-coding RNA (ncRNA) molecule identified in plants which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. R24 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R41 (also known as snoR41) is a non-coding RNA (ncRNA) molecule identified in plants which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoR41 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA SNORD83 (also known as U83 and U84) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA SNORD83 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA R72 (also known as snoR72) is a non-coding RNA (ncRNA) molecule identified in plants which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoR72 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA MBI-87 is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". snoRNA MBI-87 was originally cloned from mouse brain tissues and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin- tail structure and has the conserved H/ACA-box motifs.
|
|
Small nucleolar RNA Z195/SNORD33 (also known as U33) is a non-coding RNA (ncRNA) molecule which functions in the modification of other small nuclear RNAs (snRNAs). This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a guide RNA. snoRNA Z195/SNORD33 belongs to the C/D box class of snoRNAs which contain the conserved sequence motifs known as the C box (UGAUGA) and the D box (CUGA).
|
|
Small nucleolar RNA MBI-1 is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". snoRNA MBI-1 was originally cloned from mouse brain tissues and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure and has the conserved H/ACA-box motifs.
|
|
Small nucleolar RNA MBI-161 is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". snoRNA MBI-161 was originally cloned from mouse brain tissues and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin- tail structure and has the conserved H/ACA-box motifs.
|
|
A comparison of RNA (left) with DNA (right), showing the helices and nucleobases each employs The RNA world is a hypothetical stage in the evolutionary history of life on Earth, in which self-replicating RNA molecules proliferated before the evolution of DNA and proteins. The term also refers to the hypothesis that posits the existence of this stage. Alexander Rich first proposed the concept of the RNA world in 1962, and Walter Gilbert coined the term in 1986. Alternative chemical paths to life have been proposed, and RNA- based life may not have been the first life to exist.
|
|
The results of the analysis are expressed as the ratios of gene signal to internal control signal, which the values can then be used for the comparison between the samples in the estimation of relative target RNA expression. ; Competitive RT-PCR: Competitive RT-PCR technique is used for absolute quantification. It involves the use of a synthetic “competitor” RNA that can be distinguished from the target RNA by a small difference in size or sequence. It is important for the design of the synthetic RNA be identical in sequence but slightly shorter than the target RNA for accurate results.
|
|
Keene studies the regulation of RNA and the mechanisms of RNA- protein interactions. In his work on molecular genetics, he and his coworkers have examined the role of DNA and RNA-binding proteins (RBPs) in the pathogenesis of autoimmunity. In the late 1970s and early 1980s he identified genomic sequences for vesicular stomatitis virus (VSV) and rabies virus (RABV), members of the Rhabdoviridae family of viruses, and for Ebola virus and Marburg virus from the broader group of negative-strand RNA viruses (NSRV). He identified the origins of defective interfering particles of negative-strand RNA viruses.
|
|
Keene's lab has identified functions of the ELAV/Hu posttranscriptional regulators HuB, HuC and HuD and their roles and that of HuR in processes of growth, proliferation, differentiation, and immune response. The study of RNA-binding proteins such as HuR and the determination of the binding of specific sequences have informed Keene's later post-transcription theory and his coordination theory of RNA operons. RNA- binding proteins appear to be implicated in the functioning of many posttranscriptional processes. As of 1994, Keene suggested that RNA-binding proteins could be involved in the regulation of messenger RNA that encode cytokines.
|
|
Deadenylation-dependent mRNA decay (Homo sapiens) Ski2 protein in yeast is also thought to have a role in antiviral defence, probably via its role in RNA turnover or through control of RNA degradation. SKIV2L has been shown to be a negative regulator of the Rig-I like receptors (RLRs) that detect RNA. The authors found that the cytosolic RNA exosome, defined by the SKIV2L RNA helicase, is important for limiting the activation of RLRs and the antiviral response. If the endogenous RNAs fail to be processed, the cell undergoes an unfolded protein response which triggers an antiviral interferon (IFN) response.
|
|
Each of the functional regions of TFIIB interacts with different parts of RNA polymerase II. The amino terminal B ribbon is located on dock domain of RNA polymerase II and extends in to the cleft towards the active site. Extending the B ribbon is the B reader that extends via the RNA exit tunnel to the binding site of the DNA-RNA hybrid and towards the active site. The B linker is the region between the B reader and the B core that is found in the cleft of RNA polymerase II and continues by the rudder and the clamp coiled-coil until it reaches the C terminal B core that is found above the wall of RNA polymerase II. The B reader and the B linker consist of highly conserved residues that are positioned through the RNA polymerase II tunnel towards the active site and ensure tight binding, without these key residues dissociation would occur. These two domains are also thought to adjust the position of some of the more flexible areas of RNA polymerase II to allow for the precise positioning of the DNA and allowing the addition of the new NTPs onto the nascent RNA chain.
|
|
8-Hydroxyguanosine is an RNA nucleoside which is an oxidative derivative of guanosine. Measurement of the levels of 8-hydroxyguanosine is used as a biomarker of oxidative stress causing RNA damage.
|
|
The TarA small RNA regulates PtsG, a glucose transporter involved in the regulation of glucose uptake. Regulation of PtsG by TarA may be dependent upon the Hfq protein, an RNA chaperone.
|
|
Cellular RNA cap structures are formed via the action of an RNA triphosphatase, with guanylyltransferase, N7-methyltransferase and 2′-O methyltransferase. The virus encodes these activities in its non-structural proteins.
|
|
RNA Biology is a peer-reviewed scientific journal in the field of ribonucleic acid (RNA) research. It is indexed for MEDLINE. The editor-in-chief is Renée Schroeder (University of Vienna).
|
|
ClickSeq and Poly(A)-ClickSeq provide specific applications over other common RNA-seq techniques. These include: # Removal of RNA fragmentation steps: When the reverse-transcription step is random-primed and cDNA synthesis is terminated by the 3'-azido-nucleotides, cDNA fragments can be generated without chemical, mechanical or enzymatic fragmentation of the sample RNA # Removal of RNA/DNA ligase enzymes: In ClickSeq, there are no RNA or DNA ligation steps, as are commonly required in most Next-Generation Sequencing library synthesis strategies # Reduction of artifactual recombination: In the original ClickSeq publication, Routh et al. demonstrated that the artifactual generation of cDNA chimeras was substantially reduced when using ClickSeq. This allowed the authors to detect rare RNA recombination events that arise during the replication of Flock House virus.
|
|
Typical architecture of an RRM domain, with a four-stranded antiparallel beta- sheet, stacked on two alpha helices RNA recognition motif, RNP-1 is a putative RNA-binding domain of about 90 amino acids that are known to bind single- stranded RNAs. It was found in many eukaryotic proteins. The largest group of single strand RNA-binding protein is the eukaryotic RNA recognition motif (RRM) family that contains an eight amino acid RNP-1 consensus sequence. RRM proteins have a variety of RNA binding preferences and functions, and include heterogeneous nuclear ribonucleoproteins (hnRNPs), proteins implicated in regulation of alternative splicing (SR, U2AF2, Sxl), protein components of small nuclear ribonucleoproteins (U1 and U2 snRNPs), and proteins that regulate RNA stability and translation (PABP, La, Hu).
|
|
BiFC has been expanded to include the study of RNA-binding protein interactions in a method Rackham and Brown described as trimolecular fluorescence complementation (TriFC). In this method, a fragment of the Venus fluorescent protein is fused to the mRNA of interest, and the complementary Venus portion fused to the RNA-binding protein of interest. Similar to BiFC, if the mRNA and protein interact, the Venus protein will be reconstituted and fluoresce. Also known as the RNA bridge method, as the fluorophore and other interacting proteins form a bridge between the protein and the RNA of interest, this allows a simple detection and localisation of RNA-protein interactions within a living cell and provides a simple method to detect direct or indirect RNA-protein association (i.e.
|
|
Because EHDV is a double-stranded RNA virus, it needs to overcome a specific set of problems, the main one being the fact that double- stranded RNA is unable to be used as template strand during mRNA translation using host cell machinery. Therefore, EHDV must bring its own transcription enzymes into the cell, to survive and synthesize viral RNA and proteins. However, antiviral defense mechanisms are able to easily recognize and eliminate naked double-stranded RNA in the cell. The presence of the double- stranded RNA would trigger antiviral mechanisms such as apoptosis and interferon production. In order to bypass these host defenses, double-stranded RNA viruses such as EHDV “hide” their genome and other translation machinery within closed protein capsids.
|
|
The role of RNA in protein synthesis was suspected already in 1939. Severo Ochoa won the 1959 Nobel Prize in Medicine (shared with Arthur Kornberg) after he discovered an enzyme that can synthesize RNA in the laboratory. However, the enzyme discovered by Ochoa (polynucleotide phosphorylase) was later shown to be responsible for RNA degradation, not RNA synthesis. In 1956 Alex Rich and David Davies hybridized two separate strands of RNA to form the first crystal of RNA whose structure could be determined by X-ray crystallography. The sequence of the 77 nucleotides of a yeast tRNA was found by Robert W. Holley in 1965, winning Holley the 1968 Nobel Prize in Medicine (shared with Har Gobind Khorana and Marshall Nirenberg).
|
|
Dr. Huang and Dr. Baltimore unraveled that RNA viruses were different and used RNA polymerase to replicate its RNA genome. With continued researched and publications from other researchers, along with help from Dr. Huang, Dr. Baltimore discovered an enzyme, reverse transcriptase (in a mouse leukemia retrovirus), that converts RNA to DNA (involved in a process now known as reverse transcription). Dr. Baltimore later received the Nobel Prize in 1975 for his discovery. Huang and Baltimore coauthored a paper with Martha Stampfer titled "Ribonucleic acid synthesis of vesicular stomatitis virus, II. An RNA polymerase in the virion." This paper went on to show that “the virions of vesicular stomatitis virus contain an enzyme that catalyzes the incorporation of ribonucleotides into RNA”.
|
|
Most RNA processing events work in concert with one another and produce networks of regulating processes that allow a greater variety of proteins to be expressed than those strictly directed by the genome. These RNA processing events can also be passed on from generation to generation via reverse transcription into the genome. Over time, RNA networks that produce the fittest phenotypes will be more likely to be maintained in a population, contributing to evolution. Studies have shown that RNA processing events have especially been critical with the fast phenotypic evolution of vertebrates—large jumps in phenotype explained by changes in RNA processing events. Human genome searches have also revealed RNA processing events that have provided significant “sequence space for more variability”.
|
|
Furthermore it has been claimed that the RdRps of other RNA viruses are more similar to reverse transcriptases than they are to the RdRps of leviviruses and their relatives in the phylum Lenarviricota. From that, it has been proposed that numerous lineages of prokaryotic RNA viruses may have gone extinct when they lost competition with prokaryotic DNA viruses, after which RNA viruses reemerged once they began to infect eukaryotes. It is also probable that there are RNA viruses that infect archaea based on metagenomic samples. Phylogenetic analysis of extracted sequences suggests that they are the most divergent RNA viruses and that they may be ancestors of eukaryotic RNA viruses, especially those of Pisuviricota, Kitrinoviricota, Duplornaviricota, and Negarnaviricota, which do not have an apparent prokaryotic ancestor.
|
|
Early methods for identifying RNA-protein interactions relied on either the affinity purification of RNA- binding proteins or the immunoprecipitation of RNA-protein complexes. These methods lacked a cross-linking step and obtained low signal to noise ratios. Because RNA-binding proteins are frequently components of multi-protein complexes, RNAs bound to non-target proteins may be co-precipitated. The data obtained using early immunoprecipitation methods have been demonstrated to be dependent on the reaction conditions of the experiment.
|
|
The influenza viral genome is composed of eight ribonucleoprotein particles formed by a complex of negative-sense RNA bound to a viral nucleoprotein. Each RNP carries with it an RNA polymerase complex. When the nucleoprotein binds to the viral RNA, it is able to expose the nucleotide bases which allow the viral polymerase to transcribe RNA. At this point, once the virus enters a host cell it will be prepared to begin the process of replication.
|
|
Model of the replicase- transcriptase complex of a coronavirus. RdRp for replication (red), ExoN for proofreading (dark blue), ExoN cofactor (yellow), RBPs to avoid secondary structure (light blue), RNA sliding clamp for processivity and primase domain for priming (green/orange), and a helicase to unwind RNA (downstream). A number of the nonstructural replication proteins coalesce to form a multi- protein replicase-transcriptase complex (RTC). The main replicase- transcriptase protein is the RNA-dependent RNA polymerase (RdRp).
|
|
The Pseudomonadales-1 RNA motif is a conserved RNA structure that was discovered by bioinformatics. The Pseudomonadales-1 motif often exhibits an apparent sarcin-ricin loop, a type internal loop common in RNA. Pseudomonadales-1 motif RNAs are found in relatively closely related species of Pseudomonadales. Despite this narrow distribution, the Pseudomonadales-1 RNA motif does not exhibit many invariant nucleotide positions, suggesting that it does not need to be highly conserved at the primary sequence level.
|
|
The hypothesized transition from RNA to proteins to DNA The RNP world is a hypothesized intermediate period in the origin of life characterized by the existence of ribonucleoproteins. The period followed the hypothesized RNA world and ended with the formation of DNA and contemporary proteins. During this time, RNA molecules continued to perform many essential functions, but began to synthesize peptides, which eventually assumed most of the function of those RNA molecules, leading to life as we know it.
|
|
Time-resolved RNA sequencing methods are applications of RNA-seq that allow for observations of RNA abundances over time in a biological sample or samples. Second-Generation DNA sequencing has enabled cost effective, high throughput and unbiased analysis of the transcriptome. Normally, RNA-seq is only capable of capturing a snapshot of the transcriptome at the time of sample collection. This necessitates multiple samplings at multiple time points, which increases both monetary and time costs for experiments.
|
|
Subgenomic flavivirus RNA (sfRNA) is an extension of the 3' UTR and has been demonstrated to play a role in flavivirus replication and pathogenesis. sfRNA is produced by incomplete degradation of genomic viral RNA by the host cells 5'-3' exoribonuclease 1 (XRN1). As the XRN1 degrades viral RNA, it stalls at stemloops formed by the secondary structure of the 5' and 3' UTR. This pause results in an undigested fragment of genome RNA known as sfRNA.
|
|
SRP RNA was first detected in avian and murine oncogenic RNA (ocorna) virus particles. Subsequently, SRP RNA was found to be a stable component of uninfected HeLa cells where it associated with membrane and polysome fractions. In 1980, cell biologists purified from canine pancreas an 11S "signal recognition protein" (fortuitously also abbreviated "SRP") which promoted the translocation of secretory proteins across the membrane of the endoplasmic reticulum. It was then discovered that SRP contained an RNA component.
|
|
Varkud satellite (VS) ribozyme is the largest known nucleolyic ribozyme and found to be embedded in VS RNA. VS RNA is a long non-coding RNA exists as a satellite RNA and is found in mitochondria of Varkud-1C and few other strains of Neurospora. VS ribozyme contains features of both catalytic RNAs and group 1 introns. VS ribozyme has both cleavage and ligation activity and can perform both cleavage and ligation reactions efficiently in the absence of proteins.
|
|
Two core subunits of the archaeal exosome (Rrp41 and Rrp42), bound to a small RNA molecule (in red). The exosome is a key complex in cellular RNA quality control. Unlike prokaryotes, eukaryotes possess highly active RNA surveillance systems that recognise unprocessed and mis-processed RNA-protein complexes (such as ribosomes) prior to their exit from the nucleus. It is presumed that this system prevents aberrant complexes from interfering with important cellular processes such as protein synthesis.
|
|
In eukaryotes, transcription is performed in the nucleus by three types of RNA polymerases, each of which needs a special DNA sequence called the promoter and a set of DNA-binding proteins—transcription factors—to initiate the process (see regulation of transcription below). RNA polymerase I is responsible for transcription of ribosomal RNA (rRNA) genes. RNA polymerase II (Pol II) transcribes all protein-coding genes but also some non-coding RNAs (e.g., snRNAs, snoRNAs or long non-coding RNAs).
|
|
Amatoxins are potent and selective inhibitors of RNA polymerase II, a vital enzyme in the synthesis of messenger RNA (mRNA), microRNA, and small nuclear RNA (snRNA). Without mRNA, which is the template for protein synthesis, cell metabolism stops and lysis ensues. The RNA polymerase of Amanita phalloides is insensitive to the effects of amatoxins; thus, the mushroom does not poison itself. Amatoxins are able to travel through the bloodstream to reach the organs in the body.
|
|
DNA-directed RNA polymerases I, II, and III subunit RPABC2 is a protein that in humans is encoded by the POLR2F gene. This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes, that is also shared by the other two DNA-directed RNA polymerases. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template.
|
|
Small nucleolar RNA SNORA77 (also known as ACA63) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA). SNORA77 was identified by computational screening and its expression in mouse experimentally verified by Northern blot and primer extension analysis.
|
|
Small nucleolar RNA SNORA79 (also known as ACA65) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA). SNORA79 was identified by computational screening and its expression in mouse experimentally verified by Northern blot and primer extension analysis.
|
|
ADARs acting on RNA is one of the most common forms of RNA editing, and has both selective and non-selective activity. ADAR is able to both modify and regulate the output of gene product, as inosine is interpreted by the cell to be guanosine. ADAR has also been determined to change the functionality of small RNA molecules. Recently, ADARs have also been discovered as a splicing regulator with their editing capability or RNA binding function.
|
|
There are also many unassigned species and genera. Related to but distinct from the RNA viruses are the viroids and the RNA satellite viruses. These are not currently classified as RNA viruses and are described on their own pages. A study of several thousand RNA viruses has shown the presence of at least five main taxa: a levivirus and relatives group; a picornavirus supergroup; an alphavirus supergroup plus a flavivirus supergroup; the dsRNA viruses; and the -ve strand viruses.
|
|
The Rumen-Originating, Ornate, Large (ROOL) RNA motif was originally discovered by bioinformatics by analyzing metagenomic sequences from cow rumen. ROOL RNAs are found in a variety of bacterial species and apparently do not code for proteins. The RNA has a complex RNA secondary structure and its average size of 581 nucleotides is unusually large for bacterial non-coding RNAs. This large size and structural complexity for a bacterial RNA is consistent with properties of large ribozymes.
|
|
Circular RNA, unlike linear RNA, forms a covalently closed continuous loop, in which the 3' and 5' ends present in linear RNA molecules have been joined together. Sänger et al. also provided evidence for the true circularity of viroids by finding that the RNA could not be phosphorylated at the 5' terminus. Then, in other tests, they failed to find even one free 3' end, which ruled out the possibility of the molecule having two 3' ends.
|
|
RNA and DNA nanostructures are used for the organization and coordination of important molecular processes. However, there exist several distinct differences between the fundamental structure and applications between the two. Although inspired by the DNA origami techniques established by Paul Rothemund, the process for RNA origami is vastly different. RNA origami is a much newer process than DNA origami; DNA origami has been studied while approximately a decade now, while the study of RNA origami has only recently begun.
|
|
RNA activation (RNAa) is a small RNA-guided and Argonaute (Ago)-dependent gene regulation phenomenon in which promoter-targeted short double-stranded RNAs (dsRNAs) induce target gene expression at the transcriptional/epigenetic level. RNAa was first reported in a 2006 PNAS paper by Li et al. who also coined the term "RNAa" as a contrast to RNA interference (RNAi) to describe such gene activation phenomenon. dsRNAs that trigger RNAa have been termed small activating RNA (saRNA).
|
|
Consensus structure of TB9Cs1H1 TB9Cs1H1 is a member of the H/ACA-like class of non-coding RNA (ncRNA) molecule that guide the sites of modification of uridines to pseudouridines of substrate RNAs. It is known as a small nucleolar RNA (snoRNA) thus named because of its cellular localization in the nucleolus of the eukaryotic cell. TB9Cs1H1 is predicted to guide the pseudouridylation of LSU3 ribosomal RNA (rRNA) at residue Ψ1273 and SSU ribosomal RNA (rRNA) at residue Ψ1088.
|
|
The FMV genome consists of segmented (multipartite) negative-sense, single-stranded RNA. The genome has long been thought to have four segments, but recent findings have supported the existence of six RNA genome segments. Each segment has one open reading frame (ORF). The first segment, FMV vcRNA 1 (7093 nt), is common to all viruses of genus Emaravirus and codes for the virus's 264 kDa RNA- dependent RNA polymerase (RdRp), which has endonuclease activity near the N-terminus.
|
|
This RNA strand is then processed to give messenger RNA (mRNA), which is free to migrate through the cell. mRNA molecules bind to protein-RNA complexes called ribosomes located in the cytosol, where they are translated into polypeptide sequences. The ribosome mediates the formation of a polypeptide sequence based on the mRNA sequence. The mRNA sequence directly relates to the polypeptide sequence by binding to transfer RNA (tRNA) adapter molecules in binding pockets within the ribosome.
|
|
These enzymes are essential for replicating the viral genome and transcribing viral genes into messenger RNA (mRNA) for translation of viral proteins. Riboviria was established in 2018 to accommodate all RdRp-encoding RNA viruses and was expanded a year later to also include RdDp-encoding retroviruses. These two groups of viruses are assigned to two separate kingdoms: Orthornavirae for RdRp-encoding RNA viruses, which encompasses all RNA viruses, and Pararnavirae for RdDp-encoding viruses, i.e. all reverse- transcribing viruses.
|
|
One example of an RNA homodimer is the VS ribozyme from Neurospora, with its two active sites consisting of nucleotides from both monomers. The best known example of RNA forming quaternary structures with proteins is the ribosome, which consists of multiple rRNAs, supported by rProteins. Similar RNA-Protein complexes are also found in the spliceosome.
|
|
Piwi-interacting RNA's structure Piwi-interacting RNA (piRNA) and endogenous short interfering RNA (esiRNA) are small RNA fragments that partner with cleaving proteins to act as guides to a retrotransposon.Siomi, M. C., Saito, K., & Siomi, H. (2008). How selfish retrotransposons are silenced in Drosophila germline and somatic cells. [Review]. Febs Letters, 582(17), 2473-2478.
|
|
FANA XNAzymes also showed the ability to ligate DNA, RNA and XNA substrates. Although XNAzyme studies are still preliminary, this study was a step in the direction of searching for synthetic circuit components that are more efficient than those containing DNA and RNA counterparts that can regulate DNA, RNA, and their own, XNA, substrates.
|
|
At equivalent molecular weights, RNA will migrate faster than DNA. However, both RNA and DNA have a negative linear slope between their migration distance and logarithmic molecular weight. That is, samples of less weight are able to migrate a greater distance. This relationship is a consideration when choosing RNA or DNA markers as a standard.
|
|
Triple Gene Block 1 (TGBp1) is a multifunctional protein. It acts to promote translation of viral RNAs by acting as an RNA helicase, separating double- stranded RNA for RdRp functions. Moreover, it can act as a suppressor of RNA interference, which is an immune defense against the accumulation of viral RNAs.Lubicz-Verchot, J. (2005).
|
|
RNA serves as a template for cDNA synthesis. In cellular life, cDNA is generated by viruses and retrotransposons for integration of RNA into target genomic DNA. In molecular biology, RNA is purified from source material after genomic DNA, proteins and other cellular components are removed. cDNA is then synthesized through in vitro reverse transcription.
|
|
Highlighted are the two hinges and the small (Alu) and large (S, "specific") domain of the SRP RNA. The signal recognition particle RNA, (also known as 7SL, 6S, ffs, or 4.5S RNA) is part of the signal recognition particle (SRP) ribonucleoprotein complex. SRP recognizes the signal peptide and binds to the ribosome, halting protein synthesis.
|
|
The C0719 RNA is a bacterial non-coding RNA of 222 nucleotides in length that is found between the yghK and glcB genes in the genomes of Escherichia coli and Shigella flexneri. This non-coding RNA was originally identified in E.coli using high-density oligonucleotide probe arrays (microarray.) The function of this ncRNA is unknown.
|
|
RsmA binds to RsmB regulatory RNA which is also a member of this family. RsmB RNA was shown to be upregulated by GacS/A system, and increase downstream T3SS gene expression. FlhDC, the master regulator of flagellar genes, also activates rsmB RNA production. A regulatory network have been revealed connecting rsmB, FlhDC and T3SS.
|
|
Small nucleolar RNA snoR98 (also known as snoR98) is a non-coding RNA (ncRNA) which modifies other small nuclear RNAs (snRNAs). It is a member of the H/ACA class of small nucleolar RNA that guide the sites of modification of uridines to pseudouridines. Plant snoR98 was identified in a screen of Arabidopsis thaliana.
|
|
It is also suggested that angiogenin and FGF18 may be potential transcriptional targets of the H19 RNA. As a result of the functions and signaling pathways that H19 RNA-upregulated genes are involved in, it has been suggested that H19 RNA plays crucial roles in tissue invasion, migration and angiogenesis in tumorigenesis. Lottin et al.
|
|
Within minutes, bacterial ribosomes start translating viral mRNA into protein. For RNA-based phages, RNA replicase is synthesized early in the process. Proteins modify the bacterial RNA polymerase so it preferentially transcribes viral mRNA. The host's normal synthesis of proteins and nucleic acids is disrupted, and it is forced to manufacture viral products instead.
|
|
These gRNAs are non coding short RNA sequences which bind to the complementary target DNA sequences. Guide RNA first binds to the Cas9 enzyme and the gRNA sequence guides the complex via pairing to a specific location on the DNA, where Cas9 performs its endonuclease activity by cutting the target DNA strand. In addition to expression of the Cas9 nuclease, the CRISPR-Cas9 system requires a specific RNA molecule to recruit and direct the nuclease activity to the region of interest. These guide RNAs take one of two forms: # A synthetic trans-activating CRISPR RNA (tracrRNA) plus a synthetic CRISPR RNA (crRNA) designed to cleave the gene target site of interest # A synthetic or expressed single guide RNA (sgRNA) that consists of both the crRNA and tracrRNA as a single construct The crRNA and the tracrRNA form a complex which acts as the guide RNA for the Cas9 enzyme.
|
|
Cissé used transient-PALM to demonstrated that RNA polymerase II forms clusters that deconstruct after their work is done. Until Cissé made this discovery it was assumed that RNA polymerases were stable.
|
|
The majority of fungal viruses are double- stranded RNA viruses. A small number of positive-strand RNA viruses have been described. One report has suggested the possibility of a negative stranded virus.
|
|
As such, a splice-aware aligner may be ideal for aligning RNA sequences, whereas an aligner that considers protein structure or residue substitution rates may be preferable for translated RNA sequence data.
|
|
MiRNA processing The most basic mechanistic flow for RNA Silencing is as follows: (For a more detailed explanation of the mechanism, refer to the RNAi:Cellular mechanism article.) 1: RNA with inverted repeats hairpin/panhandle constructs --> 2: dsRNA --> 3: miRNAs/siRNAs --> 4: RISC --> 5: Destruction of target mRNA # It has been discovered that the best precursor to good RNA silencing is to have single stranded antisense RNA with inverted repeats which, in turn, build small hairpin RNA and panhandle constructs. The hairpin or panhandle constructs exist so that the RNA can remain independent and not anneal with other RNA strands. # These small hairpin RNAs and/or panhandles then get transported from the nucleus to the cytosol through the nuclear export receptor called exportin-5, and then get transformed into a dsRNA, a double stranded RNA, which, like DNA, is a double stranded series of nucleotides. If the mechanism didn't use dsRNAs, but only single strands, there would be a higher chance for it to hybridize to other "good" mRNAs.
|
|
MicL RNA (mRNA-interfering complementary RNA regulator of Lpp) is a σ E transcription factor-dependent small non-coding RNA. It was discovered in E. coli. Together with MicA and RybB sRNAs, MicL sRNA down-regulates the synthesis of abundant outer membrane proteins in response to stress. MicL specifically targets mRNA of lipoprotein Lpp, preventing its translation.
|
|
Knock down SIRT7 led to reduced RNA Pol I levels, but RNA Pol I mRNA levels did not change. This suggests that SIRT7 plays a crucial role in connecting the function of chromatin remodeling complexes to RNA Pol I machinery during transcription. SIRT7 may help attenuate DNA damage and thereby promoting cellular survival under conditions of genomic stress.
|
|
The rpfG RNA motif is a conserved RNA structure that was discovered by bioinformatics. The rpfG RNA motif is found in the genus Xanthomonas. rpfG RNAs are located upstream of rpfG genes, which likely function as part of cyclic di-GMP signaling by degrading this molecule. This observation might suggest that rpfG RNAs function as cis-regulatory elements.
|
|
It is also required for both miRNA-mediated translational repression and miRNA-mediated cleavage of complementary mRNAs by RISC, and for RNA-directed transcription and replication of the human hepatitis delta virus (HDV). Mov10 interacts with small capped HDV RNAs derived from genomic hairpin structures that mark the initiation sites of RNA- dependent HDV RNA transcription.
|
|
The study used comparative genomics to identify compensatory DNA mutations that maintain RNA base-pairings, a distinctive feature of RNA molecules. Over 80% of the genomic regions presenting evolutionary evidence of RNA structure conservation do not present strong DNA sequence conservation. Non-coding DNA may perhaps serve to decrease the probability of gene disruption during chromosomal crossover.
|
|
Leishmaniavirus (also known as Leishmania RNA virus or LRV) is a genus of double-stranded RNA virus, in the family Totiviridae. Protozoa serve as natural hosts, and Leishmaniaviruses are present in several species of the human protozoan parasite Leishmania. There are currently only two species in this genus including the type species Leishmania RNA virus 1.
|
|
According to the molecular analyses of 18S ribosomal RNA, 28S ribosomal RNA, 16S ribosomal RNA, and cytochrome-c oxidase I (COI) genes by Kameda & Kato (2011) Fukuia ooyagii should be separated from Fukuia, and its generic assignment should be determined coupled with the investigation of its soft- part morphology. The most closely related genus is Blanfordia.
|
|
In molecular biology, SMAD5 antisense RNA 1 (non-protein coding), also known as SMAD5-AS1 or DAMS is a long non-coding RNA. It is antisense to, and nested within, the SMAD5 gene. In humans it is found on chromosome 5. In humans, expression of this RNA is detected in foetal heart, foetal adrenal glands and in pancreatic tumours.
|
|
The inhibitor prevents RNA synthesis by physically blocking elongation, and thus preventing synthesis of host bacterial proteins. By this "steric-occlusion" mechanism, rifampicin blocks synthesis of the second or third phosphodiester bond between the nucleotides in the RNA backbone, preventing elongation of the 5' end of the RNA transcript past more than 2 or 3 nucleotides.
|
|
The genome has been sequenced. There are three segments—large (L), medium (M) and small (S). Five proteins have been identified—an RNA dependent RNA polymerase (RdRp), a glycoprotein N (Gn), a glycoprotein C (Gc), a nuclear protein (NP) and a non structural protein (NSs). The L segment encodes the RNA polymerase with 2084 amino acid residues.
|
|
The HBV RNA encapsidation signal epsilon (HBV_epsilon) is an element essential for HBV virus replication. It is an RNA structure situated near the 5' end of the HBV pregenomic RNA. The structure consists of a lower stem, a bulge region, an upper stem and a tri-loop. The structure was determined and refined through enzymatic probing and NMR spectroscopy.
|
|
In molecular biology, trans-activating crispr RNA (tracrRNA) is a small trans- encoded RNA. It was first discovered in the human pathogen Streptococcus pyogenes. In bacteria and archaea; CRISPR-Cas (clustered, regularly interspaced short palindromic repeats/CRISPR-associated proteins) constitute an RNA-mediated defense system which protects against viruses and plasmids. This defensive pathway has three steps.
|
|
Secondary structure motif of RNA region interacting with Vts1 Protein-protein interactions through SAM domains participate in different regulatory activities such as signal transduction. Proteins having such domains were also shown to recognize and interact with RNA structures of similar shape to the Smaug response element (SRE). Vts1 binds to RNA targets that have CUGGC on hairpin loops.
|
|
This enzyme is then able to cleave the remaining polyprotein into the individual products. One of the products cleaved is a polymerase, responsible for the synthesis of a (-) sense RNA molecule. Consequently, this molecule acts as the template for the synthesis of the genomic progeny RNA. Flavivirus genomic RNA replication occurs on rough endoplasmic reticulum membranes in membranous compartments.
|
|
This protein is a member of a RNA-binding protein family that regulates transcription and RNA translation. It was first identified in cytotoxic lymphocyte (CTL) target cells. TIA1 acts in the nucleus to regulate splicing and transcription. TIA1 helps to recruit the splicesome to regulate RNA splicing, and it inhibits transcription of multiple genes, such as the cytokine.
|
|
The class I RNA is a non-coding RNA. This family was identified in Shotgun sequencing approach of full-length cDNA libraries from small RNAs from Dictyostelium discoideum. The function of this RNA is unknown. These RNAs are 42–65 nucleotides (nt) long and they share 5' and 3' sequence elements of 16 and 8 nt respectively.
|
|
It is a guanosine (ribonucleic) analog used to stop viral RNA synthesis and viral mRNA capping, thus, it is a nucleoside inhibitor. Ribavirin is a prodrug, which when metabolized resembles purine RNA nucleotides. In this form, it interferes with RNA metabolism required for viral replication. Over five direct and indirect mechanisms have been proposed for its mechanism of action.
|
|
Real-time techniques allow for quantification of the virus. The IQ2000TM TSV detection system, a RT-PCR method, is said to have a detection limit of 10 copies per reaction. RNA-based methods are limited by the relative fragility of the viral RNA. Prolonged fixation in Davidsons' fixative might result in RNA degradation due to fixative-induced acid hydrolysis.
|
|
18S ribosomal RNA (abbreviated 18S rRNA) is a part of the ribosomal RNA. The S in 18S represents Svedberg units. 18S rRNA is a SSU rRNA, a component of the eukaryotic (40S). 18S rRNA is the structural RNA for the small component of eukaryotic cytoplasmic ribosomes, and thus one of the basic components of all eukaryotic cells.
|
|
Amongst the targets of sRNAs are a number of house- keeping genes. The 6S RNA binds to RNA polymerase and regulates transcription, tmRNA has functions in protein synthesis, including the recycling of stalled ribosomes, 4.5S RNA regulates signal recognition particle (SRP), which is required for the secretion of proteins and RNase P is involved in maturing tRNAs.
|
|
Simplified diagram of mRNA synthesis and processing. Enzymes not shown. Transcription is the first of several steps of DNA based gene expression in which a particular segment of DNA is copied into RNA (especially mRNA) by the enzyme RNA polymerase. Both DNA and RNA are nucleic acids, which use base pairs of nucleotides as a complementary language.
|
|
This is characteristic of all Togaviruses. Replication is cytoplasmic and rapid. The genomic RNA is partially translated at the 5’ end to produce the non-structural proteins which are then involved in genome replication and the production of new genomic RNA and a shorter sub- genomic RNA strand. This sub-genomic strand is translated into the structural proteins.
|
|
In some species of RNA virus, the genes are not on a continuous molecule of RNA, but are separated. The influenza virus, for example, has eight separate genes made of RNA. When two different strains of influenza virus infect the same cell, these genes can mix and produce new strains of the virus in a process called reassortment.
|
|
Transcription is when RNA is made from DNA. During transcription, RNA polymerase makes a copy of a gene from the DNA to mRNA as needed. This process is slightly differs in eukaryotes and prokaryotes. One notable difference, however, is that prokaryotic RNA polymerase associates with DNA-processing enzymes during transcription so that processing can proceed during transcription.
|
|
Transcription is when RNA is made from DNA. During transcription, RNA polymerase makes a copy of a gene from the DNA to mRNA as needed. This process is slightly differs in eukaryotes and prokaryotes. One notable difference, however, is that prokaryotic RNA polymerase associates with DNA-processing enzymes during transcription so that processing can proceed during transcription.
|
|
RRM domains are located near the N-terminus end of SR proteins. The RRM domain mediates the RNA interactions of the SR proteins by binding to exon splicing enhancer sequences. The RRMH usually has weaker interactions with RNA compared to the RRM domain. From NMR, the RRM domain of SRSF1, an SR protein, has a RNA binding fold structure.
|
|
Morpholinos do not trigger the degradation of their target RNA molecules, unlike many antisense structural types (e.g., phosphorothioates, siRNA). Instead, Morpholinos act by "steric blocking", binding to a target sequence within an RNA, inhibiting molecules that might otherwise interact with the RNA. Morpholino oligos are often used to investigate the role of a specific mRNA transcript in an embryo.
|
|
TET3 was selectively activated within the adult neo-cortex in an experience-dependent manner. A short hairpin RNA (shRNA) is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference. Mice trained in the presence of TET3-targeted shRNA showed a significant impairment in fear extinction memory.
|
|
A consensus secondary structure and primary sequence for the targets of the AUF1 RNA binding protein. This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are nucleic acid binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). The interaction sites on the RNA are frequently biased towards particular sequence motifs.
|
|
The proposed mechanism of FMRP's effect upon synaptic plasticity are through its role as a negative regulator of translation. FMRP is an RNA-binding protein which associates with polyribosomes. The RNA-binding abilities of FMRP are dependent upon its KH domains and RGG boxes. The KH domain is a conserved motif which characterizes many RNA-binding proteins.
|
|
A representation of the 3D structure of the microROSE RNA. This derived from a solution NMR structure of the microROSE element. The repression of heat shock gene expression (ROSE) element is an RNA element found in the 5' UTR of some heat shock protein's mRNAs. The ROSE element is an RNA thermometer that negatively regulates heat shock gene expression.
|
|
In molecular biology, Small nucleolar RNA snoR86 (also known as snoR86) is a non-coding RNA (ncRNA) which modifies other small nuclear RNAs (snRNAs). It is a member of the H/ACA class of small nucleolar RNA that guide the sites of modification of uridines to pseudouridines. Plant snoR86 was identified in a screen of Arabidopsis thaliana.
|
|
This RNA binds the Hfq protein and regulates levels of gene expression by an antisense mechanism. It is known to target the OmpA gene in E. coli and occludes the ribosome binding site. Under conditions of envelope stress, micA transcription is induced. MicA, RybB RNA and MicL RNA transcription is under the control of the sigma factor sigma(E).
|
|
In addition to viral proteins p33 and the RNA-dependent RNA polymerase p92, and unknown host factors, conserved and structural regions within the 3′ untranslated region (3′ UTR) are important for regulating genome replication. This 3′ structural element contains a pseudoknot. Other non-coding RNA structures in Tombusvirus include the 5′ UTR and an internal replication element.
|
|
The TCV hairpin 5 (H5) is an RNA element found in the turnip crinkle virus. This RNA element is composed of a stem-loop that contains a large symmetrical internal loop (LSL). H5 can repress minus-strand synthesis when the 3' side of the LSL pairs with the 4 bases at the 3'-terminus of the RNA(GCCC-OH).
|
|
The genome is then integrated into the DNA of the host cell, where it is now called a provirus. The host cell's RNA polymerase II then transcribes RNA in the nucleus from the proviral DNA. Some of this RNA may become mRNA whereas other strands will become copies of the viral genome for replication.Rampersad 2018, pp.
|
|
This complementarity was proposed to inhibit the translation of the lin-14 mRNA into the LIN-14 protein. At the time, the lin-4 small RNA was thought to be a nematode idiosyncrasy. In 2000, a second small RNA was characterized: let-7 RNA, which represses lin-41 to promote a later developmental transition in C. elegans.
|
|
MtlS RNA is a small non-coding RNA found in Vibrio cholerae and related bacteria. MtlS is found in the mannitol operon, which encodes the mannitol- specific phosphotransferase system. The MtlS RNA is expressed when the bacteria are grown on carbon sources other than mannitol. MtlS is responsible for the post-transcriptional regulation of the MtlA protein.
|
|
A pile-up of reads at specific locations on the genome indicates that the RNA of interest had bound to that region of the genome. This helps delineate specific genomic regions that interact with RNA. For example, genomic targets of enhancer RNA which act at a distance from their site of synthesis can be easily evaluated by ChiRP-Seq.
|
|
TLR8 is an endosomal receptor that recognizes single stranded RNA (ssRNA), and can recognize ssRNA viruses such as Influenza, Sendai, and Coxsackie B viruses. TLR8 binding to the viral RNA recruits MyD88 and leads to activation of the transcription factor NF-κB and an antiviral response. TLR8 recognizes single-stranded RNA of viruses such as HIV and HCV.
|
|
Direct interaction of QSER1 with RNA polymerase II was found in a study performed by Moller, et al. Interaction was shown to occur with the DNA-directed RNA polymerase II subunit, RPB1, of RNA polymerase II during both mitosis and interphase. Colocalization/interaction of QSER1 was shown to the regulatory region of RPB1 with 52 heptapeptide (YSPTSPSYS) repeats.
|
|
Teg49 is a non-coding RNA present in the extended promoter region of the staphylococcal accessory regulator sarA. It was identified by RNA-seq and confirmed by Northern blot. It is modulated by sigB (sarA regulator) and cshA (an ATP-dependant DEAD box RNA helicase) and it most likely contributes to virulence of S. aureus by modulating SarA expression.
|
|
Nuclear Enriched Abundant Transcript 1 (NEAT1) is a ~3.2 kb novel nuclear long non-coding RNA (RIKEN cDNA 2310043N10Rik). It is also known as Virus Inducible NonCoding RNA (VINC) or MEN epsilon RNA. It is transcribed from the multiple endocrine neoplasia locus. Expression of NEAT1 is induced in mouse brains during infection by Japanese encephalitis virus and rabies virus.
|
|
The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC). Crystallographic analysis of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.
|
|
Dr Yiliang Ding Yiliang Ding is a plant scientist at the John Innes Centre. Since 2014 she has been a group leader, with a David Philips Fellowship. Ding researches RNA structure and post-transcriptional gene regulations. Ding’s research on nucleic acid chemistry and RNA biology focuses on understanding the dynamics of RNA structure in living cells.
|
|
The folE RNA motif is a conserved RNA structure that was discovered by bioinformatics. folE motifs are found in Alphaproteobacteria. folE motif RNAs likely function as cis-regulatory elements, in view of their positions upstream of protein-coding genes. Instances of the folE RNA motif are often located nearby to the predicted Shine-Dalgarno sequence of the downstream gene.
|
|
Of those that died, only the tissue samples from the brain contained the infectious virus. However, both lung and salivary gland tissue contained viral RNA. Two of the three bats had viral RNA present in the bladder and in brown fat tissue as well. None of these three bats had viral RNA present in the kidney.
|
|
The researchers expect the resulting test to be cheap and easy to use in point-of-care settings. The test amplifies RNA directly, without the RNA-to-DNA conversion step of RT-PCR.
|
|
GeneNetwork includes annotation files for several RNA profiling platforms (Affymetrix, Illumina, and Agilent). RNA- seq and quantitative proteomic, metabolomic, epigenetics, and metagenomic data are also available for several species, including mouse and human.
|
|
RHAU (RNA Helicase associated with AU-rich element, also known as DHX36 or G4R1) is a 114-kDa human RNA helicase of the DEAH-box family of helicases encoded by the DHX36 gene.
|
|
Transfer RNA serves as the carrier molecule for amino acids to be used in protein synthesis, and is responsible for decoding the mRNA. In addition, many other classes of RNA are now known.
|
|
A competing technique is CLIP-Seq, where the RNA binding protein is cross-linked to the RNA via the use of UV light, followed by nuclease digestion and analyzed with high-throughput sequencing.
|
|
The RNA component of human telomerase. Science 269, 1236-1241.Blasco, M.A., Funk, W., Villeponteau, B., and Greider, C.W. (1995). Functional characterization and developmental regulation of mouse telomerase RNA. Science 269, 1267-1270.
|
|
NAMA (noncoding RNA associated with MAP kinase pathway and growth arrest) is a long non-coding RNA gene. It is induced by cell growth arrest, apoptosis, and inhibition of the MAP kinase pathway.
|
|
IFNG antisense RNA 1 is a long non-coding RNA that in humans is encoded by the IFNG-AS1 gene. It is a positive regulator of interferon gamma in T and NK cells.
|
|
Bebaru virus is an RNA virus in the genus Alphavirus.
|
|
Inside the core is the RNA material of the virus.
|
|
NTP binding sites play a role in poliovirus RNA replication.
|
|
The mRNA of this protein is subject to RNA editing.
|
|
Cabassou virus is an RNA virus in the genus Alphavirus.
|
|
These properties are also similar to the Drum RNA motif.
|
|
The nonhomologous RNA recombination resulted in an enhanced hemagglutinin cleavability.
|
|
In its natural state, a hammerhead RNA motif is a single strand of RNA. Although the cleavage takes place in the absence of protein enzymes, the hammerhead RNA itself is not a catalyst in its natural state, as it is consumed by the reaction (i.e. performs self-cleavage) and therefore cannot catalyze multiple turnovers. Trans-acting hammerhead constructs can be engineered such that they consist of two interacting RNA strands, with one strand composing a hammerhead ribozyme that cleaves the other strand.
|
|
Floxuridine is rapidly catabolized to 5-fluorouracil, which is the active form of the drug. The primary effect is interference with DNA synthesis and to a lesser extent, inhibition of RNA formation through the drug's incorporation into RNA, thus leading to the production of fraudulent RNA. Fluorouracil also inhibits uracil riboside phosphorylase, which prevents the utilization of preformed uracil in RNA synthesis. As well, the monophosphate of floxuridine, 5-fluoro-2'-deoxyuridine-5'-phosphate (FUDR-MP) inhibits the enzyme thymidylate synthetase.
|
|
Ideas that the origin of life may have involved the first self- replicating molecules being ribozymes are called RNA World hypotheses. Ligase ribozymes may have been part of such a pre-biotic RNA world. In order to copy RNA, fragments or monomers (individual building blocks) that have 5′-triphosphates must be ligated together. This is true for modern (protein- based) polymerases, and is also the most likely mechanism by which a ribozyme self-replicase in an RNA world might function.
|
|
RNA adopts this double helical form, and RNA-DNA duplexes are mostly A-form, but B-form RNA-DNA duplexes have been observed. In localized single strand dinucleotide contexts, RNA can also adopt the B-form without pairing to DNA. A-DNA has a deep, narrow major groove which does not make it easily accessible to proteins. On the other hand, its wide, shallow minor groove makes it accessible to proteins but with lower information content than the major groove.
|
|
Artist's impression of a cross-section through a measles virus. The virus is enveloped by a lipid membrane (light magenta) studded with many hemagglutinin and fusion proteins (outermost proteins in blue), which together bind to human cells and enter them. The viral genome is a strand of RNA (yellow) protected by nucleoproteins (green). RNA-dependent RNA polymerase (bright magenta) copies the RNA once the virus infects a cell, assisted by the largely-disordered phosphoprotein (purple strands connecting the polymerase to the nucleoprotein).
|
|
The Bacillus-plasmid RNA motif is a predicted conserved RNA structure usually located in plasmids. It is known in species under the genera Bacillus and Lactobacillus. In Bacillus subtilis, it is found upstream of the hypothetical gene ydcS, whose function is unknown. The fact that the RNA structure is typically found in plasmids suggests that it might be involved in the regulation plasmid copy number by a cis-antisense mechanism in a manner similar to that of R1162-like plasmid antisense RNA.
|
|
RNA is able to form more intramolecular interactions than DNA which may result in change of its electrophoretic mobility. Urea, DMSO and glyoxal are the most often used denaturing agents to disrupt RNA structure. Originally, highly toxic methylmercury hydroxide was often used in denaturing RNA electrophoresis, but it may be method of choice for some samples. Denaturing gel electrophoresis is used in the DNA and RNA banding pattern-based methods temperature gradient gel electrophoresis (TGGE) and denaturing gradient gel electrophoresis (DGGE).
|
|
SBPV is a non-enveloped Positive-sense single- stranded RNA virus, and is 9470 nucleotides long. The virus has approximately 300 nucleotides of 5' untranslated region and approximately 270 nucleotides of 3' untranslated region and is terminated by a poly(A) tail. The RNA has a coding region which codes for RNA-dependent RNA polymerase. Though it was not identified, it is expected that a viral genome-linked protein, involved in stability, replication, and translation, would be bound to the 5' end.
|
|
Reliable predictions of Moco-II RNAs are restricted to deltaproteobacteria, but a Moco-II RNA might be present in a betaproteobacterial species. The Moco RNA motif is another RNA that is associated with Moco, and its complex secondary structure and genetic experiments have led to proposals that it is a riboswitch. However, the simpler structure of the Moco-II RNA motif (see diagram) is less typical of riboswitches. Moco-II RNAs are typically followed by a predicted rho- independent transcription terminator.
|
|
In this approach, cell culture samples are cultured with tagged nucleotides which allow for selective purification of newly synthesized RNA molecules. One popular approach is pulse labeling with 4-thiouridine (4-sU), a uracil analogue that is incorporated in newly synthesized RNA molecules. In this type of experiment, a researcher would supplement cells with 4-sU at the time of the experiment or shortly beforehand. When the experimental treatment presumably affects RNA expression, newly synthesized RNA would be labeled with 4-sU.
|
|
All 39 genes that are expressed 1 h post infection are located in the 104 kbp region and have the nanomer directly upstream of the start codon. Since the expression of viral RNA polymerase was not detected 1 h after infection, it has yet to be established whether the promoter is recognised by a packaged viral RNA polymerase or by the host RNA polymerase. Proteomic analysis of the EhV-86 virion did, however, fail to detect any major RNA polymerase subunits.
|
|
Using diagnostic chemical tests, carbohydrate chemists showed that the two nucleic acids contained different sugars, whereupon the common name for RNA became "ribose nucleic acid". Other early biochemical studies showed that RNA was readily broken down at high pH, while DNA was stable (although denatured) in alkali. Nucleoside composition analysis showed first that RNA contained similar nucleobases to DNA, with uracil instead of thymine, and that RNA contained a number of minor nucleobase components, e.g. small amounts of pseudouridine and dimethylguanine.
|
|
DNA polymerase can only connect new DNA nucleotides to a pre- existing chain of nucleotides. Therefore, replication begins as an enzyme called primase assembles an RNA primer at the origin of replication. The RNA primer consists of a short sequence of RNA nucleotides, complementary to a small, initial section of the DNA strand being prepared for replication. DNA polymerase is then able to add DNA nucleotides to the RNA primer and thus begin the process of constructing a new complementary strand of DNA.
|
|
RNase V1 played a particularly important role in the elucidation of the distinctive stem-loop structure of transfer RNA. It has also been extensively used to study the highly structured RNA genomes of retroviruses, such as hepatitis C, dengue virus, and HIV.. Together with S1 nuclease, which specifically cleaves single- stranded RNA, it can be used to profile the secondary structure propensities of messenger RNA molecules, a procedure that can be applied to whole transcriptomes when paired with deep sequencing.
|
|
Plants can transport viral RNAs, mRNAs, microRNAs (miRNAs) and small interfering RNAs (siRNAs) systemically through the phloem. This process is thought to occur through the plasmodesmata and involves RNA-binding proteins that assist RNA localization in mesophyll cells. Although they have been identified in the phloem with mRNA, there is no determinate evidence that they mediate long-distant transport of RNAs. EVs may therefore contribute to an alternate pathway of RNA loading into the phloem, or could possibly transport RNA through the apoplast.
|
|
Some neurological disorders associated with defective RNA helicases are: amyotrophic lateral sclerosis, spinal muscular atrophy, spinocerebellar ataxia type-2, Alzheimer disease, and lethal congenital contracture syndrome. RNA helicases and DNA helicases can be found together in all the helicase superfamilies except for SF6. All the eukaryotic RNA helicases that have been identified up to date are non-ring forming and are part of SF1 and SF2. On the other hand, ring-forming RNA helicases have been found in bacteria and viruses.
|
|
Eukaryotic Transcription Eukaryotic transcription is the elaborate process that eukaryotic cells use to copy genetic information stored in DNA into units of transportable complementary RNA replica. Gene transcription occurs in both eukaryotic and prokaryotic cells. Unlike prokaryotic RNA polymerase that initiates the transcription of all different types of RNA, RNA polymerase in eukaryotes (including humans) comes in three variations, each translating a different type of gene. A eukaryotic cell has a nucleus that separates the processes of transcription and translation.
|
|
Hentze’s research focuses on RNA biology and RNA-binding proteins. In 1987, Hentze and his colleagues discovered iron- responsive elements as first example of an RNA element regulating the translation of mammalian mRNA into proteins. Hentze’s research group has paved the way for understanding translational control (RNA-binding proteins, microRNAs) whose significance for developmental biology, brain function, carcinogenesis and other diseases has in the meantime become widely recognized. Moreover, he has made key discoveries in the area of iron metabolism and disease.
|
|
Some publications state that ncRNA and fRNA are nearly synonymous, however others have pointed out that a large proportion of annotated ncRNAs likely have no function. It also has been suggested to simply use the term RNA, since the distinction from a protein coding RNA (messenger RNA) is already given by the qualifier mRNA. This eliminates the ambiguity when addressing a gene "encoding a non-coding" RNA. Besides, there may be a number of ncRNAs that are misannoted in published literature and datasets.
|
|
RNA-binding proteins (often abbreviated as RBPs) are proteins that bind to the double or single stranded RNA in cells and participate in forming ribonucleoprotein complexes. RBPs contain various structural motifs, such as RNA recognition motif (RRM), dsRNA binding domain, zinc finger and others. They are cytoplasmic and nuclear proteins. However, since most mature RNA is exported from the nucleus relatively quickly, most RBPs in the nucleus exist as complexes of protein and pre-mRNA called heterogeneous ribonucleoprotein particles (hnRNPs).
|
|
This process effectively changes the RNA sequence from that encoded by the genome and extends the diversity of the gene products. The majority of RNA editing occurs on non-coding regions of RNA; however, some protein-encoding RNA transcripts have been shown to be subject to editing resulting in a difference in their protein's amino acid sequence. An example of this is the glutamate receptor mRNA where glutamine is converted to arginine leading to a change in the functionality of the protein.
|
|
In molecular biology and genetics, upstream and downstream both refer to relative positions of genetic code in DNA or RNA. Each strand of DNA or RNA has a 5' end and a 3' end, so named for the carbon position on the deoxyribose (or ribose) ring. By convention, upstream and downstream relate to the 5' to 3' direction respectively in which RNA transcription takes place. Upstream is toward the 5' end of the RNA molecule and downstream is toward the 3' end.
|
|
The OmrA-B RNA gene family (also known as SraE RNA, RygA and RygB and OmrA and OmrB) is a pair of homologous OmpR-regulated small non-coding RNA that was discovered in E. coli during two large-scale screens. OmrA-B is highly abundant in stationary phase, but low levels could be detected in exponentially growing cells as well. RygB is adjacent to RygA a closely related RNA. These RNAs bind to the Hfq protein and regulate gene expression by antisense binding.
|
|
RNA sequencing has taken over microarray and SAGE technology in recent years, as noted in 2016, and has become the most efficient way to study transcription and gene expression. This is typically done by next-generation sequencing. A subset of sequenced RNAs are small RNAs, a class of non-coding RNA molecules that are key regulators of transcriptional and post- transcriptional gene silencing, or RNA silencing. Next generation sequencing is the gold standard tool for non-coding RNA discovery, profiling and expression analysis.
|
|
Though RNA nanotechnology is still a burgeoning field, tectoRNAs and resulting nanostructures have already been shown to be useful in nanomedicine, nanotechnology, and synthetic biology. This includes the development of programmable nano-scaffolds and nano-particles for the delivery of RNA therapeutics. As such, RNA nanoparticles, like hexagonal nanorings, can be used as a delivery vehicle carrying therapeutic RNA to targeting cells. It is also possible to incorporate modified nucleotides within tectoRNAs in order to increase their chemical stability and resistant towards degradation.
|
|
RNA-induced transcriptional silencing (RITS) is a form of RNA interference by which short RNA molecules – such as small interfering RNA (siRNA) – trigger the downregulation of transcription of a particular gene or genomic region. This is usually accomplished by posttranslational modification of histone tails (e.g. methylation of lysine 9 of histone H3) which target the genomic region for heterochromatin formation. The protein complex that binds to siRNAs and interacts with the methylated lysine 9 residue of histones H3 is the RITS complex.
|
|
They found that under the right conditions the Qβ replicase can spontaneously generate RNA which evolves into a form similar to Spiegelman's Monster. However, Chetverin and colleagues later showed that the 'spontaneous' RNA generation was due to environmental RNA contamination. Eigen built on Spiegelman's work and produced a similar system further degraded to just 48 or 54 nucleotides—the minimum required for the binding of the replication enzyme, this time a combination of HIV-1 reverse transcriptase and T7 RNA polymerase.
|
|
RNA enzymes, or ribozymes, are found in today's DNA- based life and could be examples of living fossils. Ribozymes play vital roles, such as that of the ribosome. The large subunit of 70s Ribosome (50s) contains 23s rRNA which act as a peptide bond forming enzyme called peptidal transferase and helps in protein synthesis. Many other ribozyme functions exist; for example, the hammerhead ribozyme performs self-cleavage and an RNA polymerase ribozyme can synthesize a short RNA strand from a primed RNA template.
|
|
After only a few weeks, a DNAzyme with significant catalytic activity had evolved. In general, DNA is much more chemically inert than RNA and hence much more resistant to obtaining catalytic properties. If in vitro evolution works for DNA it will happen much more easily with RNA. ;Amino acid-RNA ligation :The ability to conjugate an amino acid to the 3'-end of an RNA in order to use its chemical groups or provide a long-branched aliphatic side-chain.
|
|
DNA is isolated from an aliquot of the bound complex by treatment with RNAse (or proteinase followed by RNAse) to digest associated protein and RNA. RNA may also be isolated from an additional aliquot of the bound complex to detect other RNA molecules associated with the RNA of interest. The purified DNA is then used to prepare a sequencing library and the library is sequenced on a next generation DNA sequencing system. The sequencing reads are then mapped to the genome.
|
|
UV-induced RNA-antibody crosslinking was added on top of m6A-seq to produce PA-m6A-seq (photo-crosslinking-assisted m6A-seq) which increases resolution up to ~23nt. First, 4-thiourodine (4SU) is incorporated into the RNA by adding 4SU in growth media, some incorporation sites presumably near m6A location. Immunoprecipitation is then performed on full- length RNA using m6A-specific antibody [36]. UV light at 365 nm is then shined onto RNA to activate the crosslinking to the antibody with 4SU.
|
|
Creating a protein consists of two main steps: transcription of DNA into RNA and translation of RNA into protein. After DNA is transcribed into RNA, the molecule is known as pre-messenger RNA (mRNA) and it consists of exons and introns that can be split apart and rearranged in many different ways. Historically, exons are considered the coding sequence and introns are considered the “junk” DNA. Although this has been shown to be false, it is true that exons are often merged.
|
|
Bass joined the faculty at the University of Utah in 1989. She was named a Distinguished Professor in 2007 and given the H. A. and Edna Benning Chair in 2009. Research in Bass' laboratory focuses on RNA silencing and the cellular dynamics of double-stranded RNA (dsRNA) and double-stranded RNA binding proteins. She has continued to work with the ADAR enzymes she discovered during her postdoctoral work, as well as with Dicer, a key ribonuclease enzyme in the RNA silencing pathway.
|
|
Plant infection for RHBV is relatively standard for negative-sense single stranded RNA plant viruses, consisting of entering the cell, using an RNA-dependent RNA polymerase to convert to positive-sense RNA, and using the host's cellular machinery to produce viral proteins and genomes. Research shows that RHBV likely uses "cap- snatching", a technique where the virus cleaves and uses the 5' cap of the host cell, in order to begin synthesis of viral mRNA. However, there are some unique qualities possessed by RHBV. The NS3 protein encoded by RNA3 has been shown to suppress RNA silencing in both rice and insect vectors, contributing to the successful propagation of the virus.
|
|
All organisms studied contain many RNases of two different classes, showing that RNA degradation is a very ancient and important process. As well as cleaning of cellular RNA that is no longer required, RNases play key roles in the maturation of all RNA molecules, both messenger RNAs that carry genetic material for making proteins, and non- coding RNAs that function in varied cellular processes. In addition, active RNA degradation systems are a first defense against RNA viruses, and provide the underlying machinery for more advanced cellular immune strategies such as RNAi. Some cells also secrete copious quantities of non-specific RNases such as A and T1.
|
|
Northern blot diagram The northern blot is used to study the expression patterns of a specific type of RNA molecule as relative comparison among a set of different samples of RNA. It is essentially a combination of denaturing RNA gel electrophoresis, and a blot. In this process RNA is separated based on size and is then transferred to a membrane that is then probed with a labeled complement of a sequence of interest. The results may be visualized through a variety of ways depending on the label used; however, most result in the revelation of bands representing the sizes of the RNA detected in sample.
|
|
The earliest work in RNA structural biology coincided, more or less, with the work being done on DNA in the early 1950s. In their seminal 1953 paper, Watson and Crick suggested that van der Waals crowding by the 2`OH group of ribose would preclude RNA from adopting a double helical structure identical to the model they proposed - what we now know as B-form DNA. This provoked questions about the three-dimensional structure of RNA: could this molecule form some type of helical structure, and if so, how? As with DNA, early structural work on RNA centered around isolation of native RNA polymers for fiber diffraction analysis.
|
|
New England Biolabs developed a colorimetric loop-mediated isothermal amplification (LAMP) assay for research use. This assay can be used to test for the presence of virus through nucleic acid detection, returning results in only 30 minutes. In 2020, the LAMP method was one of several molecular tests used to detect RNA from SARS-CoV-2, a strain of coronavirus that causes COVID-19. RNA isolation kits were also used to develop assays to detect SARS-CoV-2. NEB’s Monarch Total RNA Miniprep Kit was not designed specifically for viral RNA extraction, but it was successfully used by different companies to extract viral RNA from biological samples.
|
|
Proteins in the third layer (VP7 and the VP4 spike) disrupt the membrane of the endosome, creating a difference in the calcium concentration. This causes the breakdown of VP7 trimers into single protein subunits, leaving the VP2 and VP6 protein coats around the viral dsRNA, forming a double-layered particle (DLP). The eleven dsRNA strands remain within the protection of the two protein shells and the viral RNA-dependent RNA polymerase creates mRNA transcripts of the double-stranded viral genome. By remaining in the core, the viral RNA evades innate host immune responses including RNA interference that are triggered by the presence of double-stranded RNA.
|
|
The traJ-II RNA motif is a conserved RNA structure discovered in bacteria by using bioinformatics. traJ-II RNAs appear to be in the 5' untranslated regions of protein-coding genes called traJ, which functions in the process of bacterial conjugation. A previously identified motif known as TraJ 5' UTR is also found upstream of traJ genes functions as the target of FinP antisense RNAs, so it is possible that traJ-II RNAs play a similar role as targets of an antisense RNA. However, some sequence features within the traJ-II RNA motif suggest that the biological RNA might be transcribed from the reverse- complement strand.
|
|
Real time PCR uses fluorophores in order to detect levels of gene expression. Cells in all organisms regulate gene expression by turnover of gene transcripts (single stranded RNA): The amount of an expressed gene in a cell can be measured by the number of copies of an RNA transcript of that gene present in a sample. In order to robustly detect and quantify gene expression from small amounts of RNA, amplification of the gene transcript is necessary. The polymerase chain reaction (PCR) is a common method for amplifying DNA; for RNA-based PCR the RNA sample is first reverse-transcribed to complementary DNA (cDNA) with reverse transcriptase.
|
|
Research has shown that infection of plants from tombusviruses contain defective interfering RNAs that are born directly from the viruses RNA genome, and no host genome. Viral DI RNAs with their small size and cis-acting elements are good templates both in vivo and in vitro on which to study RNA replication.NCBI: Defective interfering RNA-4 of tomato bushy stunt virus (TBSV-P DI-4) and Defective interfering RNA-5 of tomato bushy stunt virus (TBSV-P DI-5) Sub-genomic RNA is used in the synthesis of some proteins; they are generated by premature termination of (−)strand synthesis. sgRNAs and sgRNA negative-sense templates are found in infected cells.
|
|
The RNA genome encodes at least four polypeptides: these are the non-structural protein and the read-through product which are involved in virus replication (RNA-dependent RNA polymerase, RdRp); the movement protein (MP) which is necessary for the virus to move between cells and the coat protein (CP). The read-through portion of the RdRp may be expressed as a separate protein in TMV. The virus is able to replicate without the movement or coat proteins, but the other two are essential. The non-structural protein has domains suggesting it is involved in RNA capping and the read-through product has a motif for an RNA polymerase.
|
|
For transcription to take place, the enzyme that synthesizes RNA, known as RNA polymerase, must attach to the DNA near a gene. Promoters contain specific DNA sequences such as response elements that provide a secure initial binding site for RNA polymerase and for proteins called transcription factors that recruit RNA polymerase. These transcription factors have specific activator or repressor sequences of corresponding nucleotides that attach to specific promoters and regulate gene expression. ;In bacteria: The promoter is recognized by RNA polymerase and an associated sigma factor, which in turn are often brought to the promoter DNA by an activator protein's binding to its own DNA binding site nearby.
|
|
Comparing the SRP RNA genes from different species revealed helix 8 of the SRP RNA to be highly conserved in all domains of life. The regions near the 5′- and 3′-ends of the mammalian SRP RNA are similar to the dominant Alu family of middle repetitive sequences of the human genome. It is now understood that Alu DNA originated from SRP RNA by excision of the central SRP RNA-specific (S) fragment, followed by reverse transcription and integration into multiple sites of the human chromosomes. SRP RNAs have been identified also in some organelles, for example in the plastid SRPs of many photosynthetic organisms.
|
|
Small nucleolar RNA SNORA70 (also known as U70) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". ACA70 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
In particular, IBV D-RNA CD-61 is used to experimentally produce recombinant IBV vaccines. D-RNA CD-61 was created from the naturally occurring IBV D-RNA CD-91, which is produced by multiple passage of high concentration IBV in chick kidney (CK) cells. The IBV D-RNA CD-61 resulted from deletion mutagenesis of CD-91 and lacks much of the genome but retains the sequences necessary for replication and packaging of viral particles in the presence of a helper virus. One particularly promising method of IBV D-RNA-mediated heterologous gene expression uses the helper virus dependent system to promote IBV immunity.
|
|
The helper virus identifies and responds to signals within the IBV D-RNA that are responsible for replication and packaging of IBV particles. Those sequences are thought to be contained within the 5’ and 3’ UTRs of the D-RNA. Analysis of the packaged IBV particles revealed that leader sequence switching occurs between the D-RNA and the IBV helper viruses, which was similarly observed in bovine coronavirus. In addition, it was found that the TAS of the IBV D-RNA contained a consensus sequence that can accept the switched leader sequence and can also be involved in the expression of mRNA from D-RNA.
|
|
Small nucleolar RNA SNORA61 (also known as ACA61) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA61 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA69 (also known as U69) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". ACA69 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA psi18S-1377 (also known as snoRNA psi28S-1377) is a non- coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. This Drosophila-specific snoRNA is a member of the H/ACA box class of snoRNA and is predicted to be responsible for guiding the modification of uridines 1377 and 1279 to pseudouridine in Drosophila 18S rRNA.
|
|
Small nucleolar RNA psi28S-3327 (also known as snoRNA psi28S-3327) is a non- coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. This Drosophila-specific snoRNA is a member of the H/ACA box class of snoRNA and is predicted to be responsible for guiding the modification of uridines 1854 and 1937 to pseudouridine in Drosophila 18S rRNA.
|
|
Small nucleolar RNA psi28S-1192 (also known as snoRNA psi28S-1192) is a non- coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. This Drosophila-specific snoRNA is a member of the H/ACA box class of snoRNA and is predicted to be responsible for guiding the modification of uridine 1192 to pseudouridine in Drosophila 28S rRNA.
|
|
Small nucleolar RNA psi28S-2876 (also known as snoRNA psi28S-2876) is a non- coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. This Drosophila-specific snoRNA is a member of the H/ACA box class of snoRNA and is predicted to be responsible for guiding the modification of uridines 2876 and 2956 to pseudouridine in Drosophila 28S rRNA.
|
|
Small nucleolar RNA psi28S-3327 (also known as snoRNA psi28S-3327) is a non- coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. This Drosophila specific snoRNA is a member of the H/ACA box class of snoRNA and is predicted to be responsible for guiding the modification of uridine 3327 in Drosophila 28S and U1920 in Drosophila 18S rRNA to pseudouridine.
|
|
Small nucleolar RNA SNORA43 (also known as ACA43) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA43 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA44 (also known as ACA44) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA44 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA46 (also known as ACA46) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA46 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA50 (also known as ACA50) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA50 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA51 (also known as ACA51) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA51 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA52 (also known as ACA52) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA52 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA54 (also known as ACA54) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA54 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA55 (also known as ACA55) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA55 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA56 (also known as ACA56) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. ACA56 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA58 (also known as ACA58) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". ACA58 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA68 (also known as U68) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". ACA68 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA SNORA72 (also known as U72) is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a "guide RNA". ACA30 was originally cloned from HeLa cells and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin-hinge-hairpin-tail structure, has the conserved H/ACA-box motifs and is found associated with GAR1 protein.
|
|
Small nucleolar RNA MBI-28, also known as SNORA3 and ACA3, is a non-coding RNA (ncRNA) molecule which functions in the biogenesis (modification) of other small nuclear RNAs (snRNAs). This type of modifying RNA is located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis. It is known as a small nucleolar RNA (snoRNA) and also often referred to as a 'guide RNA'. snoRNA MBI-28 was originally cloned from mouse brain tissues and belongs to the H/ACA box class of snoRNAs as it has the predicted hairpin- hinge-hairpin-tail structure and has the conserved H/ACA-box motifs.
|
|
All RBPs can bind to RNA depends on different specificities and affinities. RBPs contain at least one RNA-binding domains and usually they have multiple binding domains. RNA-binding domain (RBD, also known as RNP domain and RNA recognition motif, RRM), K-homology (KH) domain (type I and type II), RGG (Arg-Gly-Gly) box, Sm domain; DEAD/DEAH box, zinc finger (ZnF, mostly C-x8-X-x5-X-x3-H), double stranded RNA-binding domain (dsRBD), cold- shock domain; Pumilio/FBF (PUF or Pum-HD) domain, and the Piwi/Argonaute/Zwille (PAZ) domain have been well characterized. RBPs are constructed by multiple binding domains.
|
|
BC200 RNA Brain cytoplasmic 200 long-noncoding RNA (or BC200 lncRNA) is a 200 nucleotide RNA transcript found predominantly in the brain with a primary function of regulating translation by inhibiting its initiation. As a long non-coding RNA, it belongs to a family of RNA transcripts that are not translated into protein (ncRNAs). Of these ncRNAs, lncRNAs are transcripts of 200 nucleotides or longer and are almost three times more prevalent than protein-coding genes. Nevertheless, only a few of the almost 60,000 lncRNAs have been characterized, and little is known about their diverse functions (transcriptional interference, chromatin remodeling, splicing, translation regulation, interaction with miRNAs and siRNAs, and mRNA degradation).
|
|
The sequence of DNA that encodes the sequence of the amino acids in a protein, is transcribed into a messenger RNA chain. Ribosomes bind to messenger RNAs and use its sequence for determining the correct sequence of amino acids to generate a given protein. Amino acids are selected and carried to the ribosome by transfer RNA (tRNA) molecules, which enter the ribosome and bind to the messenger RNA chain via an anti-codon stem loop. For each coding triplet (codon) in the messenger RNA, there is a transfer RNA that matches and carries the correct amino acid for incorporating into a growing polypeptide chain.
|
|
In accordance with the central dogma of molecular biology, RNA passes information between the DNA of a genome and the proteins expressed within an organism. Therefore, from an evolutionary standpoint, a mutation within the DNA bases results in an alteration of the RNA transcripts, which in turn leads to a direct difference in phenotype. RNA is also believed to have been the genetic material of the first life on Earth. The role of RNA in the origin of life is best supported by the ease of forming RNA from basic chemical building blocks (such as amino acids, sugars, and hydroxyl acids) that were likely present 4 billion years ago.
|
|
The RIN algorithm is applied to electrophoretic RNA measurements, typically obtained using capillary gel electrophoresis, and based on a combination of different features that contribute information about the RNA integrity to provide a more universal measure. RIN has been demonstrated to be robust and reproducible in studies comparing it to other RNA integrity calculation algorithms, cementing its position as a preferred method of determining the quality of RNA to be analyzed. A major criticism to RIN is when using with plants or in studies of eukaryotic-prokaryotic cells interactions. The RIN algorithm is unable to differentiate eukaryotic/prokaryotic/chloroplastic ribosomal RNA, creating serious quality index underestimation in such situations.
|
|
This can produce an electropherogram such as the one in Figure 1, where length is related to time at which the samples pass the detector. A marker is a sample of known size run along with the sample so that the actual size of the rest of the sample can be known by comparing their running distance/time to be relative to this marker. RNA is a biological macromolecule made of sugars and nitrogenous bases that plays a number of crucial roles in all living cells. There are several subtypes of RNA, with the most prominent in the cell being tRNA (transfer RNA), rRNA (ribosomal RNA), and mRNA (messenger RNA).
|
|
In molecular biology, Small Cajal body- specific RNA 1 (also known as SCARNA1 or ACA35) is a small nucleolar RNA found in Cajal bodies and believed to be involved in the pseudouridylation of U2 spliceosomal RNA at residue U89. scaRNA1 is a non-coding RNA, which are functional products of genes not translated into proteins. Such RNA molecules usually contain important secondary structure or ligand-binding motifs and are involved in many important biological processes in the cell. scaRNA1 belongs to the H/ACA box class of snoRNAs, as it has the predicted hairpin-hinge- hairpin-tail structure, conserved H/ACA-box motifs, and is found associated with GAR1 protein.
|
|
DNA directed RNA polymerase II polypeptide J-related gene, also known as POLR2J2, is a human gene. This gene is a member of the RNA polymerase II subunit 11 gene family, which includes three genes in a cluster on chromosome 7q22.1 and a pseudogene on chromosome 7p13. The founding member of this family, DNA directed RNA polymerase II polypeptide J, has been shown to encode a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This locus produces multiple, alternatively spliced transcripts that potentially express isoforms with distinct C-termini compared to DNA directed RNA polymerase II polypeptide J. Most or all variants are spliced to include additional non-coding exons at the 3' end which makes them candidates for nonsense-mediated decay (NMD).
|
|
Simple diagram of transcription elongation One strand of the DNA, the template strand (or noncoding strand), is used as a template for RNA synthesis. As transcription proceeds, RNA polymerase traverses the template strand and uses base pairing complementarity with the DNA template to create an RNA copy (which elongates during the traversal). Although RNA polymerase traverses the template strand from 3' → 5', the coding (non-template) strand and newly formed RNA can also be used as reference points, so transcription can be described as occurring 5' → 3'. This produces an RNA molecule from 5' → 3', an exact copy of the coding strand (except that thymines are replaced with uracils, and the nucleotides are composed of a ribose (5-carbon) sugar where DNA has deoxyribose (one fewer oxygen atom) in its sugar-phosphate backbone).
|
|
Post-transcriptional modification or co-transcriptional modification is a set of biological processes common to most eukaryotic cells by which an RNA primary transcript is chemically altered following transcription from a gene to produce a mature, functional RNA molecule that can then leave the nucleus and perform any of a variety of different functions in the cell. There are many types of post-transcriptional modifications achieved through a diverse class of molecular mechanisms. One example is the conversion of precursor messenger RNA transcripts into mature messenger RNA that is subsequently capable of being translated into protein. This process includes three major steps that significantly modify the chemical structure of the RNA molecule: the addition of a 5' cap, the addition of a 3' polyadenylated tail, and RNA splicing.
|
|
In many cases subgenomic RNAs are also created during replication. After infection, the entirety of the host cell's translation machinery may be diverted to the production of viral proteins as a result of the very high affinity for ribosomes by the viral genome's internal ribosome entry site (IRES) elements; in some viruses, such as poliovirus and rhinoviruses, normal protein synthesis is further disrupted by viral proteases degrading components required to initiate translation of cellular mRNA. All positive-strand RNA virus genomes encode RNA-dependent RNA polymerase a viral protein that synthesizes RNA from an RNA template. Host cell proteins recruited by +ssRNA viruses during replication include RNA-binding proteins, chaperone proteins, and membrane remodeling and lipid synthesis proteins, which collectively participate in exploiting the cell's secretory pathway for viral replication.
|
|