Follow tradition, of course, and enforce the homology down the generations.
|
|
"Given the somewhat close homology between SARS and the new novel coronavirus, there could be some cross-reactivity there that could be utilized."
|
|
Early lab work done in Wuhan showed the novel coronavirus behind Covid-19 had 80 percent homology—similarity due to shared ancestry—with the 2003 coronavirus that caused SARS.
|
|
The work compels me to think about how alien and strange this person appears to me despite the homology between the color she is wearing and the color in the flags.
|
|
This year has delivered several other good-sized offerings as well, including drug developers Eidos Therapeutics and Homology Medicines, recently valued around $800 million each, along with Tricida, valued around $1.2 billion.
|
|
This display scheme strikes me as a strange homology since El Anatsui is Ghanaian working primarily in Nigeria, and in the 21st century, no less, while the Egyptian artifact is both geographically and chronologically distal.
|
|
There is a suggestion of a visual homology between the roundness of the ball and the color circles that Braman has made, but they don't complement each other; they make the other deadpan and inert.
|
|
For one thing, as Robin Lovell-Badge, an expert in the area who works at the Francis Crick Institute in London, observes, the study focuses on a form of genome-editing called "non-homology end joining".
|
|
Instead, I feel drawn to her quotidian representations of listless, low-level, corporate office life — because the whole reveals the homology between the impedimenta of this kind of environment and the poverty of human agency and imagination I feel once I enter these spaces.
|
|
In mathematics, cellular homology in algebraic topology is a homology theory for the category of CW-complexes. It agrees with singular homology, and can provide an effective means of computing homology modules.
|
|
The knot Floer homology groups are part of the Heegaard Floer homology family of invariants; see Floer homology for further discussion.
|
|
Rolf Sattler has revised fundamental concepts of comparative morphology such as the concept of homology. He emphasized that homology should also include partial homology and quantitative homology.Sattler, R., 1994, Homology, homeosis, and process morphology in plants. In: B.K. Hall (ed.) Homology: The hierarchical basis of comparative morphology.
|
|
In noncommutative geometry and related branches of mathematics, cyclic homology and cyclic cohomology are certain (co)homology theories for associative algebras which generalize the de Rham (co)homology of manifolds. These notions were independently introduced by Boris Tsygan (homology)Boris L. Tsygan. Homology of matrix Lie algebras over rings and the Hochschild homology. Uspekhi Mat. Nauk, 38(2(230)):217–218, 1983.
|
|
A rational homology sphere is defined similarly but using homology with rational coefficients.
|
|
The chromatic polynomial is categorified by a homology theory closely related to Khovanov homology.
|
|
An infinite dimensional analog of Morse homology in symplectic geometry is known as Floer homology.
|
|
The selected best template is used to build the structure model. Unlike homology modeling, which selects template purely based on homology information (sequence alignments), the scoring function used in protein threading utilizes both homology and structure information (sequence structure alignments). If a sequence has no significant homology found, homology modeling may not give reliable prediction in this case. Without homology information, protein threading can still use structure information to produce good prediction.
|
|
Another spectral sequence (Ozsváth-Szabó 2005) relates a variant of Khovanov homology with the Heegaard Floer homology of the branched double cover along a knot. A third (Bloom 2009) converges to a variant of the monopole Floer homology of the branched double cover. In 2010 Kronheimer and Mrowka exhibited a spectral sequence abutting to their instanton knot Floer homology group and used this to show that Khovanov Homology (like the instanton knot Floer homology) detects the unknot. Khovanov homology is related to the representation theory of the Lie algebra sl2.
|
|
Heegaard Floer homology is an invariant due to Peter Ozsváth and Zoltán Szabó of a closed 3-manifold equipped with a spinc structure. It is computed using a Heegaard diagram of the space via a construction analogous to Lagrangian Floer homology. announced a proof that Heegaard Floer homology is isomorphic to Seiberg-Witten Floer homology, and announced a proof that the plus-version of Heegaard Floer homology (with reverse orientation) is isomorphic to embedded contact homology. A knot in a three-manifold induces a filtration on the Heegaard Floer homology groups, and the filtered homotopy type is a powerful knot invariant, called knot Floer homology.
|
|
Several kinds of Floer homology are special cases of Lagrangian Floer homology. The symplectic Floer homology of a symplectomorphism of M can be thought of as a case of Lagrangian Floer homology in which the ambient manifold is M crossed with M and the Lagrangian submanifolds are the diagonal and the graph of the symplectomorphism. The construction of Heegaard Floer homology is based on a variant of Lagrangian Floer homology for totally real submanifolds defined using a Heegaard splitting of a three-manifold. Seidel- Smith and Manolescu constructed a link invariant as a certain case of Lagrangian Floer homology, which conjecturally agrees with Khovanov homology, a combinatorially-defined link invariant.
|
|
The group homology of the alternating groups exhibits stabilization, as in stable homotopy theory: for sufficiently large n, it is constant. However, there are some low-dimensional exceptional homology. Note that the homology of the symmetric group exhibits similar stabilization, but without the low- dimensional exceptions (additional homology elements).
|
|
In mathematics, specifically in the field of differential topology, Morse homology is a homology theory defined for any smooth manifold. It is constructed using the smooth structure and an auxiliary metric on the manifold, but turns out to be topologically invariant, and is in fact isomorphic to singular homology. Morse homology also serves as a model for the various infinite-dimensional generalizations known as Floer homology theories.
|
|
If X has a triangulation compatible with the stratification, then simplicial intersection homology groups can be defined in a similar way, and are naturally isomorphic to the singular intersection homology groups. The intersection homology groups are independent of the choice of stratification of X. If X is a topological manifold, then the intersection homology groups (for any perversity) are the same as the usual homology groups.
|
|
In algebraic topology, Steenrod homology is a homology theory for compact metric spaces introduced by , based on regular cycles. It is similar to the homology theory introduced rather sketchily by Andrey Kolmogorov in 1936.
|
|
In mathematics, Floer homology is a tool for studying symplectic geometry and low-dimensional topology. Floer homology is a novel invariant that arises as an infinite-dimensional analogue of finite-dimensional Morse homology. Andreas Floer introduced the first version of Floer homology, now called Lagrangian Floer homology, in his proof of the Arnold conjecture in symplectic geometry. Floer also developed a closely related theory for Lagrangian submanifolds of a symplectic manifold.
|
|
In algebraic topology, a branch of mathematics, the (singular) homology of a topological space relative to a subspace is a construction in singular homology, for pairs of spaces. The relative homology is useful and important in several ways. Intuitively, it helps determine what part of an absolute homology group comes from which subspace.
|
|
He emphasized that the concepts of homology and homeosis (replacement) should also include partial homology, partial homeosis, and quantitative homology.Hall, B. K. (ed.) 1994. Homology: The hierarchical basis of comparative morphology. New York: Academic Press, pp.
|
|
By work of Clifford Taubes this is known to be isomorphic to embedded contact homology and subsequently Heegaard Floer homology.
|
|
One conceivable way to construct a Floer homology theory of some object would be to construct a related spectrum whose ordinary homology is the desired Floer homology. Applying other homology theories to such a spectrum could yield other interesting invariants. This strategy was proposed by Ralph Cohen, John Jones, and Graeme Segal, and carried out in certain cases for Seiberg–Witten–Floer homology by and for the symplectic Floer homology of cotangent bundles by Cohen. This approach was the basis of Manolescu's 2013 construction of Pin (2)-equivariant Seiberg-Witten Floer homology, with which he disproved the Triangulation Conjecture for manifolds of dimension 5 and higher.
|
|
Singular homology is a related theory which is better adapted to theory rather than computation. Singular homology is defined for all topological spaces and obviously depends only on the topology, not any triangulation; and it agrees with simplicial homology for spaces which can be triangulated. Nonetheless, because it is possible to compute the simplicial homology of a simplicial complex automatically and efficiently, simplicial homology has become important for application to real-life situations, such as image analysis, medical imaging, and data analysis in general. Another related theory is Cellular homology.
|
|
If one defines a homology theory axiomatically (via the Eilenberg–Steenrod axioms), and then relaxes one of the axioms (the dimension axiom), one obtains a generalized theory, called an extraordinary homology theory. These originally arose in the form of extraordinary cohomology theories, namely K-theory and cobordism theory. In this context, singular homology is referred to as ordinary homology.
|
|
The Heegaard Floer homology of the double cover of S^3 branched over a knot is related by a spectral sequence to Khovanov homology . The "hat" version of Heegaard Floer homology was described combinatorially by . The "plus" and "minus" versions of Heegaard Floer homology, and the related Ozsváth-Szabó four-manifold invariants, can be described combinatorially as well .
|
|
In 2000 Mikhail Khovanov constructed a certain chain complex for knots and links and showed that the homology induced from it is a knot invariant (see Khovanov homology). The Jones polynomial is described as the Euler characteristic for this homology.
|
|
It is a natural long exact sequence, whose entries are the (co)homology groups of the whole space, the direct sum of the (co)homology groups of the subspaces, and the (co)homology groups of the intersection of the subspaces. The Mayer–Vietoris sequence holds for a variety of cohomology and homology theories, including simplicial homology and singular cohomology. In general, the sequence holds for those theories satisfying the Eilenberg–Steenrod axioms, and it has variations for both reduced and relative (co)homology. Because the (co)homology of most spaces cannot be computed directly from their definitions, one uses tools such as the Mayer–Vietoris sequence in the hope of obtaining partial information.
|
|
One version of Seiberg-Witten- Floer homology was constructed rigorously in the monograph Monopoles and Three-manifolds by Peter Kronheimer and Tomasz Mrowka, where it is known as monopole Floer homology. Taubes has shown that it is isomorphic to embedded contact homology. Alternate constructions of SWF for rational homology 3-spheres have been given by and ; they are known to agree.
|
|
In complex geometry, a polar homology is a group which captures holomorphic invariants of a complex manifold in a similar way to usual homology of a manifold in differential topology. Polar homology was defined by B. Khesin and A. Rosly in 1999.
|
|
In mathematics, particularly algebraic topology and homology theory, the Mayer–Vietoris sequence is an algebraic tool to help compute algebraic invariants of topological spaces, known as their homology and cohomology groups. The result is due to two Austrian mathematicians, Walther Mayer and Leopold Vietoris. The method consists of splitting a space into subspaces, for which the homology or cohomology groups may be easier to compute. The sequence relates the (co)homology groups of the space to the (co)homology groups of the subspaces.
|
|
Leopold Vietoris on his 110th birthday Like the fundamental group or the higher homotopy groups of a space, homology groups are important topological invariants. Although some (co)homology theories are computable using tools of linear algebra, many other important (co)homology theories, especially singular (co)homology, are not computable directly from their definition for nontrivial spaces. For singular (co)homology, the singular (co)chains and (co)cycles groups are often too big to handle directly. More subtle and indirect approaches become necessary.
|
|
ORF 2 has some homology to the viral protein 2 of chicken anaemia virus. ORF 3 has no homology to any known protein. Similarly neither ORF 4 or 5 have any homology with any known protein. The functions of these proteins is not known.
|
|
In mathematics, and particularly homology theory, Steenrod's Problem (named after mathematician Norman Steenrod) is a problem concerning the realisation of homology classes by singular manifolds.
|
|
The Atiyah-Hirzebruch spectral sequence is the analogous method of computing the (co)homology of a CW-complex, for an arbitrary extraordinary (co)homology theory.
|
|
The Poincaré homology sphere (also known as Poincaré dodecahedral space) is a particular example of a homology sphere. Being a spherical 3-manifold, it is the only homology 3-sphere (besides the 3-sphere itself) with a finite fundamental group. Its fundamental group is known as the binary icosahedral group and has order 120. This shows the Poincaré conjecture cannot be stated in homology terms alone.
|
|
Human HPS90AB1 shares 60% overall homology to its closest relative HSP90AA1. Murine HSP90AB1 was cloned in 1987 based on homology of the corresponding Drosophila melanogaster gene.
|
|
A key conceptual and mechanistic problem in evolutionary biology is the nature of character identity, aka homology. Wagner was an early proponent of a mechanistic understanding of homology,Wagner, G. P. 1989a. The biological homology concept. Annu. Rev. Ecol. Syst. 20:51-69.Wagner, G. P. 2007.
|
|
In biology, a Src homology domain is one of the two small protein binding domains found in the Src oncoprotein. Homologs of both the Src homology 2 and Src homology 3 domains are found in numerous other proteins. The Src homology 1 domain was an early name of the protein kinase domain. In terms of initiating the cell cycle when growth factor signals are present, "Src homology domains" are found on Grb2 proteins, allowing them to bind Receptor Tyrosine Kinases (RTKs), and also on SOS proteins allowing them to interact with Grb2.
|
|
In algebraic topology, a branch of mathematics, singular homology refers to the study of a certain set of algebraic invariants of a topological space X, the so-called homology groups H_n(X). Intuitively, singular homology counts, for each dimension n, the n-dimensional holes of a space. Singular homology is a particular example of a homology theory, which has now grown to be a rather broad collection of theories. Of the various theories, it is perhaps one of the simpler ones to understand, being built on fairly concrete constructions.
|
|
Homology search: The query sequence is used to find homologous proteins or/and protein fragments in a non-redundant database of PDB sequences and secondary structures of PPT-DB using BLAST. Homology modelling: Homology modelling is done by the Homodeller program, which is a part of the PROTEUS2 program. The proteins that are identified during the homology search step are used as the templates in homology modelling. Chemical shift re-referencing: Chemical shifts are re-referenced by the RefCor, which is a part of the RCI webserver backend.
|
|
The Poincaré homology sphere (also known as Poincaré dodecahedral space) is a particular example of a homology sphere, first constructed by Henri Poincaré. Being a spherical 3-manifold, it is the only homology 3-sphere (besides the 3-sphere itself) with a finite fundamental group. Its fundamental group is known as the binary icosahedral group and has order 120. This shows the Poincaré conjecture cannot be stated in homology terms alone.
|
|
With Octav Cornea he developed a new homology (cluster homology), leading to a new universal Floer homology for pairs of Lagrangian submanifolds of a symplectic manifold.Cornea, Lalonde Cluster Homology, Preprint 2005 He has also collaborated with Dusa McDuff and Leonid Polterovich. He became Fellow of the Royal Society of Canada in 1997 at the age of 41, Fellow of the Fields Institute in 2001 when this distinction was launched.
|
|
Pleckstrin Homology domain containing Family M Member 3, or PLEKHM3, is the hypothetical protein that in humans is encoded by the PLEKHM3 gene.: plekstrin homology domain containing family member 3 PLEKHM3 is also known as DAPR (differentiation associated protein), and Pleckstrin Homology Domain Containing Family M, Member 1-like.
|
|
From a formal point of view, the Mayer–Vietoris sequence can be derived from the Eilenberg–Steenrod axioms for homology theories using the long exact sequence in homology.
|
|
In mathematics, a homology theory in algebraic topology is compactly supported if, in every degree n, the relative homology group Hn(X, A) of every pair of spaces :(X, A) is naturally isomorphic to the direct limit of the nth relative homology groups of pairs (Y, B), where Y varies over compact subspaces of X and B varies over compact subspaces of A.. Singular homology is compactly supported, since each singular chain is a finite sum of simplices, which are compactly supported. Strong homology is not compactly supported. If one has defined a homology theory over compact pairs, it is possible to extend it into a compactly supported homology theory in the wider category of Hausdorff pairs (X, A) with A closed in X, by defining that the homology of a Hausdorff pair (X, A) is the direct limit over pairs (Y, B), where Y, B are compact, Y is a subset of X, and B is a subset of A.
|
|
Precursors to the full concept of persistent homology appeared gradually over time.Edelsbrunner H. Persistent homology: theory and practice[J]. 2014. In 1990, Patrizio Frosini introduced the size function, which is equivalent to the 0th persistent homology. Nearly a decade later, Vanessa Robins studied the images of homomorphisms induced by inclusion.
|
|
GeNMR uses homology modeling and sequence/structure threading to rapidly generate a first-pass model of the query protein. The use of homology modeling/threading in GeNMR allows a considerable speed-up in its structure calculations since homology models can often be generated and refined in a minute or two.
|
|
In mathematics, the Bockstein spectral sequence is a spectral sequence relating the homology with mod p coefficients and the homology reduced mod p. It is named after Meyer Bockstein.
|
|
Singular homology is a useful invariant of topological spaces up to homotopy equivalence. The degree zero homology group is a free abelian group on the connected components of X.
|
|
Different ways of constructing homology could be shown to coincide: for example in the case of a simplicial complex the groups defined directly would be isomorphic to those of the singular theory. What cannot easily be expressed without the language of natural transformations is how homology groups are compatible with morphisms between objects, and how two equivalent homology theories not only have the same homology groups, but also the same morphisms between those groups.
|
|
The new combinatorial topology formally treated topological classes as abelian groups. Homology groups are finitely generated abelian groups, and homology classes are elements of these groups. The Betti numbers of the manifold are the rank of the free part of the homology group, and the non-orientable cycles are described by the torsion part. The subsequent spread of homology groups brought a change of terminology and viewpoint from "combinatorial topology" to "algebraic topology".
|
|
The gene is confined within Animals, as confident orthologs in fungi and chaonoflagettes were not found. The human gene shares defined homology with placental mammals, marsupials, monotremes, reptiles, birds, amphibians, cartilaginous fish and some homology in insects, lobe finned fish, chelicerates and corals (Figure 22). The following significant taxonomic groups do not yield confident homology: nematodes, cnidaria, platyhelminths, porifera, annelids, ctenophora, mollusca, echinodermata, myriapoda, agnatha, tunicata. Crustacea is a borderline case that may yield homology.
|
|
The n-th homology group of X is then defined as the factor group :H_{n}(X) = Z_n(X) / B_n(X). The elements of H_n(X) are called homology classes.
|
|
Clostridium perfringens beta toxin shows significant genetic homology with several other toxins. C. perfringens beta toxin shows 28% homology with S. aureus alpha toxin and similar homology to S. aureus gamma-toxin and leukocidin. It appears in two forms. The smaller, with a molecular mass of 34 kDa, represents the monomeric gene product.
|
|
The different types of homology theory arise from functors mapping from various categories of mathematical objects to the category of chain complexes. In each case the composition of the functor from objects to chain complexes and the functor from chain complexes to homology groups defines the overall homology functor for the theory.
|
|
Homology shared by members of the Mcm2-7 protein family. Homology among the six members of the family are indicated in black. Homology of each member across species is indicated in colour. The minichromosome maintenance proteins were named after a yeast genetics screen for mutants defective in the regulation of DNA replication initiation.
|
|
A version of the product also exists for non-exact symplectomorphisms. For the cotangent bundle of a manifold M, the Floer homology depends on the choice of Hamiltonian due to its noncompactness. For Hamiltonians that are quadratic at infinity, the Floer homology is the singular homology of the free loop space of M (proofs of various versions of this statement are due to Viterbo, Salamon–Weber, Abbondandolo–Schwarz, and Cohen). There are more complicated operations on the Floer homology of a cotangent bundle that correspond to the string topology operations on the homology of the loop space of the underlying manifold.
|
|
The five lemma is often applied to long exact sequences: when computing homology or cohomology of a given object, one typically employs a simpler subobject whose homology/cohomology is known, and arrives at a long exact sequence which involves the unknown homology groups of the original object. This alone is often not sufficient to determine the unknown homology groups, but if one can compare the original object and sub object to well- understood ones via morphisms, then a morphism between the respective long exact sequences is induced, and the five lemma can then be used to determine the unknown homology groups.
|
|
In algebraic topology, universal coefficient theorems establish relationships between homology groups (or cohomology groups) with different coefficients. For instance, for every topological space , its integral homology groups: : completely determine its homology groups with coefficients in , for any abelian group : : Here might be the simplicial homology, or more generally the singular homology: the result itself is a pure piece of homological algebra about chain complexes of free abelian groups. The form of the result is that other coefficients may be used, at the cost of using a Tor functor. For example it is common to take to be , so that coefficients are modulo 2.
|
|
In algebraic topology, cubical complexes are often useful for concrete calculations. In particular, there is a definition of homology for cubical complexes that coincides with the singular homology, but is computable.
|
|
In brief, singular homology is constructed by taking maps of the standard n-simplex to a topological space, and composing them into formal sums, called singular chains. The boundary operation - mapping each n-dimensional simplex to its (n−1)-dimensional boundary - induces the singular chain complex. The singular homology is then the homology of the chain complex. The resulting homology groups are the same for all homotopy equivalent spaces, which is the reason for their study.
|
|
The singular homology of a topological space X is defined as the homology of the chain complex of singular chains, that is, finite linear combinations of continuous maps from the simplex to X. The Borel−Moore homology of a reasonable locally compact space X, on the other hand, is isomorphic to the homology of the chain complex of locally finite singular chains. Here "reasonable" means X is locally contractible, σ-compact, and of finite dimension.Glen Bredon. Sheaf theory.
|
|
Suppose that X is homeomorphic to the complement of a closed subcomplex S in a finite CW complex Y. Then Borel–Moore homology H_i^{BM}(X) is isomorphic to the relative homology Hi(Y, S). Under the same assumption on X, the one-point compactification of X is homeomorphic to a finite CW complex. As a result, Borel–Moore homology can be viewed as the relative homology of the one-point compactification with respect to the added point.
|
|
Homology modeling and protein threading are both template-based methods and there is no rigorous boundary between them in terms of prediction techniques. But the protein structures of their targets are different. Homology modeling is for those targets which have homologous proteins with known structure (usually/maybe of same family), while protein threading is for those targets with only fold-level homology found. In other words, homology modeling is for "easier" targets and protein threading is for "harder" targets.
|
|
Homology modeling treats the template in an alignment as a sequence, and only sequence homology is used for prediction. Protein threading treats the template in an alignment as a structure, and both sequence and structure information extracted from the alignment are used for prediction. When there is no significant homology found, protein threading can make a prediction based on the structure information. That also explains why protein threading may be more effective than homology modeling in many cases.
|
|
Morse homology is a particularly easy way to understand the homology of smooth manifolds. It is defined using a generic choice of Morse function and Riemannian metric. The basic theorem is that the resulting homology is an invariant of the manifold (i.e., independent of the function and metric) and isomorphic to the singular homology of the manifold; this implies that the Morse and singular Betti numbers agree and gives an immediate proof of the Morse inequalities.
|
|
The initial motivation is to study the shape of data. TDA has combined algebraic topology and other tools from pure mathematics to allow mathematically rigorous study of "shape". The main tool is persistent homology, an adaptation of homology to point cloud data. Persistent homology has been applied to many types of data across many fields.
|
|
SacI homology domain is a family of evolutionarily related proteins. This Pfam family represents a protein domain which shows homology to the yeast protein SacI . The SacI homology domain is most notably found at the amino terminal of the inositol 5'-phosphatase synaptojanin. Synaptic vesicles are recycled with remarkable speed and precision in nerve terminals.
|
|
A "homology-like" theory satisfying all of the Eilenberg–Steenrod axioms except the dimension axiom is called an extraordinary homology theory (dually, extraordinary cohomology theory). Important examples of these were found in the 1950s, such as topological K-theory and cobordism theory, which are extraordinary cohomology theories, and come with homology theories dual to them.
|
|
In mathematics, in the field of algebraic topology, the Eilenberg–Moore spectral sequence addresses the calculation of the homology groups of a pullback over a fibration. The spectral sequence formulates the calculation from knowledge of the homology of the remaining spaces. Samuel Eilenberg and John C. Moore's original paper addresses this for singular homology.
|
|
Among mammals, the OGA sequence is even more highly conserved. The mouse and the human have 97.8% homology. However, OGA does not share significant homology with other proteins. However, short stretches of about 200 amino acids in OGA have homology with some proteins such as hyaluronidase, a putative acetyltransferase, eukaryotic translation elongation factor-1γ, and the 11-1 polypeptide.
|
|
Instanton Floer homology may be viewed as a generalization of the Casson invariant because the Euler characteristic of Floer homology agrees with the Casson invariant. Soon after Floer's introduction of Floer homology, Donaldson realized that cobordisms induce maps. This was the first instance of the structure that came to be known as a Topological Quantum Field Theory.
|
|
Cabezón obtained his PhD with the thesis "Combinatorial Koszul homology: computations and applications" for which he obtained the grade of outstanding cum laude unanimously of the court. His thesis is framed within the area of computational algebra. In it, the homology of Koszul for monomial ideals is studied. In the thesis, Cabezón described the structure of this type of ideals based on his Koszul homology, described algorithms for the calculation of this homology, and implemented algorithms that show to be effective.
|
|
The first definition of the cyclic homology of a ring A over a field of characteristic zero, denoted :HCn(A) or Hnλ(A), proceeded by the means of an explicit chain complex related to the Hochschild homology complex of A. Connes later found a more categorical approach to cyclic homology using a notion of cyclic object in an abelian category, which is analogous to the notion of simplicial object. In this way, cyclic homology (and cohomology) may be interpreted as a derived functor, which can be explicitly computed by the means of the (b, B)-bicomplex. One of the striking features of cyclic homology is the existence of a long exact sequence connecting Hochschild and cyclic homology. This long exact sequence is referred to as the periodicity sequence.
|
|
Morse theory can be used to prove some strong results on the homology of manifolds. The number of critical points of index γ of f : M → R is equal to the number of γ cells in the CW structure on M obtained from "climbing" f. Using the fact that the alternating sum of the ranks of the homology groups of a topological space is equal to the alternating sum of the ranks of the chain groups from which the homology is computed, then by using the cellular chain groups (see cellular homology) it is clear that the Euler characteristic \chi(M) is equal to the sum :\sum(-1)^\gamma C^\gamma\,=\chi(M) where Cγ is the number of critical points of index γ. Also by cellular homology, the rank of the nth homology group of a CW complex M is less than or equal to the number of n-cells in M. Therefore, the rank of the γth homology group,i.e.
|
|
The others were found by searching for homology, using bioinformatic techniques.
|
|
The long exact sequence of relative homology then gives the theorem.
|
|
Conley index theory formed the basis for development of Floer homology.
|
|
Embedded contact homology has now been proven to be isomorphic to both monopole Floer homology (Kutluhan–Lee–Taubes) and Heegaard Floer homology (Colin–Ghiggini–Honda). Hutchings has also introduced a sequence of symplectic capacities known as ECH capacities, which have applications to embedding problems for Liouville domains. He won a Sloan Research Fellowship in 2003.. He gave an invited talk at the International Congress of Mathematicians in 2010, entitled "Embedded contact homology and its applications". In 2012, he became a fellow of the American Mathematical Society.
|
|
A homology class is thus represented by a cycle which is not the boundary of any submanifold: the cycle represents a hole, namely a hypothetical manifold whose boundary would be that cycle, but which is "not there". There are many different homology theories. A particular type of mathematical object, such as a topological space or a group, may have one or more associated homology theories. When the underlying object has a geometric interpretation as topological spaces do, the nth homology group represents behavior in dimension n.
|
|
Using pseudo-holomorphic curves, and associated a bigraded abelian group, called knot Floer homology, to each isotopy class of knots. The graded Euler characteristic of knot Floer homology is the Alexander polynomial. While the Alexander polynomial gives a lower bound on the genus of a knot, showed that knot Floer homology detects the genus. Similarly, while the Alexander polynomial gives an obstruction to a knot complement fibering over the circle, showed that knot Floer homology completely determines when a knot complement fibers over the circle.
|
|
Waldhausen introduced the idea of a trace map from the algebraic K-theory of a ring to its Hochschild homology; by way of this map, information can be obtained about the K-theory from the Hochschild homology. Bökstedt factorized this trace map, leading to the idea of a functor known as the topological Hochschild homology of the ring's Eilenberg–MacLane spectrum.
|
|
Cobordism had its roots in the (failed) attempt by Henri Poincaré in 1895 to define homology purely in terms of manifolds . Poincaré simultaneously defined both homology and cobordism, which are not the same, in general. See Cobordism as an extraordinary cohomology theory for the relationship between bordism and homology. Bordism was explicitly introduced by Lev Pontryagin in geometric work on manifolds.
|
|
The abelianization of the fundamental group can be identified with the first homology group of the space. A special case of the Hurewicz theorem asserts that the first singular homology group H_1(X) is, colloquially speaking, the closest approximation to the fundamental group by means of an abelian group. In more detail, mapping the homotopy class of each loop to the homology class of the loop gives a group homomorphism :\pi_1(X) \to H_1(X) from the fundamental group of a topological space X to its first singular homology group H_1(X). This homomorphism is not in general an isomorphism since the fundamental group may be non-abelian, but the homology group is, by definition, always abelian.
|
|
Sue Geller has an extensive and largely interdisciplinary research background with a variety of focus areas, including bioinformatics, biostatistics, computational biology, algebraic K-theory, cyclic homology, and mathematics education. Throughout her career as a mathematician, Geller has published over thirty research publications, earning her notability as an accomplished interdisciplinary researcher. Geller's research in the fields of algebraic K-theory, cyclic homology, and Hochschild homology focuses on determining the relationships between K-theory and homology theories and exploiting these relationships to provide algorithms for computing K-theory and cyclic homology. Her algebraic research has been published in a variety of academic journals, as well as presented at the 1983 Summer Research Conference held by the American Mathematical Society (AMS).
|
|
In mathematics, the Thurston norm is a function on the second homology group of an oriented 3-manifold introduced by William Thurston, which measures in a natural way the topological complexity of homology classes represented by surfaces.
|
|
Andreas Floer introduced a type of homology on a 3-manifolds defined in analogy with Morse homology in finite dimensions.Floer, A., 1988. An instanton-invariant for 3-manifolds. Communications in mathematical physics, 118(2), pp. 215–240.
|
|
During meiosis up to one-third of all homology directed repair events occur between sister chromatids. The remaining two-thirds, or more, of homology directed repair occurs as a result of interaction between non-sister homologous chromatids.
|
|
It categorifies the Alexander polynomial. Knot Floer homology was defined by and independently by . It is known to detect knot genus. Using grid diagrams for the Heegaard splittings, knot Floer homology was given a combinatorial construction by .
|
|
Vitamin B6 was named pyridoxine to indicate its structural homology to pyridine.
|
|
The isoforms share 58% homology, but vary in location and catalytic efficiency.
|
|
This latter protein is an evolutionary homology of the picornavirus 3C proteinase.
|
|
This approach to Morse theory was known in some form to René Thom and Stephen Smale. It is also implicit in John Milnor's book on the h-cobordism theorem. From the fact that the Morse homology is isomorphic to the singular homology, the Morse inequalities follow by considering the number of generators -- that is, critical points -- necessary to generate the homology groups of the appropriate ranks (and by considering truncations of the Morse complex, to get the stronger inequalities). The existence of Morse homology "explains", in the sense of categorification, the Morse inequalities.
|
|
However, cylindrical contact homology is not always defined due to the presence of holomorphic discs and a lack of regularity and transversality results. In situations where cylindrical contact homology makes sense, it may be seen as the (slightly modified) Morse homology of the action functional on the free loop space, which sends a loop to the integral of the contact form alpha over the loop. Reeb orbits are the critical points of this functional. SFT also associates a relative invariant of a Legendrian submanifold of a contact manifold known as relative contact homology.
|
|
Most homology groups or modules may be formulated as derived functors on appropriate abelian categories, measuring the failure of a functor to be exact. From this abstract perspective, homology groups are determined by objects of a derived category.
|
|
The first application of Khovanov homology was provided by Jacob Rasmussen, who defined the s-invariant using Khovanov homology. This integer valued invariant of a knot gives a bound on the slice genus, and is sufficient to prove the Milnor conjecture. In 2010, Kronheimer and Mrowka proved that the Khovanov homology detects the unknot. The categorified theory has more information than the non-categorified theory.
|
|
The first algorithm over all fields for persistent homology in algebraic topology setting was described by Barannikov through reduction to the canonical form by upper-triangular matrices. The first algorithm for persistent homology over F_2 was given by Edelsbrunner et al. Zomorodian and Carlsson gave the first practical algorithm to compute persistent homology over all fields. Edelsbrunner and Harer's book gives general guidance on computational topology.
|
|
Topological data analysis and persistent homology have had impacts on Morse theory. Morse theory has played a very important role in the theory of TDA, including on computation. Some work in persistent homology has extended results about Morse functions to tame functions or, even to continuous functions. A forgotten result of R. Deheuvels long before the invention of persistent homology extends Morse theory to all continuous functions.
|
|
In algebraic topology, simplicial homology is the sequence of homology groups of a simplicial complex. It formalizes the idea of the number of holes of a given dimension in the complex. This generalizes the number of connected components (the case of dimension 0). Simplicial homology arose as a way to study topological spaces whose building blocks are n-simplices, the n-dimensional analogs of triangles.
|
|
One description of the types of simple-closed curves that may appear on the surface of the Klein bottle is given by the use of the first homology group of the Klein bottle calculated with integer coefficients. This group is isomorphic to Z×Z2. Up to reversal of orientation, the only homology classes which contain simple-closed curves are as follows: (0,0), (1,0), (1,1), (2,0), (0,1). Up to reversal of the orientation of a simple closed curve, if it lies within one of the two crosscaps that make up the Klein bottle, then it is in homology class (1,0) or (1,1); if it cuts the Klein bottle into two Möbius strips, then it is in homology class (2,0); if it cuts the Klein bottle into an annulus, then it is in homology class (0,1); and if bounds a disk, then it is in homology class (0,0).
|
|
Output alignments include homology information for sequences at internal nodes of the tree.
|
|
Due to the large mammalian homology, ADAM7 is primarily studied in Mus Musculus.
|
|
The independence from A is an analogue of the Excision theorem in homology.
|
|
The Hurewicz theorems are a key link between homotopy groups and homology groups.
|
|
Robins V. Towards computing homology from finite approximations[C]//Topology proceedings. 1999, 24(1): 503-532. Finally, shortly thereafter, Edelsbrunner et al. introduced the concept of persistent homology together with an efficient algorithm and its visualization as a persistence diagram.
|
|
These constructions can be applied to all topological spaces, and so singular homology can be expressed in terms of category theory, where homology is expressible as a functor from the category of topological spaces to the category of graded abelian groups.
|
|
In algebraic topology and category theory, factorization homology is a variant of topological chiral homology, motivated by an application to topological quantum field theory and cobordism hypothesis in particular. It was introduced by David Ayala, John Francis, and Nick Rozenblyum.
|
|
The characterized PTP-like phytases from ruminal bacteria share sequence and structural homology with the mammalian PTP-like phosphoinositide/-inositol phosphatase PTEN, and significant sequence homology to the PTP domain of a type III-secreted virulence protein from Pseudomonas syringae (HopPtoD2).
|
|
Hwp1 of Candida albicans shares similar sequence homology of amino acids with gliadin (α- and γ-gliadins) of gluten protein. This homology appears between fragments of hwp1 sequence and α-gliadin and γ-gliadin T-cell epitopes in celiac disease.
|
|
The simplest case yields invariants of Legendrian knots inside contact three-manifolds. The relative contact homology has been shown to be a strictly more powerful invariant than the "classical invariants", namely Thurston-Bennequin number and rotation number (within a class of smooth knots). Yuri Chekanov developed a purely combinatorial version of relative contact homology for Legendrian knots, i.e. a combinatorially defined invariant that reproduces the results of relative contact homology.
|
|
A closed manifold is called essential if its fundamental class defines a nonzero element in the homology of its fundamental group, or more precisely in the homology of the corresponding Eilenberg–MacLane space. Here the fundamental class is taken in homology with integer coefficients if the manifold is orientable, and in coefficients modulo 2, otherwise. Examples of essential manifolds include aspherical manifolds, real projective spaces, and lens spaces.
|
|
This protein belongs to the Src homology 2-B (SH2B) adapter family. LNK contains 3 functional domains: a C-terminal Src homology 2 (SH2) domain, a pleckstrin homology (PH) domain, and a dimerization domain. The SH2 domain spans approximately 100 amino acid residues and binds phosphotyrosine-containing proteins such as kinases. The PH domain spans approximately 120 amino acid residues and binds the phosphatidylinositol lipids found in the cell membrane.
|
|
The coset space Spin(3) / 2I = S3 / 2I is a spherical 3-manifold called the Poincaré homology sphere. It is an example of a homology sphere, i.e. a 3-manifold whose homology groups are identical to those of a 3-sphere. The fundamental group of the Poincaré sphere is isomorphic to the binary icosahedral group, as the Poincaré sphere is the quotient of a 3-sphere by the binary icosahedral group.
|
|
Circular DNA can be either covalently closed or open. The GSHV genome is very similar to the related hepadnaviruses. Ground squirrel hepatitis is 3311 base pairs in length, making the size indistinguishable from HBV. GSHV has greater nucleotide and amino acid homology with WHV than HBV, with 82% nucleotide and 78% amino acid homology between GSHV and WHV and 55% nucleotide and 46% amino acid homology between GSHV and HBV.
|
|
In Held's view, Quirks, Snake, and Deep Homology form a trilogy on evo-devo.
|
|
Mikhail Khovanov and Lev Rozansky have since defined cohomology theories associated to sln for all n. In 2003, Catharina Stroppel extended Khovanov homology to an invariant of tangles (a categorified version of Reshetikhin-Turaev invariants) which also generalizes to sln for all n. Paul Seidel and Ivan Smith have constructed a singly graded knot homology theory using Lagrangian intersection Floer homology, which they conjecture to be isomorphic to a singly graded version of Khovanov homology. Ciprian Manolescu has since simplified their construction and shown how to recover the Jones polynomial from the chain complex underlying his version of the Seidel- Smith invariant.
|
|
A standard scenario in many computer applications is a collection of points (measurements, dark pixels in a bit map, etc.) in which one wishes to find a topological feature. Homology can serve as a qualitative tool to search for such a feature, since it is readily computable from combinatorial data such as a simplicial complex. However, the data points have to first be triangulated, meaning one replaces the data with a simplicial complex approximation. Computation of persistent homology involves analysis of homology at different resolutions, registering homology classes (holes) that persist as the resolution is changed.
|
|
De Rham showed that all of these approaches were interrelated and that, for a closed, oriented manifold, the Betti numbers derived through simplicial homology were the same Betti numbers as those derived through de Rham cohomology. This was extended in the 1950s, when Samuel Eilenberg and Norman Steenrod generalized this approach. They defined homology and cohomology as functors equipped with natural transformations subject to certain axioms (e.g., a weak equivalence of spaces passes to an isomorphism of homology groups), verified that all existing (co)homology theories satisfied these axioms, and then proved that such an axiomatization uniquely characterized the theory.
|
|
Simplicial homology is defined by a simple recipe for any abstract simplicial complex. It is a remarkable fact that simplicial homology only depends on the associated topological space. As a result, it gives a computable way to distinguish one space from another.
|
|
In practice, when the sequence identity in a sequence sequence alignment is low (i.e. <25%), homology modeling may not produce a significant prediction. In this case, if there is distant homology found for the target, protein threading can generate a good prediction.
|
|
In differential topology, given a family of Morse-Smale functions on a smooth manifold X parameterized by a closed interval I, one can construct a Morse- Smale vector field on X × I whose critical points occur only on the boundary. The Morse differential defines a chain map from the Morse complexes at the boundaries of the family, the continuation map. This can be shown to descend to an isomorphism on Morse homology, proving its invariance of Morse homology of a smooth manifold. Continuation maps were defined by Andreas Floer to prove the invariance of Floer homology in infinite dimensional analogues of the situation described above; in the case of finite-dimensional Morse theory, invariance may be proved by proving that Morse homology is isomorphic to singular homology, which is known to be invariant.
|
|
Heegaard Floer homology is a homology theory whose Euler characteristic is the Alexander polynomial of the knot. It has been proven effective in deducing new results about the classical invariants. Along a different line of study, there is a combinatorially defined cohomology theory of knots called Khovanov homology whose Euler characteristic is the Jones polynomial. This has recently been shown to be useful in obtaining bounds on slice genus whose earlier proofs required gauge theory.
|
|
In mathematics, and especially topology, a Poincaré complex (named after the mathematician Henri Poincaré) is an abstraction of the singular chain complex of a closed, orientable manifold. The singular homology and cohomology groups of a closed, orientable manifold are related by Poincaré duality. Poincaré duality is an isomorphism between homology and cohomology groups. A chain complex is called a Poincaré complex if its homology groups and cohomology groups have the abstract properties of Poincaré duality.
|
|
Some facts about homology groups can be derived directly from the axioms, such as the fact that homotopically equivalent spaces have isomorphic homology groups. The homology of some relatively simple spaces, such as n-spheres, can be calculated directly from the axioms. From this it can be easily shown that the (n − 1)-sphere is not a retract of the n-disk. This is used in a proof of the Brouwer fixed point theorem.
|
|
We start with the commutative ring R (graded so that all elements have degree 0). Then add new variables as above of degree 1 to kill off all elements of the ideal M in the homology. Then keep on adding more and more new variables (possibly an infinite number) to kill off all homology of positive degree. We end up with a supercommutative graded ring with derivation d whose homology is just R/M.
|
|
There is some contention in academia about the evolutionary origin and the proper taxonomy of platypuses. A recent study revealed that four platypus X chromosomes, as well as a Y chromosome, are homologous to some regions on the avian Z chromosome. Specifically, platypus X1 shares homology with the chicken Z chromosome, and both share homology with the human chromosome 9. This homology is important when considering the mechanism of dosage compensation in monotremes.
|
|
In homology theory and algebraic topology, cohomology is a general term for a sequence of abelian groups defined from a co-chain complex. That is, cohomology is defined as the abstract study of cochains, cocycles, and coboundaries. Cohomology can be viewed as a method of assigning algebraic invariants to a topological space that has a more refined algebraic structure than does homology. Cohomology arises from the algebraic dualization of the construction of homology.
|
|
Kenzo is written in Lisp, and in addition to homology it may also be used to generate presentations of homotopy groups of finite simplicial complexes. Gmsh includes a homology solver for finite element meshes, which can generate Cohomology bases directly usable by finite element software.
|
|
A graph has only vertices (0-dimensional elements) and edges (1-dimensional elements). We can generalize the graph to an abstract simplicial complex by adding elements of a higher dimension. Then, the concept of graph homology is generalized by the concept of simplicial homology.
|
|
PSMγ (also known as δ-Toxin) shares some homology with PSMα-3 encoded by S. aureus.
|
|
Using homology theory, the binary cycle space may be generalized to cycle spaces over arbitrary rings.
|
|
Lipoxygenase homology domains 1 is a protein in humans that is encoded by the LOXHD1 gene.
|
|
Such deep homology provided strong evidence for evolution and indicated the paths that evolution had taken.
|
|
This homology suggests that the SAgs evolved through the recombination of two smaller β-strand motifs.
|
|
It is also possible to define Alexander–Spanier homology and Alexander–Spanier cohomology with compact supports .
|
|
One of the most interesting aspects of Khovanov's homology is that its exact sequences are formally similar to those arising in the Floer homology of 3-manifolds. Moreover, it has been used to produce another proof of a result first demonstrated using gauge theory and its cousins: Jacob Rasmussen's new proof of a theorem of Peter Kronheimer and Tomasz Mrowka, formerly known as the Milnor conjecture (see below). There is a spectral sequence relating Khovanov homology with the knot Floer homology of Peter Ozsváth and Zoltán Szabó (Dowlin 2018). This spectral sequence settled an earlier conjecture on the relationship between the two theories (Dunfield et al. 2005).
|
|
Chung SY, Subbiah S. (1996.) A structural explanation for the twilight zone of protein sequence homology. Structure 4: 1123–27. Taken together, these various atomic-position errors are significant and impede the use of homology models for purposes that require atomic- resolution data, such as drug design and protein–protein interaction predictions; even the quaternary structure of a protein may be difficult to predict from homology models of its subunit(s). Nevertheless, homology models can be useful in reaching qualitative conclusions about the biochemistry of the query sequence, especially in formulating hypotheses about why certain residues are conserved, which may in turn lead to experiments to test those hypotheses.
|
|
Floer homology is the homology of this chain complex. The gradient flow line equation, in a situation where Floer's ideas can be successfully applied, is typically a geometrically meaningful and analytically tractable equation. For symplectic Floer homology, the gradient flow equation for a path in the loopspace is (a perturbed version of) the Cauchy–Riemann equation for a map of a cylinder (the total space of the path of loops) to the symplectic manifold of interest; solutions are known as pseudoholomorphic curves. The Gromov compactness theorem is then used to show that the differential is well-defined and squares to zero, so that the Floer homology is defined.
|
|
One of the key ideas in bioinformatics is the notion of homology. In the genomic branch of bioinformatics, homology is used to predict the function of a gene: if the sequence of gene A, whose function is known, is homologous to the sequence of gene B, whose function is unknown, one could infer that B may share A's function. In the structural branch of bioinformatics, homology is used to determine which parts of a protein are important in structure formation and interaction with other proteins. In a technique called homology modeling, this information is used to predict the structure of a protein once the structure of a homologous protein is known.
|
|
CXorf59 is also related to Calponin, a calcium binding protein. In the 324 to 403 base pair region, there is a Calponin homology domain. Calponin homology domains are found in cytoskeletal and signal transduction proteins. They are composed of four alpha helices and are actin-binding.
|
|
Brower, A. V. Z. and V. Schawaroch. 1996. Three steps of homology assessment. Cladistics 12:265-272. As implied in this definition, many cladists consider secondary homology to be synonymous with synapomorphy, a shared derived character or trait state that distinguishes a clade from other organisms.
|
|
In algebraic topology, a branch of mathematics, Moore space is the name given to a particular type of topological space that is the homology analogue of the Eilenberg–Maclane spaces of homotopy theory, in the sense that it has only one nonzero homology (rather than homotopy) group.
|
|
Namely, two simply connected, smooth 5-manifolds are diffeomorphic if and only if there exists an isomorphism of their second homology groups with integer coefficients, preserving the linking form and the second Stiefel–Whitney class. Moreover, any such isomorphism in second homology is induced by some diffeomorphism.
|
|
Shape theory is a branch of topology, which provides a more global view of the topological spaces than homotopy theory. The two coincide on compacta dominated homotopically by finite polyhedra. Shape theory associates with the Čech homology theory while homotopy theory associates with the singular homology theory.
|
|
This is a list of some of the ordinary and generalized (or extraordinary) homology and cohomology theories in algebraic topology that are defined on the categories of CW complexes or spectra. For other sorts of homology theories see the links at the end of this article.
|
|
The three-dimensional homology modeling predicts strong conservation of the tertiary structure between Atlantic salmon and other teleost Leps compared to their mammalian orthologues (Fig. 2). Figure 2. Homology models (created using the SwissProt ProModII homology modeling server) of Atlantic salmon leptins (lepa1, lepa2) compared to the crystallographic structure () of human leptin (LEP). The human leptin structure shows the four anti-parallel α-helices (1, 2, 4, 5) with corresponding domains in the Atlantic salmon proteins.
|
|
A closed manifold M is called essential if its fundamental class [M] defines a nonzero element in the homology of its fundamental group , or more precisely in the homology of the corresponding Eilenberg–MacLane space K(, 1), via the natural homomorphism :H_n(M)\to H_n(K(\pi,1)), where n is the dimension of M. Here the fundamental class is taken in homology with integer coefficients if the manifold is orientable, and in coefficients modulo 2, otherwise.
|
|
Many spaces encountered in topology are constructed by piecing together very simple patches. Carefully choosing the two covering subspaces so that, together with their intersection, they have simpler (co)homology than that of the whole space may allow a complete deduction of the (co)homology of the space. In that respect, the Mayer–Vietoris sequence is analogous to the Seifert–van Kampen theorem for the fundamental group, and a precise relation exists for homology of dimension one.
|
|
Symplectic Floer Homology (SFH) is a homology theory associated to a symplectic manifold and a nondegenerate symplectomorphism of it. If the symplectomorphism is Hamiltonian, the homology arises from studying the symplectic action functional on the (universal cover of the) free loop space of a symplectic manifold. SFH is invariant under Hamiltonian isotopy of the symplectomorphism. Here, nondegeneracy means that 1 is not an eigenvalue of the derivative of the symplectomorphism at any of its fixed points.
|
|
Although the Khovanov homology detects the unknot, it is not yet known if the Jones polynomial does.
|
|
Pleckstrin homology domain containing S1 is a protein that in humans is encoded by the PLEKHS1 gene.
|
|
Pleckstrin homology domain containing A8 is a protein that in humans is encoded by the PLEKHA8 gene.
|
|
Retinoblastoma-binding protein-2 and the human SMCX protein share regions of homology between mice and humans.
|
|
TALENs can be used to edit genomes using non-homologous end joining (NHEJ) and homology directed repair.
|
|
Pleckstrin homology domain containing A4 is a protein that in humans is encoded by the PLEKHA4 gene.
|
|
The Topology ToolKit is specialized for continuous data defined on manifolds of low dimension (1, 2 or 3), as typically found in scientific visualization. Another R package, TDAstats, implements the fast C++ Ripser library to calculate persistent homology. It also uses the ubiquitous ggplot2 package to generate reproducible, customizable, publication-quality visualizations of persistent homology, specifically topological barcodes and persistence diagrams. The sample code below gives an example of how the R programming language can be used to compute persistent homology.
|
|
The group of C. Dekker (Delft University) directly probed the interactions involved in homology search by combining magnetic and optical tweezers. They have found that homology search and recognition requires opening of the helix and can therefore be accelerated by unwinding the DNA. This is exactly the energy barrier predicted by the conformational proofreading model. The data indicate a physical picture for homology recognition in which the fidelity of the search process is governed by the distance between the DNA-binding sites.
|
|
Although the two isozymes (ALDH1 and ALDH2) do not share a common subunit, the homology between the human ALDH1 and ALDH2 proteins is 66% at the coding nucleotide level and 69% at the amino acid level, which is found to be lower than the 91% homology between human ALDH1 and horse ALDH1. Such a finding is consistent with evidence suggesting the early evolutionary divergence between cytosolic and mitochondrial isozymes, as seen in the 50% homology between pig mitochondrial and cytosolic asparatate aminotransferases.
|
|
Following formation of segmental duplications, forces of evolution such as base-pair substitutions, insertions, deletions, and retrotransposition are all possible. It has been suggested that segmental duplications undergo homology- driven mutations. There are two main homology-driven processes that lead to structural alterations. Homology between segmental duplications can initiate NAHR, which occurs from the alignment of highly similar segmental duplications that are followed by paralogous recombination, or through the non-reciprocal transfer of sequence from one segmental duplication copy to another.
|
|
This showed a homology between these simple creatures and mammals, tying them into his controversial chain of life.
|
|
Topological manifestations of this theorem include the Mayer–Vietoris sequence and the long exact sequence for relative homology.
|
|
The C-terminal part thus also shows more homology across the calcin family than the N-terminal part .
|
|
This further shows an immunologically significant sequence homology to the biologically active site of the human acetylcholine receptor.
|
|
Src homology 2 domain containing F is a protein that in humans is encoded by the SHF gene.
|
|
These methods are based upon the fact that proteins can exhibit similar structural identity while lacking sequence homology.
|
|
PAM contains a N-terminal leucine zipper, central MYC-binding, and C-terminal histone-binding protein homology domains.
|
|
In less abstract language, cochains in the fundamental sense should assign 'quantities' to the chains of homology theory.
|
|
In mathematics, Khovanov homology is an oriented link invariant that arises as the homology of a chain complex. It may be regarded as a categorification of the Jones polynomial. It was developed in the late 1990s by Mikhail Khovanov, then at the University of California, Davis, now at Columbia University.
|
|
CED-9 is involved in the inhibition of CED-4 which is the activator of the CED-3 caspase. Because of the pathway homology with humans as well as the specific protein homology, CED-9 has been used to represent the human cell apoptosis interactions of Bcl-2 in research.
|
|
Protein O-GlcNAcases belong to glycoside hydrolase family 84 of the carbohydrate active enzyme classification. Homologs exist in other species as O-GlcNAcase is conserved in higher eukaryotic species. In a pairwise alignment, humans share 55% homology with Drosophilia and 43% with C. elegans. Drosophilia and C. elegans share 43% homology.
|
|
All three contain the Dbl oncogene homology (DH) domain plus Pleckstrin homology (PH) domain (DH/PH domain) characteristic of Rho family GEFs, while only the longer two isoforms also contain the AKAP domain. Therefore, these isoforms may function as scaffolding proteins to coordinate Rho signaling and protein kinase A signaling.
|
|
These methods are based upon the homology of proteins. These methods are also known as comparative modeling. The first step in homology modeling is generally the identification of template sequences of known structure which are homologous to the query sequence. Next the query sequence is aligned to the template sequence.
|
|
This has made the internal nares a case of parallel evolution rather than a homology between lungfish and tetrapods.
|
|
PSMδ is encoded downstream of the PSMα gene in S. epidermidis. In addition PSMδ shares some homology with PSMγ.
|
|
ERK3/MAPK6 was initially cloned from the rat brain cDNA library by homology screening with probes ERK1 derived probe.
|
|
Pleckstrin homology and RhoGEF domain containing G3 is a protein that in humans is encoded by the PLEKHG3 gene.
|
|
HgTX1 is 39 amino acids long and shows an overall amino acid sequence homology of 89% to margatoxin (MgTX).
|
|
In topological data analysis, data sets are regarded as a point cloud sampling of a manifold or algebraic variety embedded in Euclidean space. By linking nearest neighbor points in the cloud into a triangulation, a simplicial approximation of the manifold is created and its simplicial homology may be calculated. Finding techniques to robustly calculate homology using various triangulation strategies over multiple length scales is the topic of persistent homology. In sensor networks, sensors may communicate information via an ad-hoc network that dynamically changes in time.
|
|
To understand the global context of this set of local measurements and communication paths, it is useful to compute the homology of the network topology to evaluate, for instance, holes in coverage. In dynamical systems theory in physics, Poincaré was one of the first to consider the interplay between the invariant manifold of a dynamical system and its topological invariants. Morse theory relates the dynamics of a gradient flow on a manifold to, for example, its homology. Floer homology extended this to infinite-dimensional manifolds.
|
|
In geometric topology, the doughnut and the coffee cup are considered to fall into the same mathematical "genus" because each has one hole. In mathematics, holes are examined in a number of ways. One of these is in homology, which is a general way of associating certain algebraic objects to other mathematical objects such as topological spaces. Homology groups were originally defined in algebraic topology, and homology was originally a rigorous mathematical method for defining and categorizing holes in a mathematical object called a manifold.
|
|
These invariants, initially described using "classical" topological means, were shown by 1994 Fields Medalist Maxim Kontsevich to result from integration, using the Kontsevich integral, of certain algebraic structures (, ). These breakthroughs were followed by the discovery of Khovanov homology and knot Floer homology, which greatly generalize the Jones and Alexander polynomials. These homology theories have contributed to further mainstreaming of knot theory. In the last several decades of the 20th century, scientists and mathematicians began finding applications of knot theory to problems in biology and chemistry.
|
|
The CAPD library (Computer Assisted Proofs in Dynamics) is a software library that aims to provide a set of flexible C++ modules designed for rigorous numerics in Dynamical Systems and homology computation. It has been used in a research of chaotic dynamics, bifurcations, heteroclinic/homoclinic solutions and periodic orbits. The RedHom (Reduction Homology) subproject provides efficient methods for computation of a homology of sets based on geometric and algebraic reductions. The CAPD library is developed at the Faculty of Mathematics and Computer Science at the Jagiellonian University.
|
|
A triangulated torus Another triangulation of the torus A triangulated dolphin shape In mathematics, topology generalizes the notion of triangulation in a natural way as follows: :A triangulation of a topological space X is a simplicial complex K, homeomorphic to X, together with a homeomorphism h: K → X. Triangulation is useful in determining the properties of a topological space. For example, one can compute homology and cohomology groups of a triangulated space using simplicial homology and cohomology theories instead of more complicated homology and cohomology theories.
|
|
Only the strains pertaining to DNA homology group A1 were still designated L. acidophilus. Strains in the homology groups A2, A3, A4, B1 and B2 were proposed to be distinct species and later reclassified as L. crispatus, L. amylovorus, L. gallinarum, L. gasseri and L. johnsonii respectively. In the case of L. crispatus this happened in 1983 as Cato and her coworkers recharacterized strain VPI 3199 and discovered 100% DNA homology with VPI 7635 (ATCC 33197), the type strain of “L. acidophilus” group A2.
|
|
The loop in the smooth fibers gives an element of the first homology group of a surface, and the monodromy of the critical value is defined to be the monodromy of the first homology of the fibers as the loop is traversed, i.e. an invertible map of the first homology of a (real) surface of genus g. A classical result is the Picard–Lefschetz formula,Given in , for Morse functions. detailing how the monodromy round the singular fiber acts on the vanishing cycles, by a shear mapping.
|
|
In mathematics, the Pontryagin product, introduced by , is a product on the homology of a topological space induced by a product on the topological space. Special cases include the Pontryagin product on the homology of an abelian group, the Pontryagin product on an H-space, and the Pontryagin product on a loop space.
|
|
Since the number of homology theories has become large (see :Category:Homology theory), the terms Betti homology and Betti cohomology are sometimes applied (particularly by authors writing on algebraic geometry) to the singular theory, as giving rise to the Betti numbers of the most familiar spaces such as simplicial complexes and closed manifolds.
|
|
The Lagrangian Floer homology of two transversely intersecting Lagrangian submanifolds of a symplectic manifold is the homology of a chain complex generated by the intersection points of the two submanifolds and whose differential counts pseudoholomorphic Whitney discs. Given three Lagrangian submanifolds L0, L1, and L2 of a symplectic manifold, there is a product structure on the Lagrangian Floer homology: :HF(L_0, L_1) \otimes HF(L_1,L_2) \rightarrow HF(L_0,L_2), which is defined by counting holomorphic triangles (that is, holomorphic maps of a triangle whose vertices and edges map to the appropriate intersection points and Lagrangian submanifolds). Papers on this subject are due to Fukaya, Oh, Ono, and Ohta; the recent work on "cluster homology" of Lalonde and Cornea offer a different approach to it. The Floer homology of a pair of Lagrangian submanifolds may not always exist; when it does, it provides an obstruction to isotoping one Lagrangian away from the other using a Hamiltonian isotopy.
|
|
Pleckstrin homology-like domain family B member 2 is a protein that in humans is encoded by the PHLDB2 gene.
|
|
Pleckstrin homology domain-containing family A member 6 is a protein that in humans is encoded by the PLEKHA6 gene.
|
|
Pleckstrin homology domain-containing family A member 1 is a protein that in humans is encoded by the PLEKHA1 gene.
|
|
Pleckstrin homology domain-containing family A member 5 is a protein that in humans is encoded by the PLEKHA5 gene.
|
|
Because of the above example regarding homology, the study of closed model categories is sometimes thought of as homotopical algebra.
|
|
Pleckstrin homology domain-containing family F member 2 is a protein that in humans is encoded by the PLEKHF2 gene.
|
|
Pleckstrin homology domain-containing family B member 2 is a protein that in humans is encoded by the PLEKHB2 gene.
|
|
LIM and calponin homology domains-containing protein 1 is a protein that in humans is encoded by the LIMCH1 gene.
|
|
Antiquitin shares 60% homology with the 26g pea turgor protein, also referred to as ALDH7B1, in the green garden pea.
|
|
Another approach is by Dehn surgery. The Poincaré homology sphere results from +1 surgery on the right-handed trefoil knot.
|
|
Recombination can occur between DNA sequences that contain no sequence homology. This can cause chromosomal translocations, sometimes leading to cancer.
|
|
This gene encodes a protein with src homology domain 3 (SH3) patterns. Mutations in this gene cause familial juvenile nephronophthisis.
|
|
Pleckstrin homology domain-containing family O member 1 is a protein that in humans is encoded by the PLEKHO1 gene.
|
|
The symplectic version of Floer homology figures in a crucial way in the formulation of the homological mirror symmetry conjecture.
|
|
SWISS-MODEL is a structural bioinformatics web-server dedicated to homology modeling of 3D protein structures. Homology modeling is currently the most accurate method to generate reliable three-dimensional protein structure models and is routinely used in many practical applications. Homology (or comparative) modelling methods make use of experimental protein structures ("templates") to build models for evolutionary related proteins ("targets"). Today, SWISS-MODEL consists of three tightly integrated components: (1) The SWISS-MODEL pipeline – a suite of software tools and databases for automated protein structure modelling, (2) The SWISS-MODEL Workspace – a web-based graphical user workbench, (3) The SWISS-MODEL Repository – a continuously updated database of homology models for a set of model organism proteomes of high biomedical interest.
|
|
Seiberg–Witten Floer homology or monopole Floer homology is a homology theory of smooth 3-manifolds (equipped with a spinc structure). It may be viewed as the Morse homology of the Chern-Simons- Dirac functional on U(1) connections on the three-manifold. The associated gradient flow equation corresponds to the Seiberg-Witten equations on the 3-manifold crossed with the real line. Equivalently, the generators of the chain complex are translation-invariant solutions to Seiberg–Witten equations (known as monopoles) on the product of a 3-manifold and the real line, and the differential counts solutions to the Seiberg–Witten equations on the product of a three-manifold and the real line, which are asymptotic to invariant solutions at infinity and negative infinity.
|
|
This is an invariant of contact manifolds and symplectic cobordisms between them, originally due to Yakov Eliashberg, Alexander Givental and Helmut Hofer. The symplectic field theory as well as its subcomplexes, rational symplectic field theory and contact homology, are defined as homologies of differential algebras, which are generated by closed orbits of the Reeb vector field of a chosen contact form. The differential counts certain holomorphic curves in the cylinder over the contact manifold, where the trivial examples are the branched coverings of (trivial) cylinders over closed Reeb orbits. It further includes a linear homology theory, called cylindrical or linearized contact homology (sometimes, by abuse of notation, just contact homology), whose chain groups are vector spaces generated by closed orbits and whose differentials count only holomorphic cylinders.
|
|
The enzyme has a 22% amino acid homology with human prolidase and a 30% homology to E. coli aminopeptidase P.. The enzyme is unstable under harsh conditions, losing its activity in the presence of organic solvents, at elevated temperature, and over long-term storage. Unprotected OPAA enzymes are also vulnerable to inhibition from other enzymes.
|
|
HORMAD1 plays a key role in meiotic progression. Regulates 3 different functions during meiosis. It: # ensures that sufficient numbers of processed DNA double-strand breaks (DSBs) are available for successful homology search by increasing the steady-state numbers of single-stranded DSB ends. # promotes synaptonemal-complex formation independently of its role in homology search.
|
|
This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinases.
|
|
L. sphaericus has five homology groups (I-V), with group II further dividing into subgroups IIA and IIB. Due to the low levels of homology between groups, it has been suggested that each might represent a distinct species, but owing to a lack of research on this topic, all remain designated as L. sphaericus.
|
|
Based on the homology, the disulfide bridges were identified and the structure was elucidated further. A later molecular modelling study from 1998 used the homology between glandular kallikrein from the mouse and batroxobin, which is about 40%, to propose a 3D structure for biologically active batroxobin. To date no definite 3D structure has been proposed.
|
|
He went on to postdoctoral fellowships at the Mathematical Sciences Research Institute and Columbia University, before becoming an assistant professor at Princeton University in 2012. In 2016 he moved to the University of California, Los Angeles. Sarkar's research area is low- dimensional topology, with particular interests in knot theory, Heegaard Floer homology, and Khovanov homology.
|
|
The LAG3 protein, which belongs to immunoglobulin (Ig) superfamily, comprises a 503-amino acid type I transmembrane protein with four extracellular Ig-like domains, designated D1 to D4. When human LAG-3 was cloned in 1990 it was found to have approx. 70% homology with murine LAG3. The homology of pig LAG3 is 78%.
|
|
Homology search refers to the process of searching a sequence database for RNAs that are similar to already known RNA sequences. Any algorithm that is designed for homology search of nucleic acid sequences can be used, e.g., BLAST. However, such algorithms typically are not as sensitive or accurate as algorithms specifically designed for RNA.
|
|
The KAM theorem established that periodic orbits can follow complex trajectories; in particular, they may form braids that can be investigated using Floer homology. In one class of finite element methods, boundary-value problems for differential equations involving the Hodge-Laplace operator may need to be solved on topologically nontrivial domains, for example, in electromagnetic simulations. In these simulations, solution is aided by fixing the cohomology class of the solution based on the chosen boundary conditions and the homology of the domain. FEM domains can be triangulated, from which the simplicial homology can be calculated.
|
|
Spectrum: HQ (Eilenberg–Mac Lane spectrum of the rationals.) Coefficient ring: πn(HQ) = Q if n = 0, 0 otherwise. These are the easiest of all homology theories. The homology groups HQn(X) are often denoted by Hn(X, Q). The homology groups H(X, Q), H(X, R), H(X, C) with rational, real, and complex coefficients are all similar, and are used mainly when torsion is not of interest (or too complicated to work out). The Hodge decomposition writes the complex cohomology of a complex projective variety as a sum of sheaf cohomology groups.
|
|
Pseudogenes are usually characterized by a combination of homology to a known gene and loss of some functionality. That is, although every pseudogene has a DNA sequence that is similar to some functional gene, they are usually unable to produce functional final protein products. Pseudogenes are sometimes difficult to identify and characterize in genomes, because the two requirements of homology and loss of functionality are usually implied through sequence alignments rather than biologically proven. #Homology is implied by sequence identity between the DNA sequences of the pseudogene and parent gene.
|
|
The PCK2 gene encodes the mitochondrial form of PCK and shares a 68% homology in DNA sequence with PCK1 and 70% homology in amino acid sequence with its encoded cytosolic form, PCK1. Moreover, PCK2 shares structural homology with PCK1, indicating that the genes originated from a common ancestor gene. Nonetheless, though both genes possess ten exons and nine introns, the sizes of their introns may differ by ~2 kb, with the largest intron in PCK2 spanning 2.5 kb. Altogether, the total length of the PCK2 gene spans ~10 kb.
|
|
However, Murphy's experiments required expression of RecA and also employed long homology arms. Consequently, the implications for a new DNA engineering technology were not obvious. The Stewart lab showed that these homologous recombination systems mediate efficient recombination of linear DNA molecules flanked by homology sequences as short as 30 base pairs (40-50 base pairs are more efficient) into target DNA sequences in the absence of RecA. Now the homology could be provided by oligonucleotides made to order, and standard recA cloning hosts could be used, greatly expanding the utility of recombineering.
|
|
Bradyrhizobium elkanii is a species of legume-root nodulating, microsymbiotic nitrogen-fixing bacterium originally identified as DNA homology group II strains of B. japonicum . In 1988, it was discovered that only DNA homology group II strains caused a destructive bleaching of leaves, termed scientifically "microsymbiont-induced foliar chlorosis", which was widespread in soybean production fields of the southern United States . Whole cell fatty acid content together with antibiotic resistance profiles were major phenotypic differences that helped establish DNA homology group II strains as a new species, Bradyrhizobium elkanii .
|
|
Thus mPer1 and mPer2 can function as clock components in flies and may have implications concerning the homology of per genes.
|
|
CD96 main ligand is CD155. CD 96 has approximately 20% homology with CD226 and competed for binding to CD155 with CD226.
|
|
The coinvariant terminology and notation are used particularly in group cohomology and group homology, which use the same superscript/subscript convention.
|
|
Cf. Butler, A. B.: Homology and Homoplasty. In: Squire, Larry R. (Ed.): Encyclopedia of Neuroscience, Academic Press, 2009, pp. 1195–1199.
|
|
XendoU has no homology to any known cellular RNase. However, it has sequence similarity with proteins tentatively annotated as serine proteases.
|
|
Also, homology can be equated to synapomorphy, which is what Patterson has done.Forey, Peter et al. 1992. Cladistics,1st ed., p.
|
|
NEDD9-interacting protein with calponin homology and LIM domains is a protein that in humans is encoded by the MICAL1 gene.
|
|
Ras-associated and pleckstrin homology domains-containing protein 1 is a protein that in humans is encoded by the RAPH1 gene.
|
|
BMP10 is categorized as a BMP since it shares a large sequence homology with other BMP's in the TGF-β superfamily.
|
|
This is essential to applications of the theory, including the Brouwer fixed point theorem and the topological invariance of simplicial homology.
|
|
Sometimes, Poincaré space means a homology sphere with non-trivial fundamental group--for instance, the Poincaré dodecahedral space in 3 dimensions.
|
|
Within the 4 bridge groups, there is more structural homology between Pi1 and MTX than with HsTx1, since HsTx1 does not share the same position of cysteine residues responsible for the sulfide bonds in its sequence. These differences in homology could explain the differences in pharmacological activity such as HsTx1 binding with more affinity and specificity to the Kv1.3.
|
|
Using simplicial homology example as a model, one can define a singular homology for any topological space X. A chain complex for X is defined by taking Cn to be the free abelian group (or free module) whose generators are all continuous maps from n-dimensional simplices into X. The homomorphisms ∂n arise from the boundary maps of simplexes.
|
|
The word homology, coined in about 1656, is derived from the Greek ὁμόλογος homologos from ὁμός homos "same" and λόγος logos "relation". Similar biological structures or sequences in different taxa are homologous if they are derived from a common ancestor. Homology thus implies divergent evolution. For example, many insects (such as dragonflies) possess two pairs of flying wings.
|
|
Robert Mark Goresky (born 1950) is a Canadian mathematician who invented intersection homology with Robert MacPherson. He received his Ph.D. from Brown University in 1976. His thesis, titled Geometric Cohomology and Homology of Stratified Objects, was written under the direction of MacPherson. Many of the results in his thesis were published in 1981 by the American Mathematical Society.
|
|
Rosenberg's research was in the area of abstract algebra, including the application of homology to Galois theory and to the theory of quadratic forms. With Gerhard Hochschild and Bertram Kostant, he is one of the namesakes of the Hochschild–Kostant–Rosenberg theorem, which they published in 1962 and which describes the Hochschild homology of some algebras..
|
|
The current function of NAALADL2 is unknown. NAALADL2 shows significant homology to N-acetylated alpha-linked acidic dipeptidase and transferrin receptors. While sharing some homology with the M28B metallopeptidase family, NAALADL2 does not possess favoured amino acids at certain key positions that are highly conserved, and important for metallopeptidase function, which may imply it is catalytically inactive.
|
|
Smad proteins contain two conserved domains. The Mad Homology domain 1 (MH1 domain) is at the N-terminal and the Mad Homology domain 2 (MH2 domain) is at the C-terminal. Between them there is a linker region which is full of regulatory sites. The MH1 domain has DNA binding activity while the MH2 domain has transcriptional activity.
|
|
In differential topology, a branch of mathematics, a stratifold is a generalization of a differentiable manifold where certain kinds of singularities are allowed. More specifically a stratifold is stratified into differentiable manifolds of (possibly) different dimensions. Stratifolds can be used to construct new homology theories. For example, they provide a new geometric model for ordinary homology.
|
|
This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation.
|
|
This becomes straightforward in the absence of 2-torsion in the homology. Quite generally, the result indicates the relationship that holds between the Betti numbers of and the Betti numbers with coefficients in a field . These can differ, but only when the characteristic of is a prime number for which there is some -torsion in the homology.
|
|
FLICE-associated huge protein. Contains a similar domain to DED, but the homology is very weak and its function is still unclear.
|
|
U2AF homology motif (UHM) kinase 1, also known as UHMK1, is a protein which in humans is encoded by the UHMK1 gene.
|
|
In eukaryotes like Tetrahymena, tetrahymanol is instead synthesized directly from squalene by a cyclase with no homology to the bacterial tetrahymanol synthase.
|
|
MEX3 proteins contain two N-terminal heterogeneous nuclear ribonucleoprotein K homology motifs ( KH domain ) and a RING domain at the C-terminus.
|
|
Ng computed the linearized contact homology in this case, providing an entirely combinatorial model for it which is a powerful knot invariant.
|
|
KaiC's key role in circadian control and homology to RecA suggest its individual evolution before its presence in the KaiABC gene cluster.
|
|
Spectrum: H (Eilenberg–MacLane spectrum of the integers.) Coefficient ring: πn(H) = Z if n = 0, 0 otherwise. The original homology theory.
|
|
PLEKHA7 (Pleckstrin homology domain-containing family A member 7) is an adherens junction (AJ) protein, involved in the junction's integrity and stability.
|
|
This shows that two homotopic maps induce the same map on singular homology. The name "chain homotopy" is motivated by this example.
|
|
The epsin N-terminal homology (ENTH) domain is a structural domain that is found in proteins involved in endocytosis and cytoskeletal machinery.
|
|
Embedded contact homology is an extension due to Michael Hutchings of this work to noncompact four-manifolds of the form Y \times \R, where Y is a compact contact 3-manifold. ECH is a symplectic field theory-like invariant; namely, it is the homology of a chain complex generated by certain combinations of Reeb orbits of a contact form on Y, and whose differential counts certain embedded pseudoholomorphic curves and multiply covered pseudoholomorphic cylinders with "ECH index" 1 in Y \times \R. The ECH index is a version of Taubes's index for the cylindrical case, and again, the curves are pseudoholomorphic with respect to a suitable almost complex structure. The result is a topological invariant of Y, which Taubes proved is isomorphic to monopole Floer homology, a version of Seiberg–Witten homology for Y.
|
|
Within these two viruses is a sequence homology of 95%. In 2012, HHV-6A and HHV-6B were officially recognized as distinct species.
|
|
Patterson, C. 1982. Morphological characters and homology. Pp. 21-74 in K. A. Joysey, and A. E. Friday, eds. Problems of Phylogenetic Reconstruction.
|
|
In particular, it is ring-isomorphic to symplectic Floer homology. Throughout this article, X is a closed symplectic manifold with symplectic form ω.
|
|
There are several ways to define Borel−Moore homology. They all coincide for reasonable spaces such as manifolds and locally finite CW complexes.
|
|
The protein structure contains a C-terminal Myb motif, a dimerization domain (TERF homology) near its N-terminus and an acidic N-terminus.
|
|
Bott's original proof used Morse theory, which had used earlier to study the homology of Lie groups. Many different proofs have been given.
|
|
Dcr3 was identified in 1998 by the search of genes with homology to the TNFR gene superfamily in expressed sequence tag (EST) database.
|
|
For instanton Floer homology, the gradient flow equations is exactly the Yang-Mills equation on the three-manifold crossed with the real line.
|
|
A morphism of chain complexes induces a morphism H_\bullet(F) of their homology groups, consisting of the homomorphisms H_n(F) : H_n(C) \to H_n(D) for all n. A morphism F is called a quasi-isomorphism if it induces an isomorphism on the nth homology for all n. Many constructions of chain complexes arising in algebra and geometry, including singular homology, have the following functoriality property: if two objects X and Y are connected by a map f, then the associated chain complexes are connected by a morphism F=C(f) : C_\bullet(X) \to C_\bullet(Y), and moreover, the composition g\circ f of maps f: X -> Y and g: Y -> Z induces the morphism C(g\circ f): C_\bullet(X) \to C_\bullet(Z) that coincides with the composition C(g) \circ C(f). It follows that the homology groups H_\bullet(C) are functorial as well, so that morphisms between algebraic or topological objects give rise to compatible maps between their homology.
|
|
Domain structure of Janus kinases, JH = JAK homology domain JAKs range from 120-140 kDa in size and have seven defined regions of homology called Janus homology domains 1 to 7 (JH1-7). JH1 is the kinase domain important for the enzymatic activity of the JAK and contains typical features of a tyrosine kinase such as conserved tyrosines necessary for JAK activation (e.g. Y1038/Y1039 in JAK1, Y1007/Y1008 in JAK2, Y980/Y981 in JAK3, and Y1054/Y1055 in Tyk2). Phosphorylation of these dual tyrosines leads to the conformational changes in the JAK protein to facilitate binding of substrate.
|
|
By using sequenced data, one is able to screen based on homology alone. A function-based approach thus allows for discovery of novel enzymes whose functions would not have been predicted based on DNA sequence alone. Therefore, while sequencing is less labour-intensive experimentally, it can also lead to missed genes of interest due to differing sequence homology in genes of related function.
|
|
If L is the Lie algebra of (infinite) matrices over an associative R-algebra A then Leibniz homology of L is the tensor algebra over the Hochschild homology of A. A Zinbiel algebra is the Koszul dual concept to a Leibniz algebra. It has defining identity: : ( a \circ b ) \circ c = a \circ (b \circ c) + a \circ (c \circ b) .
|
|
For example another non-classical MHC class I CD1 is missing in certain species. There is 90% protein homology of the MR1 binding site within mice and human. MR1 shares greater homology with classical MHC I class than with non-classical MHC class I. Human MR1 protein has 341 amino acid residues with a molecular weight of 39 366 Daltons.
|
|
The multiplicative structure of an H-space adds structure to its homology and cohomology groups. For example, the cohomology ring of a path-connected H-space with finitely generated and free cohomology groups is a Hopf algebra. Also, one can define the Pontryagin product on the homology groups of an H-space. The fundamental group of an H-space is abelian.
|
|
Two chain homotopic maps f and g induce the same maps on homology because (f − g) sends cycles to boundaries, which are zero in homology. In particular a homotopy equivalence is a quasi- isomorphism. (The converse is false in general.) This shows that there is a canonical functor K(A) \rightarrow D(A) to the derived category (if A is abelian).
|
|
Currently, there are three ways to detect paralogs in a known genomic sequence: simple homology (FASTA), gene family evolution (TreeFam) and orthology (eggNOG v3). Since the Human Genome Project's completion, researchers are able to annotate the human genome much more easily. Using online databases like the Genome Browser at UCSC, researchers can look for homology in the sequence of their gene of interest.
|
|
The protein encoded by this gene shares significant homology to the adenomatous polyposis coli (APC) protein-binding EB1 gene family. The function of this protein is unknown; however, its homology suggests involvement in tumorigenesis of colorectal cancers and proliferative control of normal cells. This gene may belong to the intermediate/early gene family, involved in the signal transduction cascade downstream of the TCR.
|
|
In 3-dimensional topology, a part of the mathematical field of geometric topology, the Casson invariant is an integer-valued invariant of oriented integral homology 3-spheres, introduced by Andrew Casson. Kevin Walker (1992) found an extension to rational homology 3-spheres, called the Casson–Walker invariant, and Christine Lescop (1995) extended the invariant to all closed oriented 3-manifolds.
|
|
Moreover, APETx1 has 54% sequence homology with BDS1, which is also produced by sea anemones and targets voltage-gated potassium channels as well. Furthermore, the secondary structure of APETx1 is similar to that of BDS1, yet differs by at least one beta-turn. The scorpion venom ErgTx also targets the hERG channel. However, ErgTx has only a 20% sequence homology with APETx1.
|
|
The three dimensional structure of mEH has been elucidated from Aspergillus niger. Although no 3D modeling has been solved for the mammalian mEH enzyme (EPHX1), the overall homology between fungal and mammalian mEH is relatively high. This high homology has allowed for the elucidation overall general structure and subsequent catalytic mechanism of EPHX1 in humans by comparisons to existing structures of fungal mEH.
|
|
The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt lymphoma cell lines, it is tyrosine phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to Shc/Grb2.
|
|
There is a novel gene, IRIZIO that cooperates with PAX3-FOXO1 fusion gene and may contribute to rhabdomyosarcomagenesis in children. This novel gene is homologous to the FAM193 A using the National Center for Biotechnology Information Basic Local Alignment Search Tool revealed an overall homology of 53%. Furthermore, the highest similarity is in the last 76 amino acids (89% homology) of both proteins.
|
|
The final classification of this virus has yet to be decided. It has a low level of homology to the Circovirus chicken anemia virus.
|
|
String topology, a branch of mathematics, is the study of algebraic structures on the homology of free loop spaces. The field was started by .
|
|
However, the innervation shows that the homology is limited: The eyes of Onychophora form behind the antenna, whereas the opposite is true in arthropods.
|
|
Pleckstrin homology domain-containing family M member 1 also known as PLEKHM1 is a protein that in humans is encoded by the PLEKHM1 gene.
|
|
ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action.
|
|
This duplication either inserts the genetic material in the same orientation or opposite of the original parental segments as it is non- homology driven.
|
|
He received in 1983 his Ph.D from Brown University under Robert MacPherson with thesis The Intersection Homology D-module on Hypersurfaces with Isolated Singularities.
|
|
"Two Splits Between Human and Chimp Lines Suggested", The New York Times, 18 May 2006. For a chromosomal homology map between these species see.
|
|
A reconstruction of a Panderichthys. Two ideas about the homology of arms, hands, and digits exist. (1) Digits are unique to tetrapods.Holmgren N. (1933).
|
|
That such a significant degree of structural conservation is observed without sequence homology further underpins the significance of these structural solutions to replication challenges.
|
|
This path independence is very useful in contour integration. This theorem also underlies the duality between de Rham cohomology and the homology of chains.
|
|
Journal of Evolutionary Biology 15:899–910. Constraint has played an important role in the development of such ideas as homology and body plans.
|
|
The proof of the excision theorem is quite intuitive, though the details are rather involved. The idea is to subdivide the simplices in a relative cycle in (X, A) to get another chain consisting of "smaller" simplices, and continuing the process until each simplex in the chain lies entirely in the interior of A or the interior of X \setminus U. Since these form an open cover for X and simplices are compact, we can eventually do this in a finite number of steps. This process leaves the original homology class of the chain unchanged (this says the subdivision operator is chain homotopic to the identity map on homology). In the relative homology H_n(X, A), then, this says all the terms contained entirely in the interior of U can be dropped without affecting the homology class of the cycle.
|
|
Bourbaki and Algebraic Topology by John McCleary (PDF) gives documentation (translated into English from French originals). Algebraic homology remains the primary method of classifying manifolds.
|
|
This protein domain shares sequence homology with the C-terminal domain of GatB and GatE, the tRNA-binding subunits of bacterial and archaeal glutamine amidotransferases.
|
|
It has since been known as Corynascus heterothallicus, which has been observed through phylogenetic analysis to bear very strong DNA sequence homology to M. thermophila.
|
|
The group homology of the hyperoctahedral group is similar to that of the symmetric group, and exhibits stabilization, in the sense of stable homotopy theory.
|
|
Finally, it also became known as Gadd-related protein 17 during its isolation from a cDNA library by Suzuki due to its homology with Gadd45.
|
|
The terms median apophysis and conductor are used to name tegular apophyses to extend the implied homology beyond gnaphosid spiders, to include other spider groups.
|
|
Some attempts is to lose the stricter restriction of the function. Please refer to the Categorification and cosheaves and Impact on mathematics sections for more information. It's natural to extend persistence homology to other basic concepts in algebraic topology, such as cohomology and relative homology/cohomology. An interesting application is the computation of circular coordinates for a data set via the first persistent cohomology group.
|
|
The N-terminal domains of intimin from A/E lesion forming pathogens have high homology with each other and to invasin from Yersinia pseudotuberculosis and Yersinia enterocolitica, whereas the C-terminal domains show less homology. Antibodies to intimin are present in: # Immune colostrum from mothers in EPEC endemic areas # The serum of EPEC/EHEC infected children and EPEC infected volunteers # Secretions of Citrobacter rodentium infected mice.
|
|
In mathematics, the Landweber exact functor theorem, named after Peter Landweber, is a theorem in algebraic topology. It is known that a complex orientation of a homology theory leads to a formal group law. The Landweber exact functor theorem (or LEFT for short) can be seen as a method to reverse this process: it constructs a homology theory out of a formal group law.
|
|
The human Nfe2l3 gene encodes a 694 amino acid residue sequence. From bioinformatic analysis, it has been observed that the NRF3 protein shows a high degree of conservation through its evolutionary pathway from zebrafish to humans. Key conserved domains such as N-terminal homology box 1 (NHB1), N-terminal homology box 2 (NHB2), and the CNC domain allude to the conserved functional properties of this transcription factor.
|
|
Serial homology is a special type of homology, defined by Owen as "representative or repetitive relation in the segments of the same organism."R:Webster 1913 in Webster’s Revised Unabridged Dictionary, G. & C. Merriam, 1913 Ernst Haeckel preferred the term "homotypy" for the same phenomenon. Classical examples of serial homologies are the development of forelimbs and hind limbs of tetrapods and the iterative structure of the vertebrae.
|
|
The overall organization of MTA3 protein domains is similar to the other two family members with a BAH (Bromo-Adjacent Homology), an ELM2 (egl-27 and MTA1 homology), a SANT (SWI, ADA2, N-CoR, TFIIIB-B), a GATA-like zinc finger, and one predicted bipartite nuclear localization signal (NLS). The SH3 motif of Mta3 allows it to interact with Fyn and Grb2 – both SH3 containing signaling proteins.
|
|
A homology domain is generally longer than motifs. The domain may include all of a given protein sequence or only a portion of the sequence. Some domains are complex and made up of several smaller homology domains that became joined to form a larger one during evolution. A domain that covers an entire sequence is called the homeomorphic domain by PIR (Protein Information Resource).
|
|
Subsequent analysis revealed that NFAT5 is a member of the Rel family, which also consists of NF-κB and NFATc proteins. The largest Rel protein, it consists of nearly 1,500 amino acid residues. Like the other Rel proteins, NFAT5 contains the Rel homology domain, a conserved DNA-binding domain. Outside of the Rel homology domain, no similarities exist between NFAT5 and NF-κB or NFATc.
|
|
The last genus is Avibirnavirus, which contains infectious bursal disease virus (IBDV). All of these genera contain homology in three specific areas of their transcripts. The homology comes from the amino and carboxyl regions of preVP2, a small 21-residue-long domain near the carboxyl terminal of VP3, and similar small ORFs sequences. DXV was named after Drosophila melanogaster, where it was first isolated.
|
|
It immediately follows that f and g induce the same map on homology. One says f and g are chain homotopic (or simply homotopic), and this property defines an equivalence relation between chain maps. Let X and Y be topological spaces. In the case of singular homology, a homotopy between continuous maps induces a chain homotopy between the chain maps corresponding to f and g.
|
|
A specific problem area is homology modeling of proteins. Meanwhile, alternative empirical scoring functions have been developed for ligand docking, protein folding, homology model refinement, computational protein design, and modeling of proteins in membranes. It was also argued that some protein force fields operate with energies that are irrelevant to protein folding or ligand binding. The parameters of proteins force fields reproduce the enthalpy of sublimation, i.e.
|
|
FH1/FH2 domain-containing protein 1 is a protein that in humans is encoded by the FHOD1 gene. This gene encodes a protein which is a member of the formin/diaphanous family of proteins. The gene is ubiquitously expressed but is found in abundance in the spleen. The encoded protein has sequence homology to diaphanous and formin proteins within the Formin Homology (FH)1 and FH2 domains.
|
|
The manifold can be constructed by first plumbing together disc bundles of Euler number 2 over the sphere, according to the Dynkin diagram for E_8. This results in P_{E_8}, a 4-manifold with boundary equal to the Poincaré homology sphere. Freedman's theorem on fake 4-balls then says we can cap off this homology sphere with a fake 4-ball to obtain the E_8 manifold.
|
|
In topology, a branch of mathematics, intersection homology is an analogue of singular homology especially well-suited for the study of singular spaces, discovered by Mark Goresky and Robert MacPherson in the fall of 1974 and developed by them over the next few years. Intersection cohomology was used to prove the Kazhdan–Lusztig conjectures and the Riemann–Hilbert correspondence. It is closely related to L2 cohomology.
|
|
A protein superfamily is the largest grouping (clade) of proteins for which common ancestry can be inferred (see homology). Usually this common ancestry is inferred from structural alignment and mechanistic similarity, even if no sequence similarity is evident. Sequence homology can then be deduced even if not apparent (due to low sequence similarity). Superfamilies typically contain several protein families which show sequence similarity within each family.
|
|
As a consequence of the Mayer-Vietoris sequence, the value of an excisive functor on a space X only depends on its value on 'small' subspaces of X, together with the knowledge how these small subspaces intersect. In a cycle representation of the associated homology theory, this means that all cycles must be representable by small cycles. For instance, for singular homology, the excision property is proved by subdivision of simplices, obtaining sums of small simplices representing arbitrary homology classes. In this spirit, for certain homotopy-invariant functors which are not excisive, the corresponding excisive theory may be constructed by imposing 'control conditions', leading to the field of controlled topology.
|
|
Homology theory can be said to start with the Euler polyhedron formula, or Euler characteristic. This was followed by Riemann's definition of genus and n-fold connectedness numerical invariants in 1857 and Betti's proof in 1871 of the independence of "homology numbers" from the choice of basis. Homology itself was developed as a way to analyse and classify manifolds according to their cycles – closed loops (or more generally submanifolds) that can be drawn on a given n dimensional manifold but not continuously deformed into each other. These cycles are also sometimes thought of as cuts which can be glued back together, or as zippers which can be fastened and unfastened.
|
|
Arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 2 is a protein that in humans is encoded by the ASAP2 gene. This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo.
|
|
Edward Witten came up with a related construction in the early 1980s sometimes known as Morse–Witten theory. Morse homology can be extended to finite-dimensional non-compact or infinite-dimensional manifolds where the index remains finite, the metric is complete and the function satisfies the Palais–Smale compactness condition, such as the energy functional for geodesics on a Riemannian manifold. The generalization to situations in which both index and coindex are infinite, but the relative index of any pair of critical points is finite, is known as Floer homology. Sergei Novikov generalized this construction to a homology theory associated to a closed one-form on a manifold.
|
|
The various flavors of contact homology depend a priori on the choice of a contact form, and construct algebraic structures the closed trajectories of their Reeb vector fields; however, these algebraic structures turn out to be independent of the contact form, i.e. they are invariants of the underlying contact structure, so that in the end, the contact form may be seen as an auxiliary choice. In the case of embedded contact homology, one obtains an invariant of the underlying three-manifold, i.e. the embedded contact homology is independent of contact structure; this allows one to obtain results that hold for any Reeb vector field on the manifold.
|
|
The conserved domains of MTA1 include a BAH (Bromo-Adjacent Homology), an ELM2 (egl-27 and MTA1 homology), a SANT (SWI, ADA2, N-CoR, TFIIIB-B) and a GATA-like zinc finger. The C-terminal divergent region of MTA1 has an Src homology 3-binding domain, acidic regions, and nuclear localization signals. The presence of these domains revealed the role of MTA1 in interactions with modified or unmodified histone and non-histone proteins, chromatin remodeling, and modulation of gene transcription. MTA1 undergoes multiple post-translation modifications: acetylation on lysine 626, ubiquitination on lysine 182 and lysine 626, sumoylation on lysine 509, and methylation on lysine 532.
|
|
Homologous pairing of chromosomes involved using DNA strands that are highly similar to each other (~97%) and these strands must be longer than a certain length to avoid short but highly similar pairings. Non-homologous pairings, on the other hand, rely on only few base pairs of similarity between two strands, therefore it is possible for genetic materials to be exchanged or duplicated in the process of non-homologous based double stranded repairs. One type of non-homologous based mechanism is the non-homologous end joining or micro- homology end joining mechanism. These mechanisms are also involved in repairing double stranded breaks but require no homology or limited micro- homology.
|
|
Epo-R, Tpo-R, GH-R, PRL-R). The distinguishing feature between janus kinase 2 and other JAK kinases is the lack of Src homology binding domains (SH2/SH3) and the presence of up to seven JAK homology domains (JH1-JH7). Nonetheless the terminal JH domains retain a high level of homology to tyrosine kinase domains. An interesting note is that only one of these carboxy-terminal JH domains retains full kinase function (JH1) while the other (JH2), previously thought to have no kinase functionality and accordingly termed a pseudokinase domain, has since been found to be catalytically active, albeit at only 10% that of the JH1 domain.
|
|
Given any chain complex, its homology can therefore be thought of as a measure of the degree to which it fails to be exact. If we take a series of short exact sequences linked by chain complexes (that is, a short exact sequence of chain complexes, or from another point of view, a chain complex of short exact sequences), then we can derive from this a long exact sequence (i.e. an exact sequence indexed by the natural numbers) on homology by application of the zig-zag lemma. It comes up in algebraic topology in the study of relative homology; the Mayer–Vietoris sequence is another example.
|
|
A resolution of singularities :f:X\to Y of a complex variety Y is called a small resolution if for every r > 0, the space of points of Y where the fiber has dimension r is of codimension greater than 2r. Roughly speaking, this means that most fibers are small. In this case the morphism induces an isomorphism from the (intersection) homology of X to the intersection homology of Y (with the middle perversity). There is a variety with two different small resolutions that have different ring structures on their cohomology, showing that there is in general no natural ring structure on intersection (co)homology.
|
|
Zaïre (Kinshasa)Sect. Math.-Phys. 3 (1977), no. 1, 61–63. ____________"Homology of a differential algebra". Publ. Math. Debrecen 23 (1976), no. 3-4, 235—237.
|
|
From this, it follows that the relative homology and homotopy groups of Y in X are concentrated in degrees n and higher, which yields the theorem.
|
|
Symplectic field theory provides invariants of Legendrian submanifolds called relative contact homology that can sometimes distinguish distinct Legendrian submanifolds that are topologically identical (i.e. smoothly isotopic).
|
|
The developmental genetics of homology. Nature Rev. Genetics 8:473-479. together with Louise Roth at Duke University and Gerd Müller at the University of Vienna.
|
|
In algebraic topology, a phantom map is a map between spectra such that the induced map between homology theories is zero. Phantom maps were introduced by .
|
|
Mathematische Annalen, vol. 327 (2003), no. 3, pp. 545–573.James Conant, and Karen Vogtmann, Morita classes in the homology of automorphism groups of free groups.
|
|
They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Alternative splicing of this gene results in two transcript variants.
|
|
Cytohesin-1 formerly known as Pleckstrin homology, Sec7 and coiled/coil domains 1 (PSCD1) is a protein that in humans is encoded by the CYTH1 gene.
|
|
The two enzymes are homodimeric and show close homology. GOT2 has been seen to have a role in cell proliferation, especially in terms of tumor growth.
|
|
Tibroviruses are highly divergent. For example, overall amino acid homology among the human-associated tibroviruses (i.e. BASV, EKV-1 and EKV-2) ranges from 33% - 39%.
|
|
The protein strand then loops back towards the GTPase domain and terminates with a Proline Rich Domain that binds to the Src Homology domains of many proteins.
|
|
Although not consistently expressed, BCAS1 is a candidate oncogene. It is predicted to encode a protein of 584 amino acids with no significant homology to other proteins.
|
|
Homology modeling is a computational method to build tertiary structures from amino-acid sequences. The so-called H3-rules are empirical rules to build models of CDR3.
|
|
In mammals, the sequences of these cytokines are highly conserved. For instance, the sequence homology between the corresponding human and mouse proteins is usually between 62–88%.
|
|
Acta Biotheoretica 31A, p. 45.Rutishauser, R.; Moline, P. 2005. Evo-devo and the search for homology ("sameness") in biological systems. Theory in Biosciences 124: 213-241.
|
|
In the 1990s ReznikovA. Reznikov, Three-manifolds class field theory (Homology of coverings for a nonvirtually b1-positive manifold), Sel. math. New ser. 3, (1997), 361–399.
|
|
Small, helper viruses known as satellite RNA have been found to co-infect plants only in the presence of TCV. These non-coding RNAs up-regulate the symptoms of TCV infection. The satellite RNA are dependent of the TCV and host machinery to propagate. Satellite C shares sequence homology with the 3'end of the TCV, while satellite D shares sequence homology with the 5'end of satellite C.
|
|
Male and female reproductive organs are homologous if they develop from the same embryonic tissue, as do the ovaries and testicles of mammals including humans. Sequence homology between protein or DNA sequences is similarly defined in terms of shared ancestry. Two segments of DNA can have shared ancestry because of either a speciation event (orthologs) or a duplication event (paralogs). Homology among proteins or DNA is inferred from their sequence similarity.
|
|
For a subspace A\subset X, the relative homology Hn(X, A) is understood to be the homology of the quotient of the chain complexes, that is, :H_n(X,A)=H_n(C_\bullet(X)/C_\bullet(A)) where the quotient of chain complexes is given by the short exact sequence :0\to C_\bullet(A) \to C_\bullet(X) \to C_\bullet(X)/C_\bullet(A) \to 0.
|
|
The conserved Fe3+ is stabilised in the ferric form, whereas M may undergo reduction. Upon treatment with mild reductants, PAPs are converted to their enzymatically active, pink form. Treatment with strong reducing agents dissociates the metallic ions, and renders the enzyme colourless and inactive. PAPs are highly conserved within eukaryotic species, with >80% amino acid homology in mammalian PAPs, and >70% sequence homology in PAPs of plant origin.
|
|
In commutative algebra, André–Quillen cohomology is a theory of cohomology for commutative rings which is closely related to the cotangent complex. The first three cohomology groups were introduced by and are sometimes called Lichtenbaum–Schlessinger functors T0, T1, T2, and the higher groups were defined independently by Michel André and by Daniel Quillen using methods of homotopy theory. It comes with a parallel homology theory called André–Quillen homology.
|
|
In mathematics, the Atiyah–Jones conjecture is a conjecture about the homology of the moduli spaces of instantons. The original form of the conjecture considered instantons over a 4 dimensional sphere. It was introduced by and proved by . The more general version of the Atiyah–Jones conjecture is a question about the homology of the moduli spaces of instantons on any 4 dimensional real manifold, or on a complex surface.
|
|
To the reference, the members of the IL-17 family do not exhibit a significant sequence homology with other cytokines. Among IL-17 family members, the IL-17F isoforms 1 and 2 (ML-1) have the highest sequence homology with IL-17A (55 and 40%, respectively). They follow by IL-17B, which has 29% similarity to IL-17A, IL-17D (25%), IL-17C (23%), and IL-17E (17%).
|
|
The 900 kb gene for utrophin is found on the long arm of human chromosome 6. Utrophin was discovered due to its homology with dystrophin. It was found by screening a peptide containing the C-terminal domain of dystrophin against cDNA libraries. The homology varies over its full length from less than 30% in regions of the central rod structural domain to 85% (identity 73%) for the actin binding domain.
|
|
The protein encoded by this gene is a human guanine nucleotide releasing protein for Ras protein. It belongs to the adaptor-type Src homology (SH)2-containing molecules. Src homology 2 domains are globular protein modules present in a large variety of functionally distinct proteins. They mediate binding events that control the activity and localization of many proteins involved in the transmission of signals from the cell surface to the nucleus.
|
|
Arabidopsis cystathionine beta-lyase possesses 22% homology with its Escherichia coli counterpart and even higher homology (between 28% to 36%) with cystathionine λ-synthase from plant and bacterial sources and cystathionine λ-lyase from Saccharomyces cerevisiae. All of these enzymes are involved in the Cys/Met biosynthetic pathway and belong to the same class of PLP-dependent enzymes, suggesting that these enzymes were derived from a common ancestor.
|
|
IL-38 is probably originated from a common ancestral gene - an ancient IL-1Ra gene. This cytokine has 41% homology with IL-1Ra and 43% homology with IL-36Ra. IL-38 is expressed in skin, spleen, tonsil, thymus, heart, placenta and fetal liver. In tissues which do not play a special role in immune response, IL-38 is expressed in low quantity as other members of IL-1 family.
|
|
In comparative genomics, for example, it is necessary to compare huge chromosomes such as those found in the human genome. However, the immense expansion of genomic data introduces a predicament in the available methods of carrying out homology searches. For instance, enlarging the seed size lowers sensitivity while reducing seed size reduces the speed of calculations. Several sequence alignment programs have been developed to determine homology between genes.
|
|
Bjerring, H. C. (1995). The question of a homology between the reptilian processus basipterygoideus and the mammalian processus alaris. Palaeontographica (A), 235, 79-96.Bjerring, H. C. (2000).
|
|
Threading and homology modeling methods can build a 3-D model for a protein of unknown structure from experimental structures of evolutionarily-related proteins, called a protein family.
|
|
TIAM1 is tightly associate with BAIAP2 as a subunit. It contains one DH (DBL-homology) domain, one PDZ domain, two PH domains and one Ras-binding RBD domain.
|
|
The attempt to classify the objects of this category (up to homeomorphism) by invariants has motivated areas of research, such as homotopy theory, homology theory, and K-theory.
|
|
Bromo adjacent homology domain containing 1 (BAHD1) is a protein that in humans is encoded by the BAHD1 gene. BAHD1 is involved in heterochromatin formation and transcriptional repression.
|
|
The cycle space of a graph may be interpreted using the theory of homology as the homology group H_1(G,\Z_2) of a simplicial complex with a point for each vertex of the graph and a line segment for each edge of the graph. This construction may be generalized to the homology group H_1(G,R) over an arbitrary ring R. An important special case is the ring of integers, for which the homology group H_1(G,\Z) is a free abelian group, a subgroup of the free abelian group generated by the edges of the graph. Less abstractly, this group can be constructed by assigning an arbitrary orientation to the edges of the given graph; then the elements of H_1(G,\Z) are labelings of the edges of the graph by integers with the property that, at each vertex, the sum of the incoming edge labels equals the sum of the outgoing edge labels. The group operation is addition of these vectors of labels.
|
|
Next, we construct the `normalised' complex C(D) = [D][−n−]{n+ − 2n−}, where n− denotes the number of left-handed crossings in the chosen diagram for D, and n+ the number of right-handed crossings. The Khovanov homology of L is then defined as the homology H(L) of this complex C(D). It turns out that the Khovanov homology is indeed an invariant of L, and does not depend on the choice of diagram. The graded Euler characteristic of H(L) turns out to be the Jones polynomial of L. However, H(L) has been shown to contain more information about L than the Jones polynomial, but the exact details are not yet fully understood.
|
|
DOPE, or Discrete Optimized Protein Energy, is a statistical potential used to assess homology models in protein structure prediction. DOPE is based on an improved reference state that corresponds to noninteracting atoms in a homogeneous sphere with the radius dependent on a sample native structure; it thus accounts for the finite and spherical shape of the native structures. It is implemented in the popular homology modeling program MODELLER and used to assess the energy of the protein model generated through many iterations by MODELLER, which produces homology models by the satisfaction of spatial restraints. The models returning the minimum molpdfs can be chosen as best probable structures and can be further used for evaluating with the DOPE score.
|
|
For instance, the André–Quillen homology of a ring is a "non-abelian homology", defined and studied in this way. Both the algebraic K-theory and the André–Quillen homology are defined using algebraic data to write down a simplicial set, and then taking the homotopy groups of this simplicial set. Simplicial methods are often useful when one wants to prove that a space is a loop space. The basic idea is that if G is a group with classifying space BG, then G is homotopy equivalent to the loop space \Omega BG. If BG itself is a group, we can iterate the procedure, and G is homotopy equivalent to the double loop space \Omega^2 B(BG).
|
|
In mathematics, specifically in algebraic geometry and algebraic topology, the Lefschetz hyperplane theorem is a precise statement of certain relations between the shape of an algebraic variety and the shape of its subvarieties. More precisely, the theorem says that for a variety X embedded in projective space and a hyperplane section Y, the homology, cohomology, and homotopy groups of X determine those of Y. A result of this kind was first stated by Solomon Lefschetz for homology groups of complex algebraic varieties. Similar results have since been found for homotopy groups, in positive characteristic, and in other homology and cohomology theories. A far-reaching generalization of the hard Lefschetz theorem is given by the decomposition theorem.
|
|
In geometry and topology, trivial cylinders are certain pseudoholomorphic curves appearing in certain cylindrical manifolds. In Floer homology and its variants, chain complexes or differential graded algebras are generated by certain combinations of closed orbits of vector fields. In symplectic Floer homology, one considers the Hamiltonian vector field of a Hamiltonian function on a symplectic manifold; in symplectic field theory, contact homology, and their variants, one considers the Reeb vector field associated to a contact form, or more generally a stable Hamiltonian structure. The differentials all count some flavor of pseudoholomorphic curves in a manifold with a cylindrical almost-complex structure whose ends at negative infinity are the given collection of closed orbits.
|
|
The Poincaré sphere was the first example of a homology sphere, a manifold that had the same homology as a sphere, of which many others have since been constructed. To establish that the Poincaré sphere was different from the 3-sphere, Poincaré introduced a new topological invariant, the fundamental group, and showed that the Poincaré sphere had a fundamental group of order 120, while the 3-sphere had a trivial fundamental group. In this way he was able to conclude that these two spaces were, indeed, different. In the same paper, Poincaré wondered whether a 3-manifold with the homology of a 3-sphere and also trivial fundamental group had to be a 3-sphere.
|
|
In algebraic topology, the Hattori–Stong theorem, proved by and , gives an isomorphism between the stable homotopy of a Thom spectrum and the primitive elements of its K-homology.
|
|
This region may regulate kinase activity and play a role in recognizing different substrates. ULK1 and ULK2 share significant homology in both the C-terminal and N-terminal domains.
|
|
He was included in the 2019 class of fellows of the American Mathematical Society "for contributions to Floer homology and low-dimensional topology and service to the mathematical community".
|
|
G/T mismatch-specific thymine DNA glycosylase is an enzyme that in humans is encoded by the TDG gene. Several bacterial proteins have strong sequence homology with this protein.
|
|
As a consequence, nuclear receptors play key roles in both embryonic development and adult homeostasis. As discussed below, nuclear receptors may be classified according to either mechanism or homology.
|
|
Félix Vicq d'Azyr (; 23 April 1748 – 20 June 1794) was a French physician and anatomist, the originator of comparative anatomy and discoverer of the theory of homology in biology.
|
|
The protein contains a putative src homology 2 (SH2) domain, a hallmark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48.
|
|
Limbatustoxin (LbTX; α-KTx 1.4) is a 37-amino acid peptide, which belongs to the α-KTx 1.x subfamily, a group of short peptides consisting of 36-37 amino acid residues and three disulfide bridges. LbTX displays 57% sequence homology with charybdotoxin and 70% sequence homology with iberiotoxin. LbTX contains a β-sheet formed by three anti-parallel β-strands on one side of the molecule and a helix on the other side.
|
|
In homological algebra, the hyperhomology or hypercohomology of a complex of objects of an abelian category is an extension of the usual homology of an object to complexes. It is a sort of cross between the derived functor cohomology of an object and the homology of a chain complex. Hyperhomology is no longer used much: since about 1970 it has been largely replaced by the roughly equivalent concept of a derived functor between derived categories.
|
|
Based on the fact that intrepicalcin and imperacalcin have a 70% sequence homology (see Homology), it is predicted that intrepicalcin has a coiled, spherical structure. The ICK motif contains three disulfide bridges embedded in 𝛽 strands. Most positively-charged residues (lysine and arginine) are located on the frontal side of the peptide. However, compared to other calcins, intrepicalcin contains two extra positively-charged basic lysines (residue 12 and 14) on its dorsal side.
|
|
Specialised terms are used in taxonomic research. Primary homology is a researcher's initial hypothesis based on similar structure or anatomical connections, suggesting that a character state in two or more taxa share is shared due to common ancestry. Primary homology may be conceptually broken down further: we may consider all of the states of the same character as "homologous" parts of a single, unspecified, transformation series. This has been referred to as topographical correspondence.
|
|
A 2-cycle corresponds to a collection of embedded surfaces such as a sphere or a torus, and so on. Emmy Noether and, independently, Leopold Vietoris and Walther Mayer further developed the theory of algebraic homology groups in the period 1925–28.For example L'émergence de la notion de groupe d'homologie, Nicolas Basbois (PDF), in French, note 41, explicitly names Noether as inventing the homology group.Hirzebruch, Friedrich, Emmy Noether and Topology in .
|
|
In the German Naturphilosophie tradition, homology was of special interest as demonstrating unity in nature. In 1790, Goethe stated his foliar theory in his essay "Metamorphosis of Plants", showing that flower part are derived from leaves. The serial homology of limbs was described late in the 18th century. The French zoologist Etienne Geoffroy Saint-Hilaire showed in 1818 in his theorie d'analogue ("theory of homologues") that structures were shared between fishes, reptiles, birds, and mammals.
|
|
Since 1980, Dr. Wu's research has focused on the role of chromosome behavior in inheritance and gene activity, with emphasis on the widespread phenomena in which homology between chromosomes plays a role. She coined the term "homology effects" to highlight these phenomena. Her studies explore transvection, the zeste gene, chromosome pairing, and Polycomb-group genes and chromatin remodeling. She has also characterized the mechanisms of bridging promoter and enhancer elements within and between chromosomes.
|
|
Also in 1907, he described the construction of a new homology sphere. In 1908 he believed that he had found a proof of the Poincaré conjecture, but Tietze found an error. In 1910 Dehn published a paper on three-dimensional topology in which he introduced Dehn surgery and used it to construct homology spheres. He also stated Dehn's lemma, but an error was found in his proof by Hellmuth Kneser in 1929.
|
|
The BH3 interacting-domain death agonist, or BID, gene is a pro-apoptotic member of the Bcl-2 protein family. Bcl-2 family members share one or more of the four characteristic domains of homology entitled the Bcl-2 homology (BH) domains (named BH1, BH2, BH3 and BH4), and can form hetero- or homodimers. Bcl-2 proteins act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities.
|
|
Massless fields in superstring compactifications have been identified with cohomology classes on the target space (i.e. four-dimensional Minkowski space with a six-dimensional Calabi-Yau (CY) manifold). The determination of the matter and interaction content requires a detailed analysis of the (co)homology of these spaces: nearly all massless fields in the effective physics model are represented by certain (co)homology elements. However, a troubling consequence occurs when the target space is singular.
|
|
T. erythraeum has one of the largest genomes sequenced so far at 7.75 mbp. It has a GC content of 34% and contains approximately 40% non-coding DNA. There is evidence to suggest that the genome is in an expanding dynamic state due to the expansion of the genome through horizontal gene transfer. T. erythraeum shows a 98% homology with T. thiebautii but only a 75% homology with other cyanobacteria such as Oscillatoria.
|
|
Let X be a topological space and A, B be two subspaces whose interiors cover X. (The interiors of A and B need not be disjoint.) The Mayer–Vietoris sequence in singular homology for the triad (X, A, B) is a long exact sequence relating the singular homology groups (with coefficient group the integers Z) of the spaces X, A, B, and the intersection A∩B. There is an unreduced and a reduced version.
|
|
Zoltán Szabó (born November 24, 1965) is a professor of mathematics at Princeton University. He created, along with Peter Ozsváth, Heegaard Floer homology, a homology theory for 3-manifolds. For this contribution to the field of topology, Ozsváth and Szabó were awarded the 2007 Oswald Veblen Prize in Geometry. He got his B.A. from Eötvös Loránd University in Budapest, Hungary in 1990, and he received his Ph.D. from Rutgers University in 1994.
|
|
The SPG7 gene contains 21 exons and encodes for a protein that is approximately 88 kDa in size. Two transcript variants encoding distinct isoforms have been identified for this gene. The structure of the SPG7 resolved by X-ray crystallography reveals that the protein functions as a hexamer and is structurally most similar to bacterial FtSH proteases. It contains an FtsH-homology protease domain as well as an AAA+ homology ATPase domain.
|
|
In comparative cytogenetics, chromosome homology between species was proposed on the basis of similarities in banding patterns. Closely related species often had very similar banding pattern and after 40 years of comparing bands it seems safe to generalize that karyotype divergence in most taxonomic groups follows their phylogenetic relationship, despite notable exceptions. The conservation of large chromosomal segments makes comparison between species worthwhile. Chromosome banding has been a reliable indicator of chromosome homology overall, i.e.
|
|
Myosin IV has a single IQ motif and a tail that lacks any coiled-coil forming sequence. It has homology similar to the tail domains of Myosin VII and XV.
|
|
The sisRNA sequence is ~100% conserved in EBV strains and homology extends to include other lymphocryptoviruses. The hairpin structure is also conserved and includes structure-preserving mutations in its stem.
|
|
Furthermore, it was identified as a marker of myelomocytic differentiation in macrophage. RTVP-1 cluster proteins share significant sequence homology with the members of (PR ) superfamily and CRISP Family proteins.
|
|
Oxford University Press. Print [4] Bigert, A., and J. Söding. “Sequence Context- specific Profiles for Homology Searching.” Proceedings of the National Academy of Sciences 106.10 (2009): 3770-3775. PNAS. Web.
|
|
It was later noticed that this lemma provides a direct proof of the Brouwer fixed- point theorem without explicit use of homology. Sperner's students included Kurt Leichtweiss and Gerhard Ringel.
|
|
Herpetology: Third Edition. Pearson Prentice Hall:Pearson Education, Inc., 2002. The homology of such structures in various viviparous organisms is debatable, and in invertebrates such as Arthropoda, is analogous at best.
|
|
They also contain a carboxy- terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
|
|
STUB1 ( _ST_ IP1 homology and _U_ - _B_ ox containing protein _1_ ) is a human gene that codes for the protein CHIP ( _C_ terminus of _H_ SC70- _I_ nteracting _P_ rotein).
|
|
This level of homology between species is much higher than that found for LDLR. Hence, these gene comparisons suggest that VLDLR and LDLR diverged before the LDLRs did among vertebrates.
|
|
Between taxa, not all osteodermic tissue develop by homologous processes. It is agreed upon that all osteoderms may share a deep homology, connected by the similar properties of their dermis.
|
|
The authors of the study tentatively placed Longisquama among the Archosauromorpha as a result of their hypothesis of developmental "deep homology" between its plumes, bird feathers, crocodile scales and pterosaur pycnofibres.
|
|
Other proteins that are known to interact with NM IIA include the actin binding protein tropomyosin 4.2 and a novel actin stress fiber associated protein, LIM and calponin-homology domains1 (LIMCH1).
|
|
Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein.
|
|
Vogtmann's early work concerned homological properties of orthogonal groups associated to quadratic forms over various fields.Karen Vogtmann, Spherical posets and homology stability for O_{n,n}. Topology, vol. 20 (1981), no.
|
|
His book The Topology of Fibre Bundles is a standard reference. In collaboration with Samuel Eilenberg, he was a founder of the axiomatic approach to homology theory. See Eilenberg–Steenrod axioms.
|
|
This method involves the shuffling of plural DNA fragments without homology, in a single PCR. This results in the reconstruction of complete proteins by assembly of modules encoding different structural units.
|
|
Whereas ordinary homology is seen in the pattern of structures such as limb bones of mammals that are evidently related, deep homology can apply to groups of animals that have quite dissimilar anatomy: vertebrates (with endoskeletons made of bone and cartilage) and arthropods (with exoskeletons made of chitin) nevertheless have limbs that are constructed using similar recipes or "algorithms". Within the metazoa, homeotic genes control differentiation along major body axes, and pax genes (especially PAX6) help to control the development of the eye and other sensory organs. The deep homology applies across widely separated groups, such as in the eyes of mammals and the structurally quite different compound eyes of insects. Similarly, hox genes help to form an animal's segmentation pattern.
|
|
His approach moves from a revisitation of the traditional concepts of homology. According to Minelli, the homology relationships between two structures is necessarily limited to selected features of those structures, thus requiring the adoption a factorial, or combinatorial concept of homology. Minelli has introduced new concepts, such as axis paramorphism (useful for understanding the evolutionary relationships between the main axis of the body and its appendages) and those of eosegment and merosegment, through which he suggests a radical revisitation of the architecture of the body of segmented animals. Minelli has also explored the implication of evo-devo for biological systematics, speciation and the evolution of life cycles.< Minelli A., Brena Carlo, Deflorian Gianluca, Maruzzo Diego & Fusco G. (2006), “From embryo to adult.
|
|
Sequence graphs can be used to represent multiple sequence alignments with the addition of a new kind of edge representing homology between segments. For a set of genomes, one can create an acyclic breakpoint graph with a thread for each genome. For two segments (a, b) and (c,d), where a,b,c, and d represent the endpoints of the two segments, homology edges can be created from a to c and b to d or from a to d and b to c \- representing the two possible orientations of the homology. The advantage of representing a multiple sequence alignment this way is that it is possible to include inversions and other structural rearrangements that wouldn't be allowable in a matrix representation.
|
|
The main insight of persistent homology is that we can use the information obtained from all values of a parameter. Of course this insight alone is easy to make; the hard part is encoding this huge amount of information into an understandable and easy-to-represent form. With TDA, there is a mathematical interpretation when the information is a homology group. In general, the assumption is that features that persist for a wide range of parameters are "true" features.
|
|
Structure α-PMTX consists of 13 amino acid residues with the sequence Arg-Ile-Lys-Ile-Gly-Leu- Phe-Gln-Asp-Leu-Ser-Lys-Leu-NH2. Replacement of the lysine residue at position 12 of α-PMTX with arginine results in β-PMTX. Homology α-PMTX has no structural homology with other toxins. It lacks disulfide bonds which are known to be present in other toxins acting on sodium channels, such as sea anemone toxins or scorpion toxins.
|
|
Unlike the compatible SCOPe, it renames the class-fold-superfamily-family hierarchy into an architecture-X-homology-topology-family (A-XHTF) grouping, with the last level mostly defined by Pfam and supplemented by HHsearch clustering for uncategorized sequences. ECOD has the best PDB coverage of all three successors: it covers every PDB structure, and is updated biweekly. The direct mapping to Pfam has proven useful to Pfam curators who use the homology-level category to supplement their "clan" grouping.
|
|
There is a 70% sequence homology between mouse and rat and a 45% homology between human and mouse. The N-terminal, however, is highly conserved between all three species and is thought to contain potential casein kinase 2 (CK2) phosphorylation sites. CK2 is a constitutively and widely expressed serine/threonine kinase that has many substrates related to signal transduction and cell growth regulation. Several casein genes have also been found nearby to the FDC-SP gene.
|
|
Various software packages have been developed for the purposes of computing homology groups of finite cell complexes. Linbox is a C++ library for performing fast matrix operations, including Smith normal form; it interfaces with both Gap and Maple. Chomp, CAPD::Redhom and Perseus are also written in C++. All three implement pre-processing algorithms based on Simple-homotopy equivalence and discrete Morse theory to perform homology- preserving reductions of the input cell complexes before resorting to matrix algebra.
|
|
Pairs of spaces occur centrally in relative homology, homology theory and cohomology theory, where chains in A are made equivalent to 0, when considered as chains in X. Heuristically, one often thinks of a pair (X,A) as being akin to the quotient space X/A. There is a functor from spaces to pairs, which sends a space X to the pair (X,\varnothing). A related concept is that of a triple , with . Triples are used in homotopy theory.
|
|
The line which goes through the points where the figure's corresponding sides intersect is known as the axis of perspectivity, perspective axis, homology axis, or archaically, perspectrix. The figures are said to be perspective from this axis. The point at which the lines joining the corresponding vertices of the perspective figures intersect is called the center of perspectivity, perspective center, homology center, pole, or archaically perspector. The figures are said to be perspective from this center.
|
|
The localization of a topological space produces another topological space whose homology is a localization of the homology of the original space. A much more general concept from homotopical algebra, including as special cases both the localization of spaces and of categories, is the Bousfield localization of a model category. Bousfield localization forces certain maps to become weak equivalences, which is in general weaker than forcing them to become isomorphisms.Philip S. Hirschhorn: Model Categories and Their Localizations, 2003, .
|
|
Psychological profiling is described as a method of suspect identification which seeks to identify a person's mental, emotional, and personality characteristics based on things done or left at the crime scene. There are two major assumptions made when it comes to offender profiling: behavioral consistency and homology. Behavior consistency is the idea that an offender's crimes will tend to be similar to one another. Homology is the idea that similar crimes are committed by similar offenders.
|
|
The RNA strand is segmented in ten viral genomic segments with open reading frames (ORF) which encode for ten proteins. The genome's total size is 10.323kb and each of the ten segments range in size from 465 to 1,641 nucleotides. The first, and largest, of the segments has minimal homology with the influenza C virus PB1 subunit. The remaining nine segments show no homology with other known viruses, though their genome organization is consistent with that of other orthomyxoviruses.
|
|
FERM, RhoGEF and pleckstrin domain-containing protein 1 is a protein that in humans is encoded by the FARP1 gene. This gene was originally isolated through subtractive hybridization due to its increased expression in differentiated chondrocytes versus dedifferentiated chondrocytes. The resulting protein contains a predicted ezrin-like domain, a Dbl homology domain, and a pleckstrin homology domain. It is believed to be a member of the band 4.1 superfamily whose members link the cytoskeleton to the cell membrane.
|
|
Acyclic spaces occur in topology, where they can be used to construct other, more interesting topological spaces. For instance, if one removes a single point from a manifold M which is a homology sphere, one gets such a space. The homotopy groups of an acyclic space X do not vanish in general, because the fundamental group \pi_1(X) need not be trivial. For example, the punctured Poincaré homology sphere is an acyclic, 3-dimensional manifold which is not contractible.
|
|
Comparing human and rat serine dehydratase using a cDNA library was identical except for a 36 amino acid residue stretch. The overall homology between rat SDH and human SDH is 81% in the nucleotide sequence and 84% in the amino acid sequence. Similarities have also been shown between yeast and E. coli threonine dehydratase and human serine dehydratase. Human SDH shows sequence homology of 27% with the yeast enzyme and 27% with the E. coli enzyme.
|
|
The kth homology group Hk of S is defined to be the quotient abelian group :H_k(S) = Z_k/B_k\, . It follows that the homology group Hk(S) is nonzero exactly when there are k-cycles on S which are not boundaries. In a sense, this means that there are k-dimensional holes in the complex. For example, consider the complex S obtained by gluing two triangles (with no interior) along one edge, shown in the image.
|
|
Overview of metagenomic methods Functional or homology screening strategies have been used to identify genes that produce small bioactive molecules. Functional metagenomic studies are designed to search for specific phenotypes that are associated with molecules with specific characteristics. Homology metagenomic studies, on the other hand, are designed to examine genes to identify conserved sequences that are previously associated with the expression of biologically active molecules. Functional metagenomic studies enable the discovery of novel genes that encode biologically active molecules.
|
|
In mathematics, the Serre spectral sequence (sometimes Leray–Serre spectral sequence to acknowledge earlier work of Jean Leray in the Leray spectral sequence) is an important tool in algebraic topology. It expresses, in the language of homological algebra, the singular (co)homology of the total space X of a (Serre) fibration in terms of the (co)homology of the base space B and the fiber F. The result is due to Jean-Pierre Serre in his doctoral dissertation.
|
|
The function of this gene product is not known; however, homology to other proteins suggests that it may be an integral membrane transport protein. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. The MLC1 protein contains six putative transmembrane domains (S1–S6) and a pore region (P) between S5 and S6. Furthermore, MLC1 has highest homology with the KCNA1 shaker-related voltage- gated potassium channel (Kv1.1).
|
|
Plant BCATs have also been identified, but vary between species in terms of number and sequence. In studies ofArabidopsis thaliana (thale cress), six BCAT isoforms have been identified that share between 47.5-84.1% homology with each other. These isoforms also share around 30% sequence homology to the human and yeast (Saccharomyces cerevisiae) isoforms. BCAT1 is located in the mitochondria, BCAT2, 3, and 5 are located in chloroplasts, and BCAT4 and 6 are located in the cytoplasm of A. thaliana.
|
|
His works include regression diagnostic analysis for General Linear Models, extension to tangles of Morwen Thistlethwaite's result on the alternation of the Jones polynomial for alternating links, and a Lee's result on Khovanov homology for links, that states that the Khovanov homology for alternating links is supported in two lines. During his works Professor Burgos has introduced some Mathematical concepts such as: Gravity Information in a tangle diagram, Alternating planar algebras, and Rotation Number of Smoothings.
|
|
CERK is encoded by the CERK gene. The CERK gene is located on human chromosome 22q13, contains 13 exons, and is approximately 4.5kb in length. CERK shares sequence homology with sphingosine kinase type I, including an N-terminal pleckstrin homology (PH) domain and a diacylglycerol kinase domain. BLAST searches of expressed sequence tag (ESTs) by Sugiura and colleagues have yielded results showing orthologous CERK genes in other eukaryotes including Drosophila melanogaster, Caenorhabditis elegans, and Oryza sativa.
|
|
Goresky and MacPherson introduced a class of "allowable" cycles for which general position does make sense. They introduced an equivalence relation for allowable cycles (where only "allowable boundaries" are equivalent to zero), and called the group :IH_i(X) of i-dimensional allowable cycles modulo this equivalence relation "intersection homology". They furthermore showed that the intersection of an i- and an (n-i)-dimensional allowable cycle gives an (ordinary) zero-cycle whose homology class is well- defined.
|
|
In geometric topology, the double suspension theorem of James W. Cannon () and Robert D. Edwards states that the double suspension S2X of a homology sphere X is a topological sphere.Robert D. Edwards, "Suspensions of homology spheres" (2006) ArXiv (reprint of private, unpublished manuscripts from the 1970's)Robert D. Edwards, "The topology of manifolds and cell-like maps", Proceedings of the International Congress of Mathematicians, Helsinki, 1978 ed. O. Lehto, Acad. Sci. Fenn (1980) pp 111-127.
|
|
Orthology or paralogy inference requires an assessment of sequence homology, usually via sequence alignment. Phylogenetic analyses and sequence alignment are often considered jointly, as phylogenetic analyses using DNA or RNA require sequence alignment and alignments themselves often represent some hypothesis of homology. As proper ortholog identification is pivotal to phylogenetic analyses, there are a variety of methods available to infer orthologs and paralogs. These methods are generally distinguished as either graph-based algorithms or tree-based algorithms.
|
|
In his 2014 book Homology, Genes, and Evolutionary Innovation, the evolutionary biologist Günter P. Wagner argues for "the study of novelty as distinct from adaptation." He defines novelty as occurring when some part of the body develops an individual and quasi-independent existence, in other words as a distinct and recognisable structure, which he implies might occur before natural selection begins to adapt the structure for some function.Wagner, Günter P., Homology, Genes, and Evolutionary Innovation. Princeton University Press. 2014. .
|
|
Similarity ultimately leads to homology, in that the more similar sequences are, the closer they are to being homologous. This similarity in sequences can then go on to help find common ancestry.
|
|
The interaction between GAB2 and Grb2 at the cell membrane recruits another adaptor protein, the Src homology domain-containing transforming protein 1 (SHC1), before being able to recruit SH2 domain-containing molecules.
|
|
A similar structure in nymphal stoneflies (Plecoptera) is of uncertain homology. These terminal abdominal segments have excretory and sensory functions in all insects, but in adults there is an additional reproductive function.
|
|
Dror Bar-Natan (; born January 30, 1966) is a Professor at the University of Toronto Department of Mathematics, Canada. His main research interests include knot theory, finite type invariants, and Khovanov homology.
|
|
Academically, Bar-Natan has made significant contributions to the formalization of Khovanov homology. Bar-Natan was a member of the Editorial Board for the journal Compositio Mathematica for 10 years, until 2010.
|
|
In mathematical group theory, the Schur multiplier or Schur multiplicator is the second homology group H_2(G, \Z) of a group G. It was introduced by in his work on projective representations.
|
|
A similar structure in nymphal stoneflies (Plecoptera) is of uncertain homology. These terminal abdominal segments have excretory and sensory functions in all insects, but in adults there is an additional reproductive function.
|
|
Tyrosine-protein phosphatase non-receptor type 6, also known as Src homology region 2 domain-containing phosphatase-1 (SHP-1), is an enzyme that in humans is encoded by the PTPN6 gene.
|
|
The predicted tertiary structure for NLP2 shows the FAM129C PH domain. There are seven predicted β sheets at the N terminus. This will form the tertiary structure of the pleckstrin homology domain.
|
|
Coddington, J. A. (1990). Ontogeny and homology in the male palpus of orb-weaving spiders and their relatives, with comments on phylogeny (Araneoclada: Araneoidea, Deinopoidea). Smithsonian Contributions to Zoology 496: 1-52.
|
|
On the basis of its structural homology to members of the beta group of long chain neurotoxins, dortoxin may bind to voltage-gated sodium channels. However, electrophysiological tests have not yet been performed.
|
|
This is particularly true in cases where target flexibility is crucial, such as is likely to be the case when using homology models. The source code is available on GitHub under Apache License.
|
|
The domains and domain superfamilies are defined and described in SCOP. Superfamilies are groups of proteins which have structural evidence to support a common evolutionary ancestor but may not have detectable sequence homology.
|
|
Homology between features indicate that those features have been derived from a common ancestor. Alternatively, homoplasy between features describes those that can resemble each other, but derive independently via parallel or convergent evolution.
|
|
Inhibitor family I42 includes chagasin, a reversible inhibitor of papain-like cysteine proteases. Chagasin has a beta- barrel structure, which is a unique variant of the immunoglobulin fold with homology to human CD8alpha.
|
|
Pleckstrin homology domain containing, family G member 5 (PLEKHG5) is a protein that in humans is encoded by the PLEKHG5 gene. Eight transcript variants encoding different isoforms have been found for this gene.
|
|
As described in more detail below, transcription factors may be classified by their (1) mechanism of action, (2) regulatory function, or (3) sequence homology (and hence structural similarity) in their DNA-binding domains.
|
|
Support for one paralog, FAM193B, shows homology to FAM193A's C-terminus end. FAM193B is 2961 nts long while FAM193A is 4710 and when aligned using Biology Workbench received a low score of -4490.
|
|
For example, the α-complex and witness complex are used to reduce the dimension and size of complexes. Recently, Discrete Morse theory has shown promise for computational homology because it can reduce a given simplicial complex to a much smaller cellular complex which is homotopic to the original one. This reduction can in fact be performed as the complex is constructed by using matroid theory, leading to further performance increases. Another recent algorithm saves time by ignoring the homology classes with low persistence.
|
|
Discrete Morse theory is a combinatorial adaptation of Morse theory developed by Robin Forman. The theory has various practical applications in diverse fields of applied mathematics and computer science, such as configuration spaces, homology computation,Perseus: the Persistent Homology software. denoising,U. Bauer, C. Lange, and M. Wardetzky: Optimal Topological Simplification of Discrete Functions on Surfaces mesh compression,T Lewiner, H Lopez and G Tavares: Applications of Forman's discrete Morse theory to topological visualization and mesh compression and topological data analysis.
|
|
The cycles in degree 1 are then exactly the linear relations on the elements x and y, while the boundaries are the trivial relations. The first Koszul homology H1(K•(x, y)) therefore measures exactly the relations mod the trivial relations. With more elements the higher-dimensional Koszul homologies measure the higher-level versions of this. In the case that the elements x_1, x_2, \dots, x_n form a regular sequence, the higher homology modules of the Koszul complex are all zero.
|
|
Double-strand break repair models that act via homologous recombination Homology directed repair (HDR) is a mechanism in cells to repair double-strand DNA lesions. The most common form of HDR is homologous recombination. The HDR mechanism can only be used by the cell when there is a homologous piece of DNA present in the nucleus, mostly in G2 and S phase of the cell cycle. Other examples of homology-directed repair include single-strand annealing and breakage-induced replication.
|
|
The C1a and C2a subdomains are homologous and form an intramolecular 'dimer' that forms the active site. This structure displays significant homology with human brain adenylyl cyclase 1(HBA C1 or ADCY1) in the highly conserved adenylyl cyclases domain found in the 3’ cytoplasmic domain of all mammalian adenylyl cyclases. Outside this domain homology is not similar suggesting that this corresponding mRNA originates from a different gene. In situ hybridization confirms a heterogeneous population of adenylyl cyclase mRNAs is expressed in the brain.
|
|
Mixed Hodge theory, developed by Pierre Deligne, extends Hodge theory to all complex algebraic varieties, not necessarily smooth or compact. Namely, the cohomology of any complex algebraic variety has a more general type of decomposition, a mixed Hodge structure. A different generalization of Hodge theory to singular varieties is provided by intersection homology. Namely, Morihiko Saito showed that the intersection homology of any complex projective variety (not necessarily smooth) has a pure Hodge structure, just as in the smooth case.
|
|
However, these procedures are not practical for clinical laboratories to use for identification of these organisms. Other sequence-based identification systems have subsequently been introduced for VGS species level identification. In general, 16S rRNA gene sequencing results in poor resolution to species level in the VGS. This is due to the high degree of 16S rRNA gene homology in this group of organisms; S. mitis, S. oralis, S. pseudopneumoniae, and S. pneumoniae almost always have >99% sequence homology in this gene.
|
|
The ISG15 gene consists of two exons and encodes for a 17 kDa polypeptide. The immature polypeptide is cleaved at its carboxy terminus, generating a mature 15 kDa product that terminates with a LRLRGG motif, as found in ubiquitin. The tertiary structure of ISG15 also resembles ubiquitin, despite only ~30% sequence homology. Specifically, this structure consists of two ubiquitin-like domains connected by a polypeptide ‘hinge.’ Of note, ISG15 shows substantial sequence variation among species, with homology as low as 30% between orthologs.
|
|
IQGAP1 was discovered in 1994. Its name stems from the fact that its RasGAP-related domain (GRD) has sequence homology to the Sar1 GTPase. It was hypothesized that IQGAP1 would act as a GTPase activating protein (GAP) protein, promoting the switch of ras GTPases from the active GTP to GDP-bound forms. However, despite the homology of IQGAP’s GAP domain to sar1 and the fact that IQGAP1 binds Rho GTPases Rac1 and Cdc42, IQGAP does not actually have GAP function.
|
|
A chain homotopy offers a way to relate two chain maps that induce the same map on homology groups, even though the maps may be different. Given two chain complexes A and B, and two chain maps , a chain homotopy is a sequence of homomorphisms such that . The maps may be written out in a diagram as follows, but this diagram is not commutative. :650 px The map hdA \+ dBh is easily verified to induce the zero map on homology, for any h.
|
|
Floer homologies are generally difficult to compute explicitly. For instance, the symplectic Floer homology for all surface symplectomorphisms was completed only in 2007. The Heegaard Floer homology has been a success story in this regard: researchers have exploited its algebraic structure to compute it for various classes of 3-manifolds and have found combinatorial algorithms for computation of much of the theory. It is also connected to existing invariants and structures and many insights into 3-manifold topology have resulted.
|
|
Many other pro- and eukaryotic organisms (in particular, fungi such as Neurospora) express rhodopsin ion pumps or sensory rhodopsins of yet-unknown function. Very recently, microbial rhodopsins with guanylyl cyclase activity have been discovered. While all microbial rhodopsins have significant sequence homology to one another, they have no detectable sequence homology to the G-protein-coupled receptor (GPCR) family to which animal visual rhodopsins belong. Nevertheless, microbial rhodopsins and GPCRs are possibly evolutionarily related, based on the similarity of their three- dimensional structures.
|
|
Two major ways in which this can be done are through fundamental groups, or more generally homotopy theory, and through homology and cohomology groups. The fundamental groups give us basic information about the structure of a topological space, but they are often nonabelian and can be difficult to work with. The fundamental group of a (finite) simplicial complex does have a finite presentation. Homology and cohomology groups, on the other hand, are abelian and in many important cases finitely generated.
|
|
In differential geometry, a Hodge cycle or Hodge class is a particular kind of homology class defined on a complex algebraic variety V, or more generally on a Kähler manifold. A homology class x in a homology group :H_k(V, \Complex) = H where V is a non-singular complex algebraic variety or Kähler manifold is a Hodge cycle, provided it satisfies two conditions. Firstly, k is an even integer 2p, and in the direct sum decomposition of H shown to exist in Hodge theory, x is purely of type (p,p). Secondly, x is a rational class, in the sense that it lies in the image of the abelian group homomorphism :H_k(V, \Q) \to H defined in algebraic topology (as a special case of the universal coefficient theorem).
|
|
For example, the spatial arrangement of conserved residues may suggest whether a particular residue is conserved to stabilize the folding, to participate in binding some small molecule, or to foster association with another protein or nucleic acid. Homology modeling can produce high-quality structural models when the target and template are closely related, which has inspired the formation of a structural genomics consortium dedicated to the production of representative experimental structures for all classes of protein folds. The chief inaccuracies in homology modeling, which worsen with lower sequence identity, derive from errors in the initial sequence alignment and from improper template selection. Like other methods of structure prediction, current practice in homology modeling is assessed in a biennial large-scale experiment known as the Critical Assessment of Techniques for Protein Structure Prediction, or CASP.
|
|
The three-dimensional lens spaces L(p,q) were introduced by Heinrich Tietze in 1908. They were the first known examples of 3-manifolds which were not determined by their homology and fundamental group alone, and the simplest examples of closed manifolds whose homeomorphism type is not determined by their homotopy type. J. W. Alexander in 1919 showed that the lens spaces L(5;1) and L(5;2) were not homeomorphic even though they have isomorphic fundamental groups and the same homology, though they do not have the same homotopy type. Other lens spaces have even the same homotopy type (and thus isomorphic fundamental groups and homology), but not the same homeomorphism type; they can thus be seen as the birth of geometric topology of manifolds as distinct from algebraic topology.
|
|
X-ray crystal structures have been obtained for several GRKs (GRK1, GRK2, GRK4, GRK5 and GRK6), alone or bound to ligands. Overall, GRKs share sequence homology and domain organization in which the central protein kinase catalytic domain is preceded by a domain with homology to the active domain of Regulator of G protein Signaling proteins, RGS proteins (the RGS-homology – RH – domain) and is followed by a variable carboxyl terminal tail regulatory region. In the folded proteins, the kinase domain forms a typical bi-lobe kinase structure with a central ATP-binding active site. The RH domain is composed of alpha-helical region formed from the amino terminal sequence plus a short stretch of sequence following the kinase domain that provides 2 additional helices, and makes extensive contacts with one side of the kinase domain.
|
|
Many constructions in ECH (including its well-definedness) rely upon this isomorphism . The contact element of ECH has a particularly nice form: it is the cycle associated to the empty collection of Reeb orbits. An analog of embedded contact homology may be defined for mapping tori of symplectomorphisms of a surface (possibly with boundary) and is known as periodic Floer homology, generalizing the symplectic Floer homology of surface symplectomorphisms. More generally, it may be defined with respect to any stable Hamiltonian structure on the 3-manifold; like contact structures, stable Hamiltonian structures define a nonvanishing vector field (the Reeb vector field), and Hutchings and Taubes have proven an analogue of the Weinstein conjecture for them, namely that they always have closed orbits (unless they are mapping tori of a 2-torus).
|
|
Recently, several members of the order Rhodobacterales have been demonstrated to produce functional RcGTA-like particles. Groups of genes with homology to the RcGTA are present in the chromosomes of various types of alphaproteobacteria.
|
|
The beta subunits of these transporters show sufficient sequence similarity to the Na+:H+ antiporters of the CPA2 family (TC #2.A.37) to establish homology (K. Studley and M.H. Saier, Jr., unpublished results).
|
|
In mathematics, particularly homological algebra, the zig-zag lemma asserts the existence of a particular long exact sequence in the homology groups of certain chain complexes. The result is valid in every abelian category.
|
|
This allows the characterization of the properties of surfaces in terms of purely algebraic invariants, such as the genus and homology groups. The homeomorphism classes of surfaces have been completely described (see Surface (topology)).
|
|
The Imd pathway bears a number of similarities to mammalian TNFR signalling, though many of the intracellular regulatory proteins of Imd signalling also bear homology to different signalling cascades of human Toll- like receptors.
|
|
The rapidly activating, desensitizing, inward current is predominantly carried by sodium and potassium ions. 5-HT3 receptors have a negligible permeability to anions. They are most closely related by homology to the nicotinic acetylcholine receptor.
|
|
Whitehead, section 6.1; page 257. One can define homology with coefficients in a bundle of abelian groups.Whitehead, section 6.2. When satisfies certain conditions, a local system can be equivalently described as a locally constant sheaf.
|
|
Different variants of the gene that encodes for MOMP, differentiate the genotypes of the different serovars. The antigenic relatedness of the serovars reflects the homology levels of DNA between MOMP genes, especially within these segments.
|
|
Here, homology and cohomology are integral, but the isomorphism remains valid over any coefficient ring. In the case where an oriented manifold is not compact, one has to replace cohomology by cohomology with compact support.
|
|
In the case of non-orientable manifolds, every homology class of H_n(X,\Z_2), where \Z_2 denotes the integers modulo 2, can be realized by a non-oriented manifold, f\colon M^n\to X.
|
|
HAS2 is a member of the vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1.
|
|
He attended the First International Topological Conference held in Moscow 4-10 September 1935. He made two presentations there: "Accessibility and homology" and "Betti groups with different coefficient groups". He died in Prague in 1960.
|
|
In mathematics, homologyin part from Greek ὁμός homos "identical" is a general way of associating a sequence of algebraic objects, such as abelian groups or modules, to other mathematical objects such as topological spaces. Homology groups were originally defined in algebraic topology. Similar constructions are available in a wide variety of other contexts, such as abstract algebra, groups, Lie algebras, Galois theory, and algebraic geometry. The original motivation for defining homology groups was the observation that two shapes can be distinguished by examining their holes.
|
|
Like other cytokine receptors, Leptin receptor protein has three different regions: i) extracellular, ii) trans-membrane, and iii) intracellular. The extracellular part has 5 functional domains: i) membrane distal 1st cytokine receptor homology (CRH1), ii) Immunoglobulin like (Ig), iii) 2nd cytokine receptor homology (CRH2) and iv) two membrane proximal fibronectine type-III (FNIII) domains. CRH1 domains is not essential for Leptin binding, but may have regulatory roles. Ig domain interacts with Leptin and is essential for conformational change in the receptor upon ligand binding.
|
|
Conserved sequences may be identified by homology search, using tools such as BLAST, HMMER, OrthologR, and Infernal. Homology search tools may take an individual nucleic acid or protein sequence as input, or use statistical models generated from multiple sequence alignments of known related sequences. Statistical models such as profile-HMMs, and RNA covariance models which also incorporate structural information, can be helpful when searching for more distantly related sequences. Input sequences are then aligned against a database of sequences from related individuals or other species.
|
|
However, Floer homology is not always isomorphic to a familiar invariant, so continuation maps yield an a priori proof of invariance. In finite-dimensional Morse theory, different choices made in constructing the vector field on X × I yield distinct but chain homotopic maps and thus descend to the same isomorphism on homology. However, in certain infinite dimensional cases, this does not hold, and these techniques may be used to produce invariants of one-parameter families of objects (such as contact structures or Legendrian knots).
|
|
Cross over events occur between regions of homology across the cassettes and YAC vector, thereby connecting the smaller DNA sequences into one larger contig.First, gap repair cloning is performed to generate regions of homology flanking the DNA contigs. Gap Repair Cloning is a particular form of the polymerase chain reaction in which specialized primers with extensions beyond the sequence of the DNA target are utilized. Then, the DNA cassettes are exposed to the YAC vector, which drives the process of homologous recombination, thereby connecting the DNA cassettes.
|
|
This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response.
|
|
The Poincaré polynomial of a surface is defined to be the generating function of its Betti numbers. For example, the Betti numbers of the torus are 1, 2, and 1; thus its Poincaré polynomial is 1+2x+x^2. The same definition applies to any topological space which has a finitely generated homology. Given a topological space which has a finitely generated homology, the Poincaré polynomial is defined as the generating function of its Betti numbers, viz the polynomial where the coefficient of x^n is b_n.
|
|
In mathematics, a chain complex is an algebraic structure that consists of a sequence of abelian groups (or modules) and a sequence of homomorphisms between consecutive groups such that the image of each homomorphism is included in the kernel of the next. Associated to a chain complex is its homology, which describes how the images are included in the kernels. A cochain complex is similar to a chain complex, except that its homomorphisms follow a different convention. The homology of a cochain complex is called its cohomology.
|
|
Raoul Bott used Morse–Bott theory in his original proof of the Bott periodicity theorem. Round functions are examples of Morse–Bott functions, where the critical sets are (disjoint unions of) circles. Morse homology can also be formulated for Morse–Bott functions; the differential in Morse–Bott homology is computed by a spectral sequence. Frederic Bourgeois sketched an approach in the course of his work on a Morse–Bott version of symplectic field theory, but this work was never published due to substantial analytic difficulties.
|
|
The amino-acid sequence of WaTx bears little resemblance to other peptides in terms of homology. Although the toxin was discovered to be cell-penetrating, there is no sequence similarity to classical cell-penetrating peptides (CPPs).
|
|
The proteins p35 and p39 activate CDK5. Although they lack cyclin sequence homology, crystal structures show that p35 folds in a similar way as the cyclins. However, activation of CDK5 does not require activation loop phosphorylation.
|
|
While those second and third exons are shared by p16INK4a and ARF, the proteins are encoded in different reading frames meaning that p16INK4a and ARF are not isoforms, nor do they share any amino acid homology.
|
|
Most SLITRKs, but not SLITRK1, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003).
|
|
In mathematics, particularly algebraic topology, the Kan-Thurston theorem associates a discrete group G to every path connected topological space X in such a way that the group cohomology of G is the same as the cohomology of the space X. The group G might then be regarded as a good approximation to the space X, and consequently the theorem is sometimes interpreted to mean that homotopy theory can be viewed as part of group theory. More precisely, the theorem states that every path connected topological space is homology- equivalent to the classifying space K(G,1) of a discrete group G, where homology-equivalent means there is a map K(G,1) \rightarrow X inducing an isomorphism on homology. The theorem is attributed to Daniel Kan and William Thurston who published their result in 1976.
|
|
The Mayer–Vietoris sequence is such an approach, giving partial information about the (co)homology groups of any space by relating it to the (co)homology groups of two of its subspaces and their intersection. The most natural and convenient way to express the relation involves the algebraic concept of exact sequences: sequences of objects (in this case groups) and morphisms (in this case group homomorphisms) between them such that the image of one morphism equals the kernel of the next. In general, this does not allow (co)homology groups of a space to be completely computed. However, because many important spaces encountered in topology are topological manifolds, simplicial complexes, or CW complexes, which are constructed by piecing together very simple patches, a theorem such as that of Mayer and Vietoris is potentially of broad and deep applicability.
|
|
Resistance to ALK inhibitors can occur with novel acquired ALK mutations or amplifications. Also ROS1-positive tumors have shown high sensitivity to ALK inhibitors due to the high homology between the kinase domains of ROS1 and ALK.
|
|
Spinoxin has 82% sequence homology with maurotoxin (MTX; α-KTx6.2). Most short-chain scorpion toxins contain three disulfide bridges, whereas several toxins belonging to the α-KTx6 subfamily, including spinoxin and maurotoxin, possess a fourth disulfide bridge.
|
|
This led to clashes with other entomologists. Ferris helped found a group of Californian "biosystematists" who influenced each other. As a comparative morphologist he sought rigor in recognizing homology in structures. As a teacher, Ferris was popular.
|
|
AICAR transformylase requires the coenzyme N10-formyltetrahydrofolate (N10-formyl- THF) as the formyl donor for the formylation of AICAR to FAICAR. However, AICAR transformylase and GAR transformylase do not share a high sequence similarity or structural homology.
|
|
The second algebraic K-group K2(R) of a commutative ring R can be identified with the second homology group H2(E(R), Z) of the group E(R) of (infinite) elementary matrices with entries in R.
|
|
Among other structures, this structural genomics approach allowed for the determination of the structure of the TM0449 protein, which was found to exhibit a novel fold as it did not share structural homology with any known protein.
|
|
J Bacteriol 186:5093-100.Epstein, D. M., and P. C. Wensink. 1988. The α-lytic protease gene of Lysobacter enzymogenes. The nucleotide sequence predicts a large prepropeptide with homology to propeptides of other chymotrypsin-like enzymes.
|
|
The D1/D2 variable domains of 28S rDNA have often been used to identify C. foveolata. This is necessary to distinguish C. foveolata from Cephalotheca sulfurea which has 95% homology or Phialemonium obovatum, another closely related species.
|
|
Converse of this theorem is an consequence of cellular homology, and the fact that every free module is projective. Theorem: Let X be an aspherical n-dimensional CW complex with π1(X) = G, then cdZ(G) ≤ n.
|
|
Homologous genes could only be studied effectively using search tools that established like portions or local placement between two proteins or nucleic acid sequences. Homology was quantified by scores obtained from matching sequences, “mismatch and gap scores”.
|
|
If this is confirmed, it would mean the sea spiders are the last surviving (and highly modified) members of an ancient stem group of arthropods that lived in Cambrian oceans. However, a subsequent study using Hox gene expression patterns consistent with a developmental homology between chelicerates and chelifores, with chelifores innervated from a deuterocerebrum that has been rotated forwards; thus, the protocerebral Great Appendage clade does not include the Pycnogonida.Pharyngula Recent work places the Pycnogonida outside the Arachnomorpha as basal Euarthropoda, or inside Chelicerata (based on the chelifore-chelicera putative homology).
|
|
For an example of its use, and some discussion, see the paper of Higgins referenced below. The interchange law implies that a double category contains a family of abelian monoids. The history in relation to homotopy groups is interesting. The workers in topology of the early 20th century were aware that the nonabelian fundamental group was of use in geometry and analysis; that abelian homology groups could be defined in all dimensions; and that for a connected space, the first homology group was the fundamental group made abelian.
|
|
Abaloparatide is 34 amino acid synthetic analog of PTHrP. It has 41% homology to parathyroid hormone (PTH) (1-34) and 76% homology to parathyroid hormone- related protein (PTHrP) (1-34). It works as an anabolic agent for the bone, through selective activation of the parathyroid hormone 1 receptor (PTH1R), a G protein-coupled receptor (GPCR) expressed in the osteoblasts and osteocytes. Abaloparatide preferentially binds the RG conformational state of the PTH1R, which in turn elicits a transient downstream cyclic AMP signaling response towards to a more anabolic signaling pathway.
|
|
Deciding if a particular knot is the unknot was a major driving force behind knot invariants, since it was thought this approach would possibly give an efficient algorithm to recognize the unknot from some presentation such as a knot diagram. Unknot recognition is known to be in both NP and co-NP. It is known that knot Floer homology and Khovanov homology detect the unknot, but these are not known to be efficiently computable for this purpose. It is not known whether the Jones polynomial or finite type invariants can detect the unknot.
|
|
In molecular biology, the BAH domain (bromo-adjacent homology) domain is found in proteins such as eukaryotic DNA (cytosine-5) methyltransferases, the origin recognition complex 1 (Orc1) proteins, Bromo adjacent homology domain containing 1 (BAHD1), as well as several proteins involved in transcriptional regulation. The BAH domain appears to act as a protein-protein interaction module specialised in gene silencing, as suggested for example by its interaction within yeast Orc1p with the silent information regulator Sir1p. The BAH domain might therefore play an important role by linking DNA methylation, replication and transcriptional regulation.
|
|
Activator of apoptosis Hrk regulates apoptosis through interaction with death-repressor proteins Bcl-2 and Bcl-X(L). The HRK protein lacks significant homology to other BCL2 family members except for an 8-amino acid region that was similar to the BCL2 homology domain-3 (BH3) motif of BIK. HRK interacts with BCL2 and BCLXL via the BH3 domain, but not with the death-promoting BCL2-related proteins BAX, BAK, or BCLXS. HRK localizes to membranes of intracellular organelles in a pattern similar to that previously reported for BCL2 and BCLXL.
|
|
The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively.
|
|
These properties noticeably differ between different mammalian alkaline phosphatase isozymes and therefore showcase a difference in in vivo functions. Alkaline phosphatase has homology in a large number of other enzymes and composes part of a superfamily of enzymes with several overlapping catalytic aspects and substrate traits. This explains why most salient structural features of mammalian alkaline are the way they are and reference their substrate specificity and homology to other members of the nucleoside pyrophosphatase/phosphodiesterase family of isozyme. Research has shown a relationship between members of the alkaline phosphatase family with aryl sulfatases.
|
|
In the mathematical field of knot theory, the Arf invariant of a knot, named after Cahit Arf, is a knot invariant obtained from a quadratic form associated to a Seifert surface. If F is a Seifert surface of a knot, then the homology group H1(F, Z/2Z) has a quadratic form whose value is the number of full twists mod 2 in a neighborhood of an imbedded circle representing an element of the homology group. The Arf invariant of this quadratic form is the Arf invariant of the knot.
|
|
Formins are characterized by the presence of three formin homology (FH) domains (FH1, FH2 and FH3), although members of the formin family do not necessarily contain all three domains. In addition, other domains are usually present, such as PDZ, DAD, WH2, or FHA domains. The proline-rich FH1 domain mediates interactions with a variety of proteins, including the actin-binding protein profilin, SH3 (Src homology 3) domain proteins, and WW domain proteins. The actin nucleation- promoting activity of S. cerevisiae formins has been localized to the FH2 domain.
|
|
At the beginning of the 20th century, Henri Poincaré was working on the foundations of topology—what would later be called combinatorial topology and then algebraic topology. He was particularly interested in what topological properties characterized a sphere. Poincaré claimed in 1900 that homology, a tool he had devised based on prior work by Enrico Betti, was sufficient to tell if a 3-manifold was a 3-sphere. However, in a 1904 paper he described a counterexample to this claim, a space now called the Poincaré homology sphere.
|
|
The homology between megacheiran great appendages and cephalic appendages of other arthropods had been discussed for decades. There is controversy over whether they are homologous to both dinocaridid (radiodonts and gilled lobopodians) frontal appendages, the frontalmost appendages of Isoxys and chelicerates' chelicerae. Based on neuroanatomical evidences, many studies support their homology to chelicerae and first antennae of other arthropods (which are deutocerebral), but not dinocaridid frontal appendages (protocerebral), A 2020 study suggests that the great appendages of megacheirans and radiodonts are homologous and casts doubt on the validity of suspected neuroanatomical evidences.
|
|
These are the theories satisfying the "dimension axiom" of the Eilenberg–Steenrod axioms that the homology of a point vanishes in dimension other than 0. They are determined by an abelian coefficient group G, and denoted by H(X, G) (where G is sometimes omitted, especially if it is Z). Usually G is the integers, the rationals, the reals, the complex numbers, or the integers mod a prime p. The cohomology functors of ordinary cohomology theories are represented by Eilenberg–MacLane spaces. On simplicial complexes, these theories coincide with singular homology and cohomology.
|
|
Cross over events occur between regions of homology across the cassettes and YAC vector, thereby connecting the smaller DNA sequences into one larger contig. First, Gap Repair Cloning is performed to generate regions of homology flanking the DNA contigs. Gap Repair Cloning is a particular form of the Polymerase Chain Reaction in which specialized primers with extensions beyond the sequence of the DNA target are utilized. Then, the DNA cassettes are exposed to the YAC vector, which drives the process of homologous recombination, thereby connecting the DNA cassettes.
|
|
In mathematics, the plus construction is a method for simplifying the fundamental group of a space without changing its homology and cohomology groups. It was introduced by , and was used by Daniel Quillen to define algebraic K-theory. Given a perfect normal subgroup of the fundamental group of a connected CW complex X, attach two-cells along loops in X whose images in the fundamental group generate the subgroup. This operation generally changes the homology of the space, but these changes can be reversed by the addition of three-cells.
|
|
Andreas Floer (; 23 August 1956 – 15 May 1991) was a German mathematician who made seminal contributions to symplectic topology, and mathematical physics, in particular the invention of Floer homology. Floer's first pivotal contribution was a solution of a special case of Arnold's conjecture on fixed points of a symplectomorphism. Because of his work on Arnold's conjecture and his development of instanton homology, he achieved wide recognition and was invited as a plenary speaker for the International Congress of Mathematicians held in Kyoto in August 1990. He received a Sloan Fellowship in 1989.
|
|
Barycentric subdivision is an important tool in simplicial homology theory, where it is used as a means of obtaining finer simplicial complexes (containing the original ones, i.e. with more simplices). This in turn is crucial to the simplicial approximation theorem, which roughly states that one can approximate any continuous function between polyhedra by a (finite) simplicial map, given a sufficient amount of subdivision of the respective simplicial complexes whom they realize. Ultimately, this approximation technique is a standard ingredient in the proof that simplicial homology groups are topological invariants.
|
|
ArgBP2 may exist in as many as 9 unique isoforms ranging from 52 kDa to 117 kDa (492 to 1100 amino acids). ArgBP2 belongs to the a small family of adaptor proteins having sorbin homology (SOHO) domains and three SH3 domains, which regulate cell adhesion, cytoskeletal organization and growth factor signaling; other members include CAP/ponsin and vinexin. The three SH3 domains are C-terminal, a serine-threonine rich domain resides in the middle, and the sorbin homology (SoHo) domain is N-terminal. The SH3 domains interact with Arg/Abl, vinculin.
|
|
The proposed models for adipose differentiation related protein (perilipin 2) is maintained by the protein model portal. It is based on homology modelling and no models were found with greater than 90 percent homology. Perlipin 2 has three different functional domains . 1-115 amino acid sequences at N-terminal is highly similar with other perlipin family proteins and is required for stabilization of lipid droplets, 103-215 mid- region is needed for binding at lipid droplets while the C-terminal sequence from 220-437 forms four helix bundle.
|
|
As mentioned above homology-based methods use a database to align the target protein gap with a known template protein. A database of known structures is searched for a loop that fits the gap of interest by similarity of sequence and stems (the edges of the gap created by the unknown loop structure). The success of this method largely depends on the quality of that alignment. Since the loop is the least conserved portion of a protein’s structure, the homology-based method cannot always find a known template that aligns with the target sequence.
|
|
Topological data analysis uses techniques from algebraic topology to determine the large scale structure of a set (for instance, determining if a cloud of points is spherical or toroidal). The main method used by topological data analysis is to: # Replace a set of data points with a family of simplicial complexes, indexed by a proximity parameter. # Analyse these topological complexes via algebraic topology – specifically, via the theory of persistent homology. # Encode the persistent homology of a data set in the form of a parameterized version of a Betti number, which is called a barcode.
|
|
A third construction, also due to Floer, associates homology groups to closed three-dimensional manifolds using the Yang–Mills functional. These constructions and their descendants play a fundamental role in current investigations into the topology of symplectic and contact manifolds as well as (smooth) three- and four-dimensional manifolds. Floer homology is typically defined by associating to the object of interest an infinite-dimensional manifold and a real valued function on it. In the symplectic version, this is the free loop space of a symplectic manifold with the symplectic action functional.
|
|
For the (instanton) version for three- manifolds, it is the space of SU(2)-connections on a three-dimensional manifold with the Chern–Simons functional. Loosely speaking, Floer homology is the Morse homology of the function on the infinite-dimensional manifold. A Floer chain complex is formed from the abelian group spanned by the critical points of the function (or possibly certain collections of critical points). The differential of the chain complex is defined by counting the function's gradient flow lines connecting certain pairs of critical points (or collections thereof).
|
|
Then the space of flat connections on \Sigma modulo gauge equivalence is a symplectic manifold M(\Sigma) of dimension 6g − 6, where g is the genus of the surface \Sigma. In the Heegaard splitting, \Sigma bounds two different 3-manifolds; the space of flat connections modulo gauge equivalence on each 3-manifold with boundary embeds into M(\Sigma) as a Lagrangian submanifold. One can consider the Lagrangian intersection Floer homology. Alternately, we can consider the Instanton Floer homology of the 3-manifold Y. The Atiyah–Floer conjecture asserts that these two invariants are isomorphic.
|
|
Phyre and Phyre2 (Protein Homology/AnalogY Recognition Engine; pronounced as 'fire') are free web-based services for protein structure prediction. Phyre is among the most popular methods for protein structure prediction having been cited over 1500 times.Number of results returned from a search on Google Scholar (Google Scholar search) Like other remote homology recognition techniques (see protein threading), it is able to regularly generate reliable protein models when other widely used methods such as PSI-BLAST cannot. Phyre2 has been designed to ensure a user-friendly interface for users inexpert in protein structure prediction methods.
|
|
The structure based alignments can be carried out using the most common structural aligners such as TMalign, Mustang, and sap. ;R-Coffee : a special mode of T-Coffee making it possible to align RNA sequences while using secondary structure information. ;PSI-Coffee : aligns distantly related proteins using homology extension (slow and accurate) ;TM-Coffee : aligns transmembrane proteins using homology extension ;Pro-Coffee : aligns homologous promoter regions ;Accurate : automatically combine the most accurate modes for DNA, RNA and proteins (experimental!) ;Combine : combines two (or more) multiple sequence alignments into a single one.
|
|
The editing site in NF1 mRNA was shown to have high homology to the ApoB editing site, where double stranded mRNA undergoes editing by the ApoB holoenzyme. NF1 mRNA editing was believed to involve the ApoB holoenzyme due to the high homology between the two editing sites, however studies have shown that this is not the case. The editing site in NF1 is longer than the sequence required for ApoB mediated mRNA editing, and the region contains two guanidines which are not present in the ApoB editing site.
|
|
In the 1960s, the sequence similarity of several proteases indicated that they were evolutionarily related. These were grouped into the chymotrypsin-like serine proteases (now called the S1 family). As the structures of these, and other proteases were solved by X-ray crystallography in the 1970s and 80s, it was noticed that several viral proteases such as Tobacco Etch Virus protease showed structural homology despite no discernible sequence similarity and even a different nucleophile. Based on structural homology, a superfamily was defined and later named the PA clan (by the MEROPS classification system).
|
|
Calciseptine is only found in the Black Mamba and can be purified from the crude venom. The snake can be milked to acquire the venom. Schweitz et al. used a three-step method to purify calciseptine to homology.
|
|
For any locally compact space X, Borel–Moore homology with integral coefficients is defined as the cohomology of the dual of the chain complex which computes sheaf cohomology with compact support.Birger Iversen. Cohomology of sheaves. Section IX.1.
|
|
Morse homology is a special case for the one-form df. A special case of Novikov's theory is circle-valued Morse theory, which Michael Hutchings and Yi-Jen Lee have connected to Reidemeister torsion and Seiberg–Witten theory.
|
|
In algebraic geometry, the h topology is a Grothendieck topology introduced by Vladimir Voevodsky to study the homology of schemes. It combines several good properties possessed by its related "sub"topologies, such as the qfh and cdh topologies.
|
|
A set of organisms from all domains of life was chosen and the sequence homology of the sulfatase motif was determined. The sequence used is the best consensus for sequences found in bacteria, archaea, worms and higher vertebrates.
|
|
As the result, RBPs can bind RNA with higher specificity and affinity than single domain. RNA-binding protein database has three main specific categories. They are RNA recognition motif (RRM), K-Homology domain (KH domain) and zinc fingers.
|
|
The function of this family of archeases as chaperones is supported by structural analysis of the archease from Methanobacterium thermoautotrophicum, which shows homology to heat shock protein 33, a chaperone protein that inhibits the aggregation of partially denatured proteins.
|
|
Although they differ in structure, these proteins are most closely related to the 12 TMS members of the CPA superfamily and exhibit demonstrable homology to the MadML malonate:H+ symporter (TC #2.A.70), although their sequence similarity is low.
|
|
A. August, A. Sadra, B. Dupont and H. Hanafusa. “Src induced activation of Inducible T cell Kinase (ITK) requires PI3 kinase activity and the Pleckstrin Homology domain of inducible T cell kinase.” (1997) Proc. Natl. Acad. Sci. 94: 11227.
|
|
J. Math. 75, pp.189–199 They discovered that, when topologists were writing proofs to establish equivalence of various homology theories, there were numerous similarities in the processes. Eilenberg and MacLane then discovered the theorem to generalize this process.
|
|
In mathematics, Tate cohomology groups are a slightly modified form of the usual cohomology groups of a finite group that combine homology and cohomology groups into one sequence. They were introduced by , and are used in class field theory.
|
|
Mature ground squirrel hepatitis sAg (GSHsAg) had 90% amino acid homology with woodchuck hepatitis sAg and is believed to be glycosylated. The ground squirrel hepatitis cAg (GSHcAg) is the most highly conserved protein sequence between GSHV, WHV, and HBV.
|
|
This homomorphism may be set in the context of group cohomology (strictly, group homology), providing a more abstract definition.Serre (1979) p.120 The transfer is also seen in algebraic topology, when it is defined between classifying spaces of groups.
|
|
Based on its homology to other members of the α-scorpion toxin family, bukatoxin most likely blocks the inactivation of neuronal sodium channels by binding to the neurotoxin receptor site 3 of sodium channels, thereby prolonging the action potential.
|
|
Calretinin, also known as calbindin 2, is a 29 kDa protein with 58% homology to calbindin 1 and principally found in nervous tissues. It is encoded in humans by the CALB2 gene and was formerly known as calbindin-D29k.
|
|
Structural homology in the PA superfamily (PA clan). The double β-barrel that characterises the superfamily is highlighted in red. Shown are representative structures from several families within the PA superfamily. Note that some proteins show partially modified structural.
|
|
Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Alternatively spliced transcript variants encoding different isoforms have been described.
|
|
Sequences with homology to JMTV have also been isolated from a red colobus monkey, suggesting the possibility of a segmented, possibly multicomponent virus capable of infecting primates. A metagenomics study of arthropod flaviviruses identified five additional examples of likely jingmenvirus sequences.
|
|
Despite sequence homology with MT-MMPs, the CTE is not a transmembrane domain and does not interact permanently with membrane. This unique feature for an MMP raises important questions about potential functions of MMP-27, which remains to be investigated.
|
|
Chlorotoxin is a small toxin and at pH 7 is highly positively charged. It is a peptide consisting of 36 amino acids, with 8 cysteines forming 4 disulfide bonds. Chlorotoxin has a considerable sequence homology to the class of small insectotoxins.
|
|
One says that relative homology is given by the relative cycles, chains whose boundaries are chains on A, modulo the relative boundaries (chains that are homologous to a chain on A, i.e., chains that would be boundaries, modulo A again).
|
|
Pleckstrin homology-like domain family B member 1 is a protein that in humans is encoded by the PHLDB1 gene. The first PHLDB1 cDNA was cloned from a rat pituitary cDNA library and named as LL5 after the clone number.
|
|
In the nuclear DNA however, homology with Paeonia rockii is largest, with lesser contributions from P. qiui, P. ostii, P. cathayana and P. jishanensis. Paeonia decomposita is the only species from the Vaginatae that has not contributed to these cultivars.
|
|
Dock10 was identified via bioinformatic approaches as one of a family of evolutionarily conserved proteins (the DOCK family) that share significant sequence homology. Dock10 is expressed in peripheral blood leukocytes as well as in the brain, spleen, lung and thymus.
|
|
USP20 is a 914-amino acid protein that shows 59% homology with another DUB, USP33. It contains 4 known domains, an N-terminal Zf UBP domain, a catalytic domain containing conserved histidine and cysteine residues, and two C-terminal DUSP domains.
|
|
Viruses can encode proteins with sequence homology to cyclins. One much-studied example is K-cyclin (or v-cyclin) from Kaposi sarcoma herpes virus (see Kaposi’s sarcoma), which activates CDK6. Viral cyclin-CDK complexes have different substrate specificities and regulation sensitivities.
|
|
Such features can be used to detect structures of molecules, tumors in X-rays, and cluster structures in complex data. More generally, simplicial homology plays a central role in topological data analysis, a technique in the field of data mining.
|
|
This gene is a putative oncogene encoding a protein belonging to the AKT subfamily of serine/threonine kinases that contain SH2-like (Src homology 2-like) domains. The encoded protein is a general protein kinase capable of phosphorylating several known proteins.
|
|
As of early 2016, no crystal structures had been determined. However, bioinformatics utilizing combinations of homology modelling and mutation experiments have been used to explore the heterdimer nature of the system as well as the mechanisms of substrate recognition and transport.
|
|
Iberiotoxin is a 37-amino acid peptide. The formula is C179H274N50O55S7. It is also known as "Potassium channel toxin alpha-KTx 1.3" or IbTx. The complete amino acid sequence has been defined and it displays 68% sequence homology with charybdotoxin.
|
|
The globular structure of bacteriocin AS-48 consists of five alpha helices enclosing a hydrophobic core. The mammalian NK- lysin effector protein of T and natural killer cells has a similar structure, though it lacks sequence homology with bacteriocins AS-48.
|
|
In mathematics, the Hurewicz theorem is a basic result of algebraic topology, connecting homotopy theory with homology theory via a map known as the Hurewicz homomorphism. The theorem is named after Witold Hurewicz, and generalizes earlier results of Henri Poincaré.
|
|
One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of PLA2 have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets (Seilhamer et al., 1986) .
|
|
Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric mitochondrial creatine kinase. Two genes located near each other on chromosome 15 (CKMT1A and CKMT1B (this gene)) have been identified which encode identical mitochondrial creatine kinase proteins.
|
|
This method generates recombination between genes with little to no sequence homology. These chimeras are fused via a linker sequence containing several restriction sites. This construct is then digested using DNase1. Fragments are made are made blunt ended using S1 nuclease.
|
|
The evolutionary biologist Günter P. Wagner described Goodwin's structuralism as "a fringe movement in evolutionary biology".Wagner, Günter P., Homology, Genes, and Evolutionary Innovation. Princeton University Press. 2014. Chapter 1: The Intellectual Challenge of Morphological Evolution: A Case for Variational Structuralism.
|
|
In topology, a branch of mathematics, a collapse reduces a simplicial complex (or more generally, a CW complex) to a homotopy-equivalent subcomplex. Collapses, like CW complexes themselves, were invented by J. H. C. Whitehead. Collapses find applications in computational homology.
|
|
In algebraic topology and abstract algebra, homology (in part from Greek ὁμός homos "identical") is a certain general procedure to associate a sequence of abelian groups or modules with a given mathematical object such as a topological space or a group.
|
|
Cytohesin-4 is a protein that in humans is encoded by the CYTH4 gene. This gene encodes a member of the cytohesin (CYTH) family, formerly known as the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of CYTHs with membranes.
|
|
Cytohesin-3 is a protein that in humans is encoded by the CYTH3 gene. This gene encodes a member of the cytohesin (CYTH) family, formerly known as the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. Cytohesin family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of CYTHs with membranes.
|
|
For example, homology groups are a functorial homotopy invariant: this means that if f and g from X to Y are homotopic, then the group homomorphisms induced by f and g on the level of homology groups are the same: Hn(f) = Hn(g) : Hn(X) → Hn(Y) for all n. Likewise, if X and Y are in addition path connected, and the homotopy between f and g is pointed, then the group homomorphisms induced by f and g on the level of homotopy groups are also the same: πn(f) = πn(g) : πn(X) → πn(Y).
|
|
Cladistics, either generally or in specific applications, has been criticized from its beginnings. Decisions as to whether particular character states are homologous, a precondition of their being synapomorphies, have been challenged as involving circular reasoning and subjective judgements. Transformed cladistics arose in the late 1970s in an attempt to resolve some of these problems by removing phylogeny from cladistic analysis, but it has remained unpopular. However, homology is usually determined from analysis of the results that are evaluated with homology measures, mainly the consistency index (CI) and retention index (RI), which, it has been claimed - makes the process objective.
|
|
The PYGL gene encodes one of three major glycogen phosphorylase isoforms, which are distinguished by their different structures and subcellular localizations: brain (PYGB), muscle (PYGM), and liver (PYGL). PYGL spans 846 amino acids and shares fairly high homology in amino acid sequence with the other two isozymes, with 73% similarity with PYGM and 74% similarity with PYGB. Nonetheless, PYGB and PYGM demonstrate greater homology to each other, indicating that PYGL evolved by a more distant descent from the common ancestral gene. This protein forms a homodimer, with each monomer composed of N-terminal and C-terminal domains of nearly equal size.
|
|
The common function of helicases accounts for the fact that they display a certain degree of amino acid sequence homology; they all possess sequence motifs located in the interior of their primary structure, involved in ATP binding, ATP hydrolysis and translocation along the nucleic acid substrate. The variable portion of the amino acid sequence is related to the specific features of each helicase. The presence of these helicase motifs allows putative helicase activity to be attributed to a given protein, but does not necessarily confirm it as an active helicase. Conserved motifs do, however, support an evolutionary homology among enzymes.
|
|
Uses of the structural models include protein–protein interaction prediction, protein–protein docking, molecular docking, and functional annotation of genes identified in an organism's genome. Even low-accuracy homology models can be useful for these purposes, because their inaccuracies tend to be located in the loops on the protein surface, which are normally more variable even between closely related proteins. The functional regions of the protein, especially its active site, tend to be more highly conserved and thus more accurately modeled. Homology models can also be used to identify subtle differences between related proteins that have not all been solved structurally.
|
|
Each thematic form of temple architecture permits nine styles of temples, and the Purana lists all 45 styles. The inner edifice of a temple is best in five shapes, in these various styles of temples, and the edifice can be triangle, lotus-shaped, crescent, rectangular and octagonal, asserts the text. The text thereafter describes the design guidelines for the Mandapa and the Garbha Griha. The temple design, states Jonathan Parry, follows the homology at the foundation of Hindu thought, that the cosmos and body are harmonious correspondence of each other, the temple is a model and reminder of this cosmic homology.
|
|
These studies have mostly been performed by biologically synthesizing batroxobin from Bothrops moojeni cDNA, and analyzing this product and using homology models based on other proteases, such as thrombin and trypsin, among others. One of the earlier studies from 1986 showed that the molecular weight is 25.503 kDa, 32.312 kDa with the carbohydrate, and it consists of 231 amino acids. The amino acid sequence exhibited significant homology with other known mammalian serine proteases, such as trypsin, thrombin, and most notably pancreatic kallikrein. It was therefore concluded that it is indeed a member of the serine protease family.
|
|
In algebraic topology, a branch of mathematics, the excision theorem is a theorem about relative homology and one of the Eilenberg–Steenrod axioms --given a topological space X and subspaces A and U such that U is also a subspace of A, the theorem says that under certain circumstances, we can cut out (excise) U from both spaces such that the relative homologies of the pairs (X \setminus U,A \setminus U ) into (X, A) are isomorphic. This assists in computation of singular homology groups, as sometimes after excising an appropriately chosen subspace we obtain something easier to compute.
|
|
Structural genomics involves taking a large number of approaches to structure determination, including experimental methods using genomic sequences or modeling-based approaches based on sequence or structural homology to a protein of known structure or based on chemical and physical principles for a protein with no homology to any known structure. As opposed to traditional structural biology, the determination of a protein structure through a structural genomics effort often (but not always) comes before anything is known regarding the protein function. This raises new challenges in structural bioinformatics, i.e. determining protein function from its 3D structure.
|
|
The ROCK1 structure is a serine/threonine kinase with molecular weight of 158 kDa. It is a homodimer composed of a catalytic kinase domain (residues76-338) located at the amino or N-terminus of the protein, a coiled-coil region (residues 425-1100) containing the Rho-binding domain, and a pleckstrin- homology domain (residues 1118-1317) with a cysteine-rich domain. When a substrate is absent, ROCK1 is an autoinhibited loop structure. Enzyme activity of ROCK1 is inhibited when the pleckstrin-homology and Rho-binding domains in the C-terminus independently bind to the N-terminus kinase domain.
|
|
The protein is made up of the two folding domains, the leucine zipper-like domain at the N-terminal and an olfactomedin-like domain at the C-terminal. The domain at the N-terminal is known to have 77.6% homology to the myosin heavy chain of Dictyostelium discoideum and 25% homology with the cardiac β-myosin heavy chain. The gene encodes three different exons, each consisting of different structural and functional domains. The N-terminal is encoded by exon 1 and contains the leucine zipper structural motif, which consists of 50 amino acid residues (117-169 amino acids).
|
|
Chapter 4 in Herbicide Classes in Development: Mode of Action, Targets, Genetic Engineering, Chemistry. Eds Peter Böger, Ko Wakabayashi, Kenji Hirai. Springer Science & Business Media, 2012 In the late 1980s scientists discovered enzymes in these Streptomyces species that selectively inactivate free phosphinothricin; the gene encoding the enzyme that was isolated from Streptomyces hygroscopicus was called the "bialaphos resistance" or "bar" gene, and the gene encoding the enzyme in Streptomyces viridochromeogenes was called "phosphinothricin acetyltransferase" or "pat". The two genes and their proteins have 80% homology on the DNA level and 86% amino acid homology, and are each 158 amino acids long.
|
|
This period of his work culminated in his book Composition methods in homotopy groups of spheres (1962). Here he uses as important tools the Toda bracket (which he calls the toric construction) and the Toda fibration, among others, to compute the first 20 nontrivial homotopy groups for each sphere. Among his most important contributions to stable homotopy theory is his work on the existence and non-existence of so-called Toda–Smith complexes. These are finite complexes which can be characterized as having a particularly simple ordinary homology (as modules over the Steenrod algebra) or, alternatively, by having a particularly simple BP-homology.
|
|
Cytohesin-2 (CYTH2), formerly known as Pleckstrin homology, Sec7 and coiled/coil domains 2 (PSCD2), is a member of the cytohesin family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of CYTHs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking.
|
|
In algebraic topology, the singular chain complex of a topological space X is constructed using continuous maps from a simplex to X, and the homomorphisms of the chain complex capture how these maps restrict to the boundary of the simplex. The homology of this chain complex is called the singular homology of X, and is a commonly used invariant of a topological space. Chain complexes are studied in homological algebra, but are used in several areas of mathematics, including abstract algebra, Galois theory, differential geometry and algebraic geometry. They can be defined more generally in abelian categories.
|
|
A relative index may be defined between pairs of fixed points, and the differential counts the number of holomorphic cylinders with relative index 1\. The symplectic Floer homology of a Hamiltonian symplectomorphism of a compact manifold is isomorphic to the singular homology of the underlying manifold. Thus, the sum of the Betti numbers of that manifold yields the lower bound predicted by one version of the Arnold conjecture for the number of fixed points for a nondegenerate symplectomorphism. The SFH of a Hamiltonian symplectomorphism also has a pair of pants product that is a deformed cup product equivalent to quantum cohomology.
|
|
The homological mirror symmetry conjecture of Maxim Kontsevich predicts an equality between the Lagrangian Floer homology of Lagrangians in a Calabi–Yau manifold X and the Ext groups of coherent sheaves on the mirror Calabi–Yau manifold. In this situation, one should not focus on the Floer homology groups but on the Floer chain groups. Similar to the pair- of-pants product, one can construct multi-compositions using pseudo- holomorphic n-gons. These compositions satisfy the A_\infty-relations making the category of all (unobstructed) Lagrangian submanifolds in a symplectic manifold into an A_\infty-category, called the Fukaya category.
|
|
Versuch die Metamorphose der Pflanzen zu erklären, known in English as Metamorphosis of Plants, was published by German poet and philosopher Johann Wolfgang von Goethe in 1790. In this work, Goethe essentially discovered the (serially) homologous nature of leaf organs in plants, from cotyledons, to photosynthetic leaves, to the petals of a flower. Although Sir Richard Owen, the British vertebrate anatomist, is generally credited with first articulating a definition of the word "homology" (in 1843), it is clear that Goethe had already arrived at a sophisticated view of homology and transformation (within an idealist morphological perspective) more than fifty years earlier.
|
|
Using the orientation of X one may assign to each of these points a sign; in other words intersection yields a 0-dimensional cycle. One may prove that the homology class of this cycle depends only on the homology classes of the original i- and (n-i)-dimensional cycles; one may furthermore prove that this pairing is perfect. When X has singularities--that is, when the space has places that do not look like \R^n--these ideas break down. For example, it is no longer possible to make sense of the notion of "general position" for cycles.
|
|
PatternHunter is a commercially available homology search instrument software that uses sequence alignment techniques. It was initially developed in the year 2002 by three scientists: Bin Ma, John Tramp and Ming Li. These scientists were driven by the desire to solve the problem that many investigators face during studies that involve genomics and proteomics. These scientists realized that such studies greatly relied on homology studies that established short seed matches that were subsequently lengthened. Describing homologous genes was an essential part of most evolutionary studies and was crucial to the understanding of the evolution of gene families, the relationship between domains and families.
|
|
In abstract algebra, one uses homology to define derived functors, for example the Tor functors. Here one starts with some covariant additive functor F and some module X. The chain complex for X is defined as follows: first find a free module F1 and a surjective homomorphism p1 : F1 → X. Then one finds a free module F2 and a surjective homomorphism p2 : F2 → ker(p1). Continuing in this fashion, a sequence of free modules Fn and homomorphisms pn can be defined. By applying the functor F to this sequence, one obtains a chain complex; the homology Hn of this complex depends only on F and X and is, by definition, the n-th derived functor of F, applied to X. A common use of group (co)homology H^2(G,M)is to classify the possible extension groups E which contain a given G-module M as a normal subgroup and have a given quotient group G, so that G = E/M.
|
|
MMP-27 was discovered and cloned in 1998 by Yang and Kurkinen. Initially compared to the so-called Chicken MMP (CMMP), MMP-27 actually shows very little sequence homology with this protease. Sequence homology predicts that the human MMP-27 gene encodes the canonical domains shared by most MMPs (annotation based on Uniprot entry Q9H306): (i) a signal peptide (residues 1-17), (ii) a propeptide (18-98) containing the cysteine switch motif (89-96), (iii) a catalytic domain (99-263) containing the typical HEXXHXXGXXH motif of the metzincins (M10 and M12 families of the MEROPS[2] database), (iv) a proline-rich hinge region (264-278) and (v) a hemopexin-like domain (279-465) folded as a four-bladed β-propeller through disulfide bond formation between the two flanking Cys residues (Cys279 and Cys465). MMP-27 could be classified in the stromelysin group of MMPs, since MMP-27 shows 51,6% homology with stromelysin-2 (MMP-10) and localizes in the cluster of MMPs located on chromosome 11.
|
|
Homology model of the DHRS7B protein created with Swiss-model and rendered with PyMOL Homology modeling, also known as comparative modeling of protein, refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental three-dimensional structure of a related homologous protein (the "template"). Homology modeling relies on the identification of one or more known protein structures likely to resemble the structure of the query sequence, and on the production of an alignment that maps residues in the query sequence to residues in the template sequence has been shown that protein structures are more conserved than protein sequences amongst homologues, but sequences falling below a 20% sequence identity can have very different structure. Evolutionarily related proteins have similar sequences and naturally occurring homologous proteins have similar protein structure. It has been shown that three-dimensional protein structure is evolutionarily more conserved than would be expected on the basis of sequence conservation alone.
|
|
This low- identity region is often referred to as the "twilight zone" within which homology modeling is extremely difficult, and to which it is possibly less suited than fold recognition methods. At high sequence identities, the primary source of error in homology modeling derives from the choice of the template or templates on which the model is based, while lower identities exhibit serious errors in sequence alignment that inhibit the production of high- quality models. It has been suggested that the major impediment to quality model production is inadequacies in sequence alignment, since "optimal" structural alignments between two proteins of known structure can be used as input to current modeling methods to produce quite accurate reproductions of the original experimental structure. Attempts have been made to improve the accuracy of homology models built with existing methods by subjecting them to molecular dynamics simulation in an effort to improve their RMSD to the experimental structure.
|
|
If A is a homology 3-sphere not homeomorphic to the standard 3-sphere, then the suspension of A is an example of a 4-dimensional homology manifold that is not a topological manifold. The double suspension of A is homeomorphic to the standard 5-sphere, but its triangulation (induced by some triangulation of A) is not a PL manifold. In other words, this gives an example of a finite simplicial complex that is a topological manifold but not a PL manifold. (It is not a PL manifold because the link of a point is not always a 4-sphere.) Galewski and Stern showed that all compact topological manifolds (without boundary) of dimension at least 5 are homeomorphic to simplicial complexes if and only if there is a homology 3 sphere Σ with Rokhlin invariant 1 such that the connected sum Σ#Σ of Σ with itself bounds a smooth acyclic 4-manifold.
|
|
In 1941, while studying H^2(G,\Z) (which plays a special role in groups), Heinz Hopf discovered what is now called Hopf's integral homology formula , which is identical to Schur's formula for the Schur multiplier of a finite, finitely presented group: : H_2(G,\Z) \cong (R \cap [F, F])/[F, R], where G\cong F/R and F is a free group. Hopf's result led to the independent discovery of group cohomology by several groups in 1943-45: Samuel Eilenberg and Saunders Mac Lane in the United States ; Hopf and Beno Eckmann in Switzerland; and Hans Freudenthal in the Netherlands . The situation was chaotic because communication between these countries was difficult during World War II. From a topological point of view, the homology and cohomology of G was first defined as the homology and cohomology of a model for the topological classifying space BG as discussed above. In practice, this meant using topology to produce the chain complexes used in formal algebraic definitions.
|
|
The fourth arches are supported by a midline fourth basibranchiale. An ossified operculum is present.Liston, J.J., 2008, "A review of the characters of the edentulous pachycormiforms Leedsichthys, Asthenocormus and Martillichthys nov. gen.", In: Mesozoic Fishes 4 Homology and Phylogeny, G. Arratia, H.-P.
|
|
ALKV has been found to be closely related to the Kyasanur Forest disease (KFD), with which it shares 89% nucleotide sequence homology. Close similarities indicate that these viruses diverged 700 years ago. Related viruses include Omsk hemorrhagic fever and Royal Farm virus.
|
|
The homology test for 40 N-terminal amino acid residues of all eleven components also demonstrates that T. akamusi hemoglobin consists of two different clusters. This further shows a very early separation of the N-type and L-type in the phylogenetic tree.
|
|
Through homology screens with the Drosophila per, these genes were discovered. It was independently discovered by Sun et al. 1997, naming it RIGUI and by Tei et al. 1997, who named it hper because of the protein sequence similarity with Drosophila per.
|
|
Transcription factor with homology to the AP-1 family links RNA transcription and DNA replication in the lytic cycle of Epstein-Barr virus. EMBO Journal. Vol 12, iss 10. It interacts with the viral helicase-primase complex El-Guindy et al. (2010).
|
|
Based on sequence homology, mammalian Gapex-5 has been shown to have an amino- terminal Ras GAP domain, a central polyproline (SH3 binding) region and a carboxy-terminal Rab GEF domain. The RabGEF domain has been suggested to activate Rab5 and Rab31.
|
|
The genome is 19,063 bases in length and encodes 20 predicted coding sequences. Seven have homology to the Maverick/Polinton family of transposons. The genome encodes a retroviral integrase, an adenosine triphosphatase (ATPase), a cysteine protease and a protein primed DNA polymerase B.
|
|
Med Princ Pract 2007;16:167-80. Based on the high degree of homology between porcine and human enamel proteins, it was decided to produce the EMD from fetal pigs.Brooks, SJ, et al. _Biochemistry and molecular biology of amelogenin proteins of developing dental enamel_.
|
|
This family member is an inositol 1,3,4,5-tetrakisphosphate-binding protein, like the closely related RAS p21 protein activator 2. The two family members have distinct pleckstrin-homology domains, with this particular member having a domain consistent with its localization to the plasma membrane.
|
|
The discovery of DmX was published in the journal Gene in 1998. It was discovered using a comparative genomics approach that found sequence homology to CpY, a gene found in the sex determining region of the Y chromosome of the hoverfly C. piger.
|
|
These larger cathelicidins display repetitive proline motifs forming extended polyproline-type structures. The cathelicidin family shares primary sequence homology with the cystatin family of cysteine proteinase inhibitors, although amino acid residues thought to be important in such protease inhibition are usually lacking.
|
|
PomA is a protein that is part of the stator in Na+ driven bacterial flagella. It has a high degree of homology to MotA, and Rhodobacter sphaeroides MotA can functionally complement a non-motile Vibrio alginolyticus with a non- functional pomA gene.
|
|
This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol- binding domain.
|
|
The CDC25 homology domain, also called the RasGEF domain, is the catalytic domain of many Ras GEFs, which activate Ras GTPases. The CDC25 domain comprises approximately 500 amino acids and was first identified in the CDC25 protein in budding yeast (Saccharomyces cerevisiae).
|
|
Evolutionary relationships between different alpha solenoid proteins are difficult to trace due to the low sequence homology of the repeats. Convergent evolution of similar protein structures from ancestrally unrelated proteins is thought to be significant in the evolutionary history of this fold class.
|
|
CLPTM1 encodes a transmembrane protein and has strong homology to two Caenorhabditis elegans genes, suggesting that CLPTM1 may belong to a new gene family. This family also contains the Homo sapiens cisplatin resistance related protein CRR9p which is associated with CDDP-induced apoptosis.
|
|
Loop of length 10 constructed using 6 fragments, each of length 4. Only overlaps of 2 were used in this 2D model. Anchor points are circled. In homology modeling, a common application of fragment libraries is to model the loops of the structure.
|
|
The scientists used injection of Cas9 protein complexed with the relevant sgRNAs and homology donors into human embryos. The scientists found homologous recombination-mediated alteration in HBB and G6PD. The scientists also noted the limitations of their study and called for further research.
|
|
Gap Repair Cloning. The blue arrows represent DNA contigs. Segments of the same colour represent complementary or identical sequences. Specialized primers with extensions are used in a polymerase chain reaction to generate regions of homology at the terminal ends of the DNA contigs.
|
|
The usual four steps of homology modeling are executed: # search for a template (similar sequence of known structure), # align query and template sequences, # build the 3D model using the last alignment and the structure of the template and # assess the final 3D model.
|
|
It was difficult to obtain a stable crystal of dopamine beta-hydroxylase. Hence an homology model based on the primary sequence and comparison to PHM is available. in silico prediction and physiochemical validation However, a crystal structure was also put forward in 2016.
|
|
A digestive organ called the hepatic caecum is found in the cephalochordate amphioxus, or lancelet. The hepatic caecum of the amphioxus is a presumed homologue of the vertebrate liver, although it is not undisputed. This homology was first hypothesized by Müller in 1844.
|
|
Gap Repair Cloning. The blue arrows represent DNA contigs. Segments of the same colour represent complementary or identical sequences. Specialized primers with extensions are used in a polymerase chain reaction to generate regions of homology at the terminal ends of the DNA contigs.
|
|
John Coleman Moore (May 27, 1923 – January 1, 2016) was an American mathematician. The Borel−Moore homology and Eilenberg–Moore spectral sequence are named after him.. Updated February 2005. Moore was born in 1923 in Staten Island, New York.Pamela Kalte et al.
|
|
In algebraic topology, a discipline within mathematics, the acyclic models theorem can be used to show that two homology theories are isomorphic. The theorem was developed by topologists Samuel Eilenberg and Saunders MacLane.S. Eilenberg and S. Mac Lane (1953), "Acyclic Models." Amer.
|
|
SGEF ( _S_ rc homology 3 domain-containing _G_ uanine nucleotide _E_ xchange _F_ actor) is a 97 kDa protein involved in intracellular signalling networks. It functions as a guanine nucleotide exchange factor (GEF) for RhoG, a small G protein of the Rho family.
|
|
The Atiyah–Floer conjecture connects the instanton Floer homology with the Lagrangian intersection Floer homology.M.F. Atiyah, "New invariants of three and four dimensional manifolds" Proc. Symp. Pure Math., 48 (1988) Consider a 3-manifold Y with a Heegaard splitting along a surface \Sigma.
|
|
The Bardet-Biedl syndrome 10 protein has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes.
|
|
Glucose movement from the cytoplasm to the ER of the HEK293T cells was monitored by quantifying changes in FRET ratio. By using this assay, the first member of the SWEET family, AtSWEET1, was identified. Other potential family members were identified by sequence homology.
|
|
Protein KIAA1958 is a protein that in humans is encoded by the KIAA1958 gene. Orthologs of KIAA1958 go as far back in evolution to chordates, although, it is closer in homology to primates than any other orthologs. KIAA1958 has no known paralogs.
|
|
Pages 7–38, 125 He forms a structuralist picture of evolutionary developmental biology, using empirical evidence, arguing that homology and biological novelty are key aspects requiring explanation, and that developmental bias (i.e. structural constraints on embryonic development) is a key explanation for these.
|
|
Stammbach's research deals with homological algebra, specifically with its applications to group theory ( homology and cohomology of groups). He also does research on the history of mathematics, especially pertaining to Switzerland. In 1990–1991 he was president of the Swiss Mathematical Society.
|
|
In mathematics, a fake 4-ball is a compact contractible topological 4-manifold. Michael Freedman proved that every three-dimensional homology sphere bounds a fake 4-ball. His construction involves the use of Casson handles and so does not work in the smooth category.
|
|
The first known sequence is used to annotate the first unknown sequence, but what is happening is that the first unknown sequence is being used to annotate the second unknown sequence and so on. Sequence homology is only a modestly reliable predictor of function.
|
|
Also known as pc; MOD2. In human ortholog CBX2, synonyms CDCA6, M33, SRXY5 from orthology source HGNC. M33 was isolated by means of the structural similarity of its chromodomain. It contains a region of homology shared by Xenopus and Drosophila in the fifth exon.
|
|
Intraorganismal homology, character construction, and the phylogeny of aetosaurian archosaurs (Reptilia, Diapsida). Systematic Biology 52(2):239-252. The presence of elongate lateral osteoderm horns is shared by all of these genera, which make up the subfamily Desmatosuchinae.Martz, J. W. and Small, B. J. (2006).
|
|
Instead they are often globular and soluble. The protein epsin is an example. Epsin has an ENTH (epsin N-terminal homology) domain which inserts its amphipathic alpha helix into the membrane. Epsin has high binding affinity for the membrane if PI-4,5-P2 is present.
|
|
Several V segments and three C segments are known to be incapable of encoding a protein and are considered pseudogenes. The locus also includes several non-immunoglobulin genes, many of which are pseudogenes or are predicted by automated computational analysis or homology to other species.
|
|
They developed the first efficient gene targeting method for the model plant Arabidopsis. They have also developed an elegant tandem repeat-HDR (homology-directed repair) approach for efficient sequence insertion and replacement in rice, which is important for crop functional genomics research and breeding.
|
|
This is a timeline of bordism, a topological theory based on the concept of the boundary of a manifold. For context see timeline of manifolds. Jean Dieudonné wrote that cobordism returns to the attempt in 1895 to define homology theory using only (smooth) manifolds.
|
|
Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that contains a high level of sequence similarity with ribosomal protein S11P family members.
|
|
However, current force field parameterizations may not be sufficiently accurate for this task, since homology models used as starting structures for molecular dynamics tend to produce slightly worse structures. Slight improvements have been observed in cases where significant restraints were used during the simulation.
|
|
Most bacteria have a homologous structure, FtsZ. Prosthecobacter are the exception to this, containing genes that have higher sequence-homology to eukaryotic tubulin than FtsZ. These genes are called bacterial tubulin a (BtubA) and bacterial tubulin b (BtubB). The properties are not exactly same.
|
|
Cannon, Bryant and Lacher established that the conjecture holds under the assumption that M be a manifold except possibly at a set of dimension (n-2)/2. Later Frank QuinnFrank Quinn. Resolutions of homology manifolds, and the topological characterization of manifolds. Inventiones Mathematicae, vol.
|
|
Beta is a protein that binds to single stranded DNA and assists homologous recombination by promoting annealing between the homology regions of the inserted DNA and the chromosomal DNA. Gam functions to protect the DNA insert from being destroyed by native nucleases within the cell.
|
|
The basic point is that sphere complements determine the homology, but not the homotopy type, in general. What is determined, however, is the stable homotopy type, which was conceived as a first approximation to homotopy type. Thus Spanier-Whitehead duality fits into stable homotopy theory.
|
|
In algebraic topology, homological connectivity is a property describing a topological space based on its homology groups. This property is related, but more general, than the properties of graph connectivity and topological connectivity. There are many definitions of homological connectivity of a topological space X.
|
|
UBE2V2 has sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene also shares homology with ubiquitin- conjugating enzyme E2 variant 1 and yeast MMS2 gene product.
|
|
GeneCards lists five aliases for TNRC18, Long CAG Trinucleotide Repeat-Containing Gene 79 Protein, Trinucleotide Repeat-Containing Gene 18 Protein, CAGL79, KIAA1856, and TNRC18A. Additionally, TNRC18 has two paralogs, BAH Domain And Coiled-Coil Containing 1 (BAHCC1) and Bromo Adjacent Homology Domain Containing 1 (BAHD1).
|
|
HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase.
|
|
Flamingo is a member of the adhesion-GPCR family of proteins. Flamingo has sequence homology to cadherins and G protein-coupled receptors (GPCR). Flamingo was originally identified as a Drosophila protein involved in planar cell polarity. Mammals have three flamingo homologs, CELSR1, CELSR2, CELSR3.
|
|
A peptide derived from the terminus of the extracellular domain shares structural homology with certain neuropeptides. There are four teneurin genes in vertebrates, named teneurin-1 through -4. Other names found in the literature include Odz-1 through -4 and Tenm-1 through -4.
|
|
Voltage-gated chloride channels display a variety of important physiological and cellular roles that include regulation of pH, volume homeostasis, organic solute transport, cell migration, cell proliferation and differentiation. Based on sequence homology the chloride channels can be subdivided into a number of groups.
|
|
In mathematics, a bivariant theory was introduced by Fulton and MacPherson , in order to put a ring structure on the Chow group of a singular variety, the resulting ring called an operational Chow ring. On technical levels, a bivariant theory is a mix of a homology theory and a cohomology theory. In general, a homology theory is a covariant functor from the category of spaces to the category of abelian groups, while a cohomology theory is a contravariant functor from the category of (nice) spaces to the category of rings. A bivariant theory is a functor both covariant and contravariant; hence, the name “bivariant”.
|
|
Additionally in most animals, these genes are laid out along the chromosome similar to the order in which they are expressed along the anterior–posterior axis. Variants of the Hox genes are found almost in every phylum with the exception of the sponge which use a different type of developmental genes. The homology of these genes is of important interest to scientists as they may hold more answers to the evolution of many species. In fact, these genes demonstrate such a high degree of homology that a human Hox gene variant – HOXB4 – could mimic the function of its homolog in the fruit fly (Drosophila).
|
|
Evidence for Woese's dogma is well established through comparisons of RNA homology. Modern research allows more liberal use of RNA sequencing, allowing for a better comparative analysis between distant RNA. When analyzing multiple strains of E. coli, Root-Bernstein et. al. have compared tRNA encodings found within rRNA with tRNA found in E. coli to see if the secondary structure was the same as more “modern” tRNA present in E. coli. Comparisons between the tRNA encodings found in the rRNAs and mRNAs of the control sequences found that “sortings” for these sequences were extremely similar, and comparisons of translated protein structure indicated that homology was likely.
|
|
RecA first polymerizes along a stretch of single-stranded DNA, and then this protein-DNA filament searches for homology along double-stranded DNA. In the RecA-DNA filament, the distance between bases increases significantly with respect to the bare 3.4 Å in the double-strand (by 50% on average). This sets a significant energetic barrier on the search, since the double-stranded DNA has to stretch by the same magnitude to check for homology. By formulating the DNA recognition process as a signal detection problem, it was shown that the experimentally observed RecA-induced DNA deformation and the binding energetics are fine-tuned to ensure optimal sequence detection.
|
|
In mathematics, a smooth algebraic curve C in the complex projective plane, of degree d, has genus given by the genus–degree formula :g = (d-1)(d-2)/2. The Thom conjecture, named after French mathematician René Thom, states that if \Sigma is any smoothly embedded connected curve representing the same class in homology as C, then the genus g of \Sigma satisfies the inequality :g \geq (d-1)(d-2)/2. In particular, C is known as a genus minimizing representative of its homology class. It was first proved by Peter Kronheimer and Tomasz Mrowka in October 1994, using the then-new Seiberg–Witten invariants.
|
|
Model categories can provide a natural setting for homotopy theory: the category of topological spaces is a model category, with the homotopy corresponding to the usual theory. Similarly, objects that are thought of as spaces often admit a model category structure, such as the category of simplicial sets. Another model category is the category of chain complexes of R-modules for a commutative ring R. Homotopy theory in this context is homological algebra. Homology can then be viewed as a type of homotopy, allowing generalizations of homology to other objects, such as groups and R-algebras, one of the first major applications of the theory.
|
|
The method of homology modeling is based on the observation that protein tertiary structure is better conserved than amino acid sequence. Thus, even proteins that have diverged appreciably in sequence but still share detectable similarity will also share common structural properties, particularly the overall fold. Because it is difficult and time-consuming to obtain experimental structures from methods such as X-ray crystallography and protein NMR for every protein of interest, homology modeling can provide useful structural models for generating hypotheses about a protein's function and directing further experimental work. There are exceptions to the general rule that proteins sharing significant sequence identity will share a fold.
|
|
Structure of Muniscin proteins and a dimer of FCHO proteins endophilin-A1. The μ homology domain of muniscins evolved from TCUP The muniscin protein family was initially defined in 2009 as proteins having 2 homologous domains that are involved in clathrin mediated endocytosis (CME) and have been reviewed. In addition to FCHO1, FCHO2 and Syp1, SGIP1 is also included in the family because it contains the μ (mu) homology domain and is involved in CME, even though it does not contain the F-BAR domain Muniscins are known as alternate cargo adaptors. That is, they participate in selecting which cargo molecules are internalized via CME.
|
|
L. crispatus was first isolated in 1953 by Brygoo and Aladame, who proposed it as a new species of the genus Eubacterium. In the 1970s the type strain VPI 3199 (ATCC 33820) of L. crispatus (at the time still designated “Eubacterium crispatum”) was deposited in the collection of the Anaerobe Laboratory, Virginia Polytechnic Institute and State University (VPI), where it was identified as a Lactobacillus and characterized by Moore and Holdeman. Addressing the problem of genetic heterogeneity among a vast number of strains identified as L. acidophilus based on phenotypic similarity, Johnson et al. performed DNA homology experiments on 89 previously proposed L. acidophilus strains and delineated six distinct homology groups.
|
|
SAPs (single amino acid polymorphisms) and nsSNPs non-synonymous single nucleotide polymorphisms are key elements that can lead to different "protein species" or "proteomorphs". The term dark proteome coined by Perdigão and colleagues, defines regions of proteins that have no detectable sequence homology to other proteins of known three-dimensional structure and therefore cannot be modeled by homology. For 546,000 Swiss-Prot proteins, 44–54% of the proteome in eukaryotes and viruses was found to be "dark", compared with only ∼14% in archaea and bacteria. Currently, several projects aim to map the human proteome, including the Human Proteome Map, ProteomicsDB and The Human Proteome Project (HPP).
|
|
In the 2004 CASP6 experiment, Rosetta made history by being the first to produce a close to atomic-level resolution, ab initio protein structure prediction in its submitted model for CASP target T0281. Ab initio modeling is considered an especially difficult category of protein structure prediction, as it does not use information from structural homology and must rely on information from sequence homology and modeling physical interactions within the protein. Rosetta@home has been used in CASP since 2006, where it was among the top predictors in every category of structure prediction in CASP7. These high quality predictions were enabled by the computing power made available by Rosetta@home volunteers.
|
|
In algebraic geometry, the Chow groups (named after Wei-Liang Chow by ) of an algebraic variety over any field are algebro-geometric analogs of the homology of a topological space. The elements of the Chow group are formed out of subvarieties (so-called algebraic cycles) in a similar way to how simplicial or cellular homology groups are formed out of subcomplexes. When the variety is smooth, the Chow groups can be interpreted as cohomology groups (compare Poincaré duality) and have a multiplication called the intersection product. The Chow groups carry rich information about an algebraic variety, and they are correspondingly hard to compute in general.
|
|
It served to put the homology theory of the time--the first decade of the twentieth century--on a rigorous basis, since it showed that the topological effect (on homology groups) of continuous mappings could in a given case be expressed in a finitary way. This must be seen against the background of a realisation at the time that continuity was in general compatible with the pathological, in some other areas. This initiated, one could say, the era of combinatorial topology. There is a further simplicial approximation theorem for homotopies, stating that a homotopy between continuous mappings can likewise be approximated by a combinatorial version.
|
|
A radical British school of comparative anatomy that included the anatomist Robert Edmond Grant was closely in touch with Lamarck's French school of Transformationism. One of the French scientists who influenced Grant was the anatomist Étienne Geoffroy Saint-Hilaire, whose ideas on the unity of various animal body plans and the homology of certain anatomical structures would be widely influential and lead to intense debate with his colleague Georges Cuvier. Grant became an authority on the anatomy and reproduction of marine invertebrates. He developed Lamarck's and Erasmus Darwin's ideas of transmutation and evolutionism, and investigated homology, even proposing that plants and animals had a common evolutionary starting point.
|
|
RhoGEF domain describes two distinct structural domains with guanine nucleotide exchange factor (GEF) activity to regulate small GTPases in the Rho family. Rho small GTPases are inactive when bound to GDP but active when bound to GTP; RhoGEF domains in proteins are able to promote GDP release and GTP binding to activate specific Rho family members, including RhoA, Rac1 and Cdc42. The largest class of RhoGEFs is composed of proteins containing the "Dbl-homology" (DH) domain, which almost always is found together with a pleckstrin-homology (PH) domain to form a combined DH/PH domain structure. A distinct class of RhoGEFs is those proteins containing the DOCK/CZH/DHR-2 domain.
|
|
The first is the Klein bottle times S1 and other is the surface bundle associated to a Dehn twist of the Klein bottle. They are homeomorphic to the torus bundles {b; (n1, 2);}. {0; (n1, 1); (2, 1), (2, 1)} Homeomorphic to the non-orientable Euclidean Klein bottle bundle {1; (n3, 2);}, with first homology Z + Z/4Z. {b; (n1, 2); } (b is 0 or 1) These are the non-orientable Euclidean surface bundles associated with orientation reversing order 2 automorphisms of a 2-torus with no fixed points. The first homology is Z+Z+Z/2Z if b=0, and Z+Z if b=1.
|
|
Also, since it works by approximating the outline by a series of ellipses, it deals poorly with pointed shapes. One criticism of outline-based methods is that they disregard homology – a famous example of this disregard being the ability of outline-based methods to compare a scapula to a potato chip. Such a comparison which would not be possible if the data were restricted to biologically homologous points. An argument against that critique is that, if landmark approaches to morphometrics can be used to test biological hypotheses in the absence of homology data, it is inappropriate to fault outline-based approaches for enabling the same types of studies.
|
|
In algebraic topology, a Poincaré space is an n-dimensional topological space with a distinguished element µ of its nth homology group such that taking the cap product with an element of the kth cohomology group yields an isomorphism to the (n − k)th homology group. The space is essentially one for which Poincaré duality is valid; more precisely, one whose singular chain complex forms a Poincaré complex with respect to the distinguished element µ. For example, any closed, orientable, connected manifold M is a Poincaré space, where the distinguished element is the fundamental class [M]. Poincaré spaces are used in surgery theory to analyze and classify manifolds.
|
|
As a member of the histidine triad nucleotide-binding (Hint) protein family, which is a subfamily of the histidine triad (HIT) family, HINT2 contains a conserved histidine and HIT sequence motif (His-X-His-X-His-X-X), and the latter two histidines contribute to a catalytic triad. The 163-amino acid protein encoded by this gene forms a 17-kDa homodimer. Compared to other members of the Hint family, HINT2 has a 61% sequence homology to HINT1 and 28% sequence homology to HINT3. When compared with HINT1, the 35–amino acid extension at the HINT2 N-terminal corresponds to a predicted mitochondria import signal.
|
|
SH2-domain containing Phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase 2 is an enzyme that in humans is encoded by the INPPL1 gene. INPPL1 encodes inositol polyphosphate-5 phosphatase-like 1, a protein that in addition to the phosphatase domain contains an SH2 (src-homology domain 2) motif.
|
|
BHLHE41/DEC2 and BHLHE40/DEC1 share 97% homology in the BHLH domain. After the identification of the BHLHE41 gene, Dr. Ken-Ichi Honma's lab characterized its role as a regulator in the mammalian circadian clock. The role of BHLHE41 in other pathways is still being fully characterized.
|
|
The modification of proteins with Ufm1 is also reversible. Two novel cysteine proteases have been identified to date (UFSP1 and UFSP2) which cleave Ufm1-peptide C-terminal fusions and also removes Ufm1 from native intracellular conjugates. These proteases have no obvious homology to ubiquitin deconjugating enzymes.
|
|
Kalicludine has 40% homology with BPTIs. The most represented sequences of this group corresponds with kalicludine-3 and kalicludine-4, a recently found polypeptide. A. sulcata kalicludines include AsKC1, AsKC2, and AsKC3., which are related to Bunodosoma granulifera toxin k (BgK) and Stichodactyla helianthus toxin k (ShK).
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein.
|
|
Native FoldX is run from the command line. A FoldX plugin for the YASARA molecular graphics program has been developed to access various FoldX tools inside a graphical environment. The results of e.g. in silico mutations or homology modeling with FoldX can be directly analyzed on screen.
|
|
The thrombopoietin gene is located on the long arm of chromosome 3 (q26.3-27). Abnormalities in this gene occur in some hereditary forms of thrombocytosis (high platelet count) and in some cases of leukemia. The first 155 amino acids of the protein share homology with erythropoietin.
|
|
It has high homology with erythropoietin. It is essential for the formation of an adequate quantity of platelets. After budding off platelets, what remains is mainly the cell nucleus. This crosses the bone marrow barrier to the blood and is consumed in the lung by alveolar macrophages.
|
|
This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Several transcript variants encoding different isoforms have been identified.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein.
|
|
The Topaz application contains all the functions relating to abstract simplicial complexes. Many advance topological calculations over simplicial complexes can be performed like homology groups, orientation, fundamental group. There is also a combinatorial collection of properties that can be computed like a shelling and Hasse diagrams.
|
|
Its function(s) are unknown. However, due to sequence homology of its protein with SR splicing factors, it is widely believed that the protein is nuclear and may have a role in splicing regulation. The protein is believed to be a mediator in the RAC1 signalling pathway.
|
|
In mathematics, the intersection form of an oriented compact 4-manifold is a special symmetric bilinear form on the 2nd (co)homology group of the 4-manifold. It reflects much of the topology of the 4-manifolds, including information on the existence of a smooth structure.
|
|
Families are sometimes grouped together into larger clades called superfamilies based on structural and mechanistic similarity, even if there is no identifiable sequence homology. Currently, over 60,000 protein families have been defined, although ambiguity in the definition of protein family leads different researchers to wildly varying numbers.
|
|
Aldosterone synthase is encoded on chromosome 8q22 by the CYP11B2 gene. The gene contains 9 exons and spans roughly 7000 base pairs of DNA. CYP11B2 is closely related with CYP11B1. The two genes show 93% homology to each other and are both encoded on the same chromosome.
|
|
The function of DEPDC5 is not yet known, but it has been implicated in intracellular signal transduction based on homology between the DEP domains of DEPDC5 and Dishevelled-1 (DVL1). Mutations in this gene have been associated to cases of focal epilepsy (doi:10.1038/ng.2601).
|
|
DNMT3A is a 130 kDa protein encoded by 23 exons found on chromosome 2p23 in humans. There exists a 98% homology between human and murine homologues. Due to splicing, there exist two main murine RNA isoforms, Dnmt3a1 and Dnmt3a2. These isoforms exist in different cell types.
|
|
HSSP is a database that combines structural and sequence information about proteins. This database has the information of the alignment of all available homologs of proteins from the PDB database As a result of this, HSSP is also a database of homology-based implied protein structures.
|
|
Bacteroides caccae is a saccharolytic gram-negative bacterium from the genus Bacteroides. They are obligate anaerobes first isolated from human feces in the 1980s. Prior to their discovery, they were known as the 3452A DNA homology group. The type strain is now identified as ATCC 43185.
|
|
Sexual methods of directed evolution involve in vitro recombination which mimic natural in vivo recombination. Generally these techniques require high sequence homology between parental sequences. These techniques are often used to recombine two different parental genes, and these methods do create cross overs between these genes.
|
|
KLF2 also exhibits these structural features. The mRNA transcript is approximately 1.5 kilobases in length, and the 37.7 kDa protein contains 354 amino acids. KLF2 also shares some homology with EKLF at the N-terminus with a proline-rich region presumed to function as the transactivation domain.
|
|
The composition of GAG chains of biglycan and decorin originating from the same tissue has been reported to be similar. The structure of biglycan core protein is highly conserved across species; over 90% homology has been reported for rat, mouse, bovine and human biglycan core proteins.
|
|
CD32A binds IgG2 immune complexes, but not IgG4. CD32B and CD32C bind IgG4 immune complexes, but not IgG2. The usage of monoclonal antibodies can distinguish between CD32A and CD32B; however, the high degree of homology between the extracellular domains of CD32A and CD32C make differentiation difficult.
|
|
In this region of HsNV-2, three ORFs are found: Hz2V008, Hz2V091, and Hz2V092. In total, 14 ORFs identified in HsNV-2 are not found in the HzNV-1 genome. None of which have been determined to share sequence homology with any genes of known function.
|
|
However, recent additions to this family show some degree of homology to one or more of the existing members of the OXA beta-lactamase family. Some confer resistance predominantly to ceftazidime, but OXA-17 confers greater resistance to cefotaxime and cefepime than it does resistance to ceftazidime.
|
|
Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. The gene is biallelically expressed, despite its location within a region of imprinted genes on chromosome 11.
|
|
RASEF is a 740 amino acids long protein which contains 3 distinct regions: 2 EF hand domains (which in turn contain 2 Calcium bindings and 3 nucleotide bindings -assumed by similarity with other proteins, without direct evidence-), a Coiled Coil region and a C-terminal Rab-homology domain.
|
|
Brower, A. V. Z. and M. C. C. de Pinna. (2012). "Homology and errors". Cladistics 28:529-538 doi/510.1111/j.1096-0031.2012.00398.x Shared ancestral character states, symplesiomorphies, represent either synapomorphies of a more inclusive group, or complementary states (often absences) that unite no natural group of organisms.
|
|
Significant similarity is strong evidence that two sequences are related by divergent evolution from a common ancestor. Alignments of multiple sequences are used to discover the homologous regions. Homology remains controversial in animal behaviour, but there is suggestive evidence that, for example, dominance hierarchies are homologous across the primates.
|
|
Erythroferrone in humans is transcribed as a precursor of 354 amino acids, with a signal peptide of 28 amino acids. The mouse gene encodes a 340 amino acid protein which is 71% identical. Homology is greater at the C-terminal where there is a TNF-alpha-like domain.
|
|
Although it bears homology to some drug-metabolizing cytochrome P450s, it is unknown whether the enzyme is also involved in xenobiotic metabolism. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Alternate splicing of this gene results in three transcript variants encoding different isoforms.
|
|
In homological algebra and algebraic topology, a spectral sequence is a means of computing homology groups by taking successive approximations. Spectral sequences are a generalization of exact sequences, and since their introduction by , they have become important computational tools, particularly in algebraic topology, algebraic geometry and homological algebra.
|
|
The subfamily α-KTx15 consists of 6 toxins. The first five toxins of this subfamily are very much alike, but discrepin only shares 50% amino acid homology with other members of this subfamily. Discrepin contains 38 amino acid residues. It has a polyglutamic acid at its N-terminal region.
|
|
She won a scholarship to study at Somerville College, Oxford, where she concentrated on topology in her mathematical studies with Henry Whitehead, earning a second-class degree in 1953. She earned her doctorate at the University of Warsaw, with a dissertation titled "The Homology of Cartesian Product Spaces" (1966).
|
|
One of the applications of cyclic homology is to find new proofs and generalizations of the Atiyah-Singer index theorem. Among these generalizations are index theorems based on spectral triplesAlain Connes and Henri Moscovici. The local index formula in noncommutative geometry. Geom. Funct. Anal., 5(2):174–243, 1995.
|
|
This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility.
|
|
The protein encoded by this gene has significant homology to NADH oxidoreductases and the apoptosis-inducing factor PDCD8/AIF. Overexpression of this gene has been shown to induce apoptosis. The expression of this gene is found to be induced by tumor suppressor protein p53 in colon cancer cells.
|
|
The combined use of a pharmacophore model, assembled from highly optimized TRPV1 antagonists, with a homology model of the protein has enhanced understanding of the observed structure–activity relationships of many series of current TRPV1 antagonists, and should be useful in the discovery of new classes of antagonists.
|
|
KASH domains are conserved C-terminal protein regions less than ~30 amino acids. KASH is an acronym for Klarsicht, ANC-1, Syne Homology. KASH domains always follow a transmembrane domain. Most proteins containing KASH domains are thought to be involved in the positioning of the nucleus in the cell.
|
|
In 1988, M. Atiyah published a paper in which he described many new examples of topological quantum field theory that were considered at that time . It contains some new topological invariants along with some new ideas: Casson invariant, Donaldson invariant, Gromov's theory, Floer homology and Jones-Witten theory.
|
|
Simone Fior and Per Ola Karis. 2007. "Phylogeny, evolution, and systematics of Moehringia (Caryophyllaceae) as inferred from molecular and morphological data: a case of homology reassessment." Cladistics 23(4):362-372. In 2007, Fior and Karis transferred four species from Moehringia to Arenaria, leaving Moehringia with 27 species.
|
|
C5orf34 is highly conserved in primates and mammals and moderately conserved in reptiles. The furthest conserved ortholog is in Python bivittatus, or the Burmese python. Below is a selected list of orthologs to demonstrate the homology of this gene with relation to the reference sequence in Homo sapiens.
|
|
The 44-way comparative track on the human assembly clearly shows that the farther one goes back in evolutionary time, the less sequence homology remains, but functionally important regions of the genome (e.g., exons and control elements, but not introns typically) are conserved much farther back in evolutionary time.
|
|
It is 360 amino acids in length. It is expressed ubiquitously but only in G1/S phase of the cell cycle. The human and mouse mRNAs of this protein have 77% homology. Two types of amino acid clusters have been observed, a serine cluster and a basic cluster.
|
|
In archaea, the heterohexamer ring is replaced by a homohexamer made up of a single type mcm protein, pointing at a history of gene duplicaion and diversification. Mcm1 and Mcm10 are also involved in DNA replication, directly or indirectly, but have no sequence homology to the Mcm2-7 family.
|
|
Arachidonic acid is both a signaling molecule and the precursor for the synthesis of other signaling molecules termed eicosanoids. These include leukotrienes and prostaglandins. Some eicosanoids are synthesized from diacylglycerol, released from the lipid bilayer by phospholipase C (see below). Phospholipases A2 can be classified based on sequence homology.
|
|
Constituent amino-acids can be analyzed to predict secondary, tertiary and quaternary protein structure. This list of protein structure prediction software summarizes notable used software tools in protein structure prediction, including homology modeling, protein threading, ab initio methods, secondary structure prediction, and transmembrane helix and signal peptide prediction.
|
|
He was born in Dayton, Ohio, and educated at Miami University and University of Michigan (A.B. 1932). After receiving a master's degree from Harvard University in 1934, he enrolled at Princeton University. He completed his Ph.D. under the direction of Solomon Lefschetz, with a thesis titled Universal homology groups.
|
|
Rsa RNAs are non-coding RNAs found in the bacterium Staphylococcus aureus. The shared name comes from their discovery, and does not imply homology. Bioinformatics scans identified the 16 Rsa RNA families named RsaA-K and RsaOA-OG. Others, RsaOH-OX, were found thanks to an RNomic approach.
|
|
To make it a comprehensive tool set, PSI-BLAST is also included in RAPTOR to let people do homology modeling. People can set up all the necessary parameters by themselves. There are two steps involved in running PSI-BLAST. The first step is to generate the sequence profile.
|
|
Other examples of homohexameric structures of plant ureases are those of soybean, pigeon pea and cotton seeds enzymes. It is important to note, that although composed of different types of subunits, ureases from different sources extending from bacteria to plants and fungi exhibit high homology of amino acid sequences.
|
|
Homologous recombination can be categorized as either in vivo or in vitro. In vitro homologous recombination mimics natural in vivo recombination. These in vitro recombination methods require high sequence homology between parental sequences. These techniques exploit the natural diversity in parental genes by recombining them to yield chimeric genes.
|
|
De novo synthesis of protein benefits from knowledge of existing protein structures. This knowledge of existing protein structure assists with the prediction of new protein structures. Methods for protein structure prediction fall under one of the four following classes: ab initio, fragment based methods, homology modeling, and protein threading.
|
|
Sarcomeric mitochondrial creatine kinase has 80% homology with the coding exons of ubiquitous mitochondrial creatine kinase. This gene contains sequences homologous to several motifs that are shared among some nuclear genes encoding mitochondrial proteins and thus may be essential for the coordinated activation of these genes during mitochondrial biogenesis.
|
|
Alpha-1-syntrophin is a protein that in humans is encoded by the SNTA1 gene. Alpha-1 syntrophin is a signal transducing adaptor protein and serves as a scaffold for various signaling molecules. Alpha-1 syntrophin contains a PDZ domain, two Pleckstrin homology domain and a 'syntrophin unique' domain.
|
|
Westrom BR, Karlsson BW, Ohlsson K (1982). Hoppe-Seyler's Zeitschrift fur Physiologische Chemie. 364: 375-381. cited in Sottrup-Jensen L, Folkersent J, Kristensen T, Tack BF (1984). “Partial primary structure of human pregnancy zone protein: Extensive sequence homology with human a2-macroglobulin (plasma proteins/evolution/acute-phase proteins)”.
|
|
CP can also detect packing anomalies, and, in particular, can potentially signal unbalanced partial charges within protein interiors. It is useful in homology modeling and protein design. A version of the plot (CPint) has also been built and made available to probe similar errors in protein-protein interfaces.
|
|
The average ORF is 1.4 kb in length, though the sizes range from 189 bp and 5.7 kb. The gene density of HzNV-2 is one gene per 2.05 kb with a coding density of 68%. The HsNV-2 genome shares homology with 16 conserved baculovirus core genes.
|
|
Stein was born on August 11, 1926, in Minneapolis; his father was a bookbinder. He graduated from the California Institute of Technology in 1946. He completed his doctorate at Columbia University in 1952. His dissertation, The Homology of the Two-Fold Symmetric Product, was supervised by Paul Althaus Smith.
|
|
Academy of Management Review, 35(4), 604-626 developed a framework that describes the relationships between these multiple velocity dimensions, noting that they may each have a distinct and often different velocity. They define “velocity homology” as the degree to which velocity dimensions have similar rates and directions of change and “velocity coupling” as the degree to which the velocities of different dimensions affect one another. This multidimensional treatment of environmental velocity results in four “velocity regimes” - simple, divergent, conflicted and integrated - based on the patterns of velocity homology and velocity coupling. A key implication of the framework is that firms should not necessarily focus on being uniformly fast (or slow) to suit industry conditions.
|
|
His work on circle-valued Morse theory (partly in collaboration with Yi-Jen Lee) studies torsion invariants that arise from circle-valued Morse theory and, more generally, closed 1-forms, and relates them to the three-dimensional Seiberg–Witten invariants and the Meng–Taubes theorem, in analogy with Taubes' Gromov–Seiberg–Witten theorem in four dimensions. The main body of his work involves embedded contact homology, or ECH. ECH is a holomorphic curve model for the Seiberg–Witten–Floer homology of a three-manifold, and is thus a version of Taubes's Gromov invariant for certain four-manifolds with boundary. Ideas connected to ECH were important in Taubes's proof of the Weinstein conjecture for three-manifolds.
|
|
The principle of homology: The biological relationships (shown by colours) of the bones in the forelimbs of vertebrates were used by Charles Darwin as an argument in favor of evolution. In biology, homology is similarity due to shared ancestry between a pair of structures or genes in different taxa. A common example of homologous structures is the forelimbs of vertebrates, where the wings of bats and birds, the arms of primates, the front flippers of whales and the forelegs of four-legged vertebrates like dogs and crocodiles are all derived from the same ancestral tetrapod structure. Evolutionary biology explains homologous structures adapted to different purposes as the result of descent with modification from a common ancestor.
|
|
JH2 is a "pseudokinase domain", a domain structurally similar to a tyrosine kinase and essential for a normal kinase activity, yet lacks enzymatic activity. This domain may be involved in regulating the activity of JH1, and was likely a duplication of the JH1 domain which has undergone mutation post- duplication. The JH3-JH4 domains of JAKs share homology with Src-homology-2 (SH2) domains. The amino terminal (NH2) end (JH4-JH7) of Jaks is called a FERM domain (short for band 4.1 ezrin, radixin and moesin); this domain is also found in the focal adhesion kinase (FAK) family and is involved in association of JAKs with cytokine receptors and/or other kinases.
|
|
As noted already, when is less than , , the trivial group . The reason is that a continuous mapping from an -sphere to an -sphere with can always be deformed so that it is not surjective. Consequently, its image is contained in with a point removed; this is a contractible space, and any mapping to such a space can be deformed into a one-point mapping. The case has also been noted already, and is an easy consequence of the Hurewicz theorem: this theorem links homotopy groups with homology groups, which are generally easier to calculate; in particular, it shows that for a simply-connected space X, the first nonzero homotopy group , with , is isomorphic to the first nonzero homology group .
|
|
The Smith normal form is useful for computing the homology of a chain complex when the chain modules of the chain complex are finitely generated. For instance, in topology, it can be used to compute the homology of a simplicial complex or CW complex over the integers, because the boundary maps in such a complex are just integer matrices. It can also be used to determine the invariant factors that occur in the structure theorem for finitely generated modules over a principal ideal domain, which includes the fundamental theorem of finitely generated abelian groups. The Smith normal form is also used in control theory to compute transmission and blocking zeros of a transfer function matrix.
|
|
Bloch's definition of higher Chow groups (1986) was the first integral (as opposed to rational) definition of motivic homology for schemes over a field k (and hence motivic cohomology, in the case of smooth schemes). The definition of higher Chow groups of X is a natural generalization of the definition of Chow groups, involving algebraic cycles on the product of X with affine space which meet a set of hyperplanes (viewed as the faces of a simplex) in the expected dimension. Finally, Voevodsky (building on his work with Suslin) defined the four types of motivic homology and motivic cohomology in 2000, along with the derived category of motives. Related categories were also defined by Hanamura and Levine.
|
|
If the homology is supported, the consequence is that the common ancestor of both saurischians and ornithischians were covered by feather-like structures, and that groups for which skin impression are known such as the sauropods were only secondarily featherless. If the homology is not supported, it would indicate that these filamentous dermal structures evolved independently in saurischians and ornithischians, as well as in other archosaurs such as the pterosaurs. The authors (in supplementary information to their primary article) noted that discovery of similar filamentous structures in the theropod Beipiaosaurus bolstered the idea that the structures on Tianyulong are homologous with feathers. Both the filaments of Tianyulong and the filaments of Beipiaosaurus were long, singular, and unbranched.
|
|
Given any two smooth submanifolds, it is possible to perturb either of them by an arbitrarily small amount such that the resulting submanifold intersects transversally with the fixed submanifold. Such perturbations do not affect the homology class of the manifolds or of their intersections. For example, if manifolds of complementary dimension intersect transversally, the signed sum of the number of their intersection points does not change even if we isotope the manifolds to another transverse intersection. (The intersection points can be counted modulo 2, ignoring the signs, to obtain a coarser invariant.) This descends to a bilinear intersection product on homology classes of any dimension, which is Poincaré dual to the cup product on cohomology.
|
|
The BAX gene was the first identified pro-apoptotic member of the Bcl-2 protein family. Bcl-2 family members share one or more of the four characteristic domains of homology entitled the Bcl-2 homology (BH) domains (named BH1, BH2, BH3 and BH4), and can form hetero- or homodimers. These domains are composed of nine α-helices, with a hydrophobic α-helix core surrounded by amphipathic helices and a transmembrane C-terminal α-helix anchored to the mitochondrial outer membrane (MOM). A hydrophobic groove formed along the C-terminal of α2 to the N-terminal of α5, and some residues from α8, binds the BH3 domain of other BAX or BCL-2 proteins in its active form.
|
|
Zeeman's main contributions to mathematics were in topology, particularly in knot theory, the piecewise linear category, and dynamical systems. His 1955 thesis at the University of Cambridge described a new theory termed "dihomology", an algebraic structure associated to a topological space, containing both homology and cohomology, introducing what is now known as the Zeeman spectral sequence. This was studied by Clint McCrory in his 1972 Brandeis thesis following a suggestion of Dennis Sullivan that one make "a general study of the Zeeman spectral sequence to see how singularities in a space perturb Poincaré duality". This in turn led to the discovery of intersection homology by Robert MacPherson and Mark Goresky at Brown University where McCrory was appointed in 1974.
|
|
Each promoter is associated with its own proximal exon (exon 0 for P0, exon 1 for P1) resulting in transcripts which are alternatively spliced in the 5' un-translated region. By convention, exon for orthologs from other species are named relative to the human/mouse numbering, as long as the organization is reasonably well- conserved. Of the four Drosophila Pax6 orthologues, it is thought that the eyeless (ey) and twin of eyeless (toy) gene products share functional homology with the vertebrate canonical Pax6 isoform, while the eyegone (eyg) and twin of eyegone (toe) gene products share functional homology with the vertebrate Pax6(5a) isoform. Eyeless and eyegone were named for their respective mutant phenotypes.
|
|
The PIR resource uses the term homeomorphic superfamilies to refer to superfamilies that are composed of sequences that can be aligned from end to end, representing a sharing of single sequence homology domain, a region of similarity that extends throughout the alignment. This domain may also comprise smaller homology domains that are shared with other protein families and superfamilies. Although a given protein sequence may contain domains found in several superfamilies, thus indicating a complex evolutionary history, sequences will be assigned to only one homeomorphic superfamily based on the presence of similarity throughout a multiple sequence alignment. The superfamily alignment may also include regions that do not align either within or at the ends of the alignment.
|
|
Protein threading, also known as fold recognition, is a method of protein modeling which is used to model those proteins which have the same fold as proteins of known structures, but do not have homologous proteins with known structure. It differs from the homology modeling method of structure prediction as it (protein threading) is used for proteins which do not have their homologous protein structures deposited in the Protein Data Bank (PDB), whereas homology modeling is used for those proteins which do. Threading works by using statistical knowledge of the relationship between the structures deposited in the PDB and the sequence of the protein which one wishes to model. The prediction is made by "threading" (i.e.
|
|
By virtue of their high degree of homology, the new gene copies that came into existence following the gene duplication naturally tend to either unequal crossover or unidirectional gene conversion events. In the latter process, there exists the acceptor and donor sequences and the acceptor sequence will be replaced by a sequence copied from the donor, while the sequence of the donor remains unchanged. The effective homology between the interacting sequences makes the gene conversion event successful. Additionally, the frequency of gene conversion is inversely proportional to the distance between the interacting sequences in cis , and the rate of gene conversion is usually directly proportional to the length of uninterrupted sequence tract in the assumed converted region.
|
|
Sal-like protein 4 (SALL4) is a transcription factor encoded by a member of the Spalt-like (SALL) gene family, SALL4. The SALL genes were identified based on their sequence homology to Spalt, which is a homeotic gene originally cloned in Drosophila melanogaster that is important for terminal trunk structure formation in embryogenesis and imaginal disc development in the larval stages. There are four human SALL proteins (SALL1, 2, 3, and 4) with structural homology and playing diverse roles in embryonic development, kidney function, and cancer. The SALL4 gene encodes at least three isoforms, termed A, B, and C, through alternative splicing, with the A and B forms being the most studied.
|
|
Anaerobic gram- positive cocci that produce large amounts of lactic acid during the process of carbohydrate fermentation were reclassified as Streptococcus parvulus and Streptococcus morbillorum from Peptococcus or Peptostreptococcus. Most of these organisms are anaerobic, but some are microaerophilic. Due to a large amount of new research done on the human microbe and more information on bacteria, many species of bacteria have been renamed and re-classified. Based on DNA homology and whole-cell polypeptide-pattern study findings supported by phenotypic characteristics, the DNA homology group of microaerobic streptococci that was formerly known as Streptococcus anginosus or Streptococcus milleri is now composed of three distinct species: S anginosus, Streptococcus constellatus, and Streptococcus intermedius.
|
|
The GRD is made up of a central portion called the minimal central catalytic domain (GAPc) as well as an extra domain (GAPex) that is formed through the coiling of about 50 residues from the N- and C- terminus. The Ras-binding region is found in the surface of GAPc and consists of a shallow pocket that is lined by conserved amino acid residues. In addition to the GRD, neurofibromin also contains a Sec14 homology-like region as well as a pleckstrin homology-like (PH) domain. Sec14 domains are defined by a lipid binding pocket that resembles a cage and is covered by a helical lid portion that is believed to regulate ligand access.
|
|
The case n = 2 is less obvious, but can be proven by using basic arguments involving the fundamental groups of the respective spaces: the retraction would induce an injective group homomorphism from the fundamental group of S1 to that of D2, but the first group is isomorphic to Z while the latter group is trivial, so this is impossible. The case n = 2 can also be proven by contradiction based on a theorem about non-vanishing vector fields. For n > 2, however, proving the impossibility of the retraction is more difficult. One way is to make use of homology groups: the homology Hn − 1(Dn) is trivial, while Hn − 1(Sn−1) is infinite cyclic.
|
|
In algebraic topology, a branch of mathematics, a homotopy sphere is an n-manifold that is homotopy equivalent to the n-sphere. It thus has the same homotopy groups and the same homology groups as the n-sphere, and so every homotopy sphere is necessarily a homology sphere. The topological generalized Poincaré conjecture is that any n-dimensional homotopy sphere is homeomorphic to the n-sphere; it was solved by Stephen Smale in dimensions five and higher, by Michael Freedman in dimension 4, and for dimension 3 (the original Poincaré conjecture) by Grigori Perelman in 2005. The resolution of the smooth Poincaré conjecture in dimensions 5 and larger implies that homotopy spheres in those dimensions are precisely exotic spheres.
|
|
As December 15, 2019, no diseases are attributed to this mark although Pleckstrin homology domain's (PHIP) targetable bromodomain specifically binds H4K91ac which could implicate PHIP in the progression of melanoma. It is found at the transcription start site (TSS) of active and poised genes. Histone acetyltransferase KAT2A is the specific reader.
|
|
Structures obtained in closed and open conformations are reversibly interconvertible by changes in the pH. A hydrogen-bonded perturbed pair of conserved aspartyl residues explains the pH dependence of this transition, and the pH regulates calcium influx in proteoliposomes. Homology models for human BI-1 provided insight into its cytoprotective activity.
|
|
Bradyrhizobium japonicum is a species of legume-root nodulating, microsymbiotic nitrogen-fixing bacteria. The species is one of many Gram- negative, rod-shaped bacteria commonly referred to as rhizobia. Within that broad classification, which has three groups, taxonomy studies using DNA sequencing indicate that B. japonicum belongs within homology group II.
|
|
Figure 1: Lanosterol synthase mechanism. The discrete carbocation intermediates show the non- concerted nature of the mechanism. Though some data on the mechanism has been obtained by the use of suicide inhibitors, mutagenesis studies, and homology modeling, it is still not fully understood how the enzyme catalyzes the formation of lanosterol.
|
|
C. parvum is incapable of de novo lipid synthesis, making its lipid trafficking machinery an important potential therapeutic target. C. parvum possesses multiple oxysterol-binding proteins (OSBPs), and oxysterol related proteins (OSRPs). Only OSBPs are capable of lipid binding, while both contain Pleckstrin homology domains, which function in cell signalling pathways.
|
|
Myosin-Ie (Myo1e) is a protein that in humans is encoded by the MYO1E gene. Myosin-Ie is a long tailed myosin. It contains an N-terminal motor domain, an IQ motif, a TH1 domain containing a plecstrin homology (PH) domain, a proline rich TH2 domain, and an SH3 domain.
|
|
Some proteobacterial assemblies require a third subunit () to bind heme d; others do not. The high-resolution structure heterotrimeric Cytochromes bd from Geobacillus species has been determined (). The third subunit does not share sequence homology with the third subunit proteobacteria, but does come into the assemblies at a similar position.
|
|
Pleckstrin homology-like domain family A member 1 (PHLDA1) is a protein that in humans is encoded by the PHLDA1 gene. This gene encodes an evolutionarily conserved proline-histidine rich nuclear protein. The encoded protein may play an important role in the anti-apoptotic effects of insulin-like growth factor-1.
|
|
This method greatly increases the rate of cloning and success rate of cloning into a vector backbone. However, it requires the DNA fragment to have significant homology with the plasmid. For this reason, knowledge of the sequence being cloned must be known beforehand. This is not a requirement with functional cloning.
|
|
Other studies have been able to induce transcription of Cas9 with a small molecule, doxycycline. Small molecules can also be used to improve homology directed repair, often by inhibiting the non-homologous end joining pathway. These systems allow conditional control of CRISPR activity for improved precision, efficiency, and spatiotemporal control.
|
|
Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), or DCC-interacting protein 13-alpha (DIP13alpha), is a protein that in humans is encoded by the APPL1 gene. APPL1 contains several key interactory domains: pleckstrin homology (PH) domain, phosphotyrosine-binding (PTB) domain and Bin–Amphiphysin–Rvs (BAR) domain.
|
|
Transcription regulator protein BACH2 (broad complex-tramtrack-bric a brac and Cap'n'collar homology 2) is a protein that in humans is encoded by the BACH2 gene. It contains a BTB/POZ domain at its N-terminus which forms a disulphide- linked dimer and a bZip_Maf domain at the C-terminus.
|
|
Several conserved domains have been found in UNC13A. These conserved domains include three C2 domains. One C2 domain is centrally located, another is at the carboxyl end, and there is a third. In addition, there is one C1 domain, as well as Munc13 homology domains 1 (MHD1) and 2 (MHD2).
|
|
The osteology of the human skull was an important theory for transcendental anatomists. Transcendental anatomists theorized that the bones of the skull were "cranial vertebra", or modified bones from the vertebrae. Owen ardently supported the theory as major evidence for his theory of homology. The theory has since been discredited.
|
|
Hsia, C. T. Hsia on Chinese Literature, pp. 149 Literary critic C. T. Hsia explains the reason why Qian Cai, the book's author, linked Yue with Garuda is because of the homology in their Chinese names. Yue Fei's courtesy name is Pengju ().Hsia, C.T. C. T. Hsia on Chinese Literature, pp.
|
|
For example, SOS contains a Dbl homology domain in addition to its CDC25 catalytic domain. SOS can act as a GEF to activate Rac1, a RhoGTPase, in addition to its role as a GEF for Ras. SOS is therefore a link between the Ras-Family and Rho-Family GTPase signaling pathways.
|
|
Michler earned her Ph.D. in Mathematics in 1993 from the University of California, Berkeley. Her dissertation is titled "Hodge components of cyclic homology of affine hypersurfaces." Her advisors were Mariusz Wodzicki and Arthur Ogus. She spent the academic year 1993-1994 as a postdoc at Queen's University working with Leslie Roberts.
|
|
In 2010, a team led by Edward Marcotte developed an algorithm that identifies deeply homologous genetic modules in unicellular organisms, plants, and animals based on phenotypes (such as traits and developmental defects). The technique aligns phenotypes across organisms based on orthology (a type of homology) of genes involved in the phenotypes.
|
|
In contrast to the ubiquitous expression of receptors for type I interferons, IFNLR1 is largely restricted to tissues of epithelial origin. Despite high homology between type III interferons, the binding affinity to IFNLR1 differ, with IFN-λ1 showing the highest binding affinity, and IFN-λ3 showing the lowest binding affinity.
|
|
In 1994 Billera won the Fulkerson Prize for his paper, Homology of smooth splines. This prize is given every three years to the best paper in discrete mathematics. In 2012 he became a fellow of the American Mathematical Society.List of Fellows of the American Mathematical Society, retrieved 2013-07-07.
|
|
These enriched loci are the genetic markers for the trait of interest. The genetic markers for the tau mutants mapped to chromosome 22. The region of conserved synteny was the gene casein kinase I epsilon (CKIe). This is consistent with CKIe's homology to the Drosophila circadian control gene doubletime (dbt).
|
|
This is an indispensable tool for any researcher using the mouse as a model organism for their research, and for researchers interested in genes that share homology with the mouse genes. Various mouse research support resources including animal collections and free colony management software are also available at the MGI site.
|
|
A great number of software tools for protein structure prediction exist. Approaches include homology modeling, protein threading, ab initio methods, secondary structure prediction, and transmembrane helix and signal peptide prediction. Some recent successful methods based on the CASP experiments include I-TASSER and HHpred. For complete list see main article.
|
|
Schizophrenia PPI. Using experimental data as a starting point, homology transfer is one way to predict interactomes. Here, PPIs from one organism are used to predict interactions among homologous proteins in another organism ("interologs"). However, this approach has certain limitations, primarily because the source data may not be reliable (e.g.
|
|
ER-X is a membrane-associated receptor that is bound and activated by 17α-estradiol and 17β-estradiol and is a putative membrane estrogen receptor (mER). It shows sequence homology with ERα and ERβ and activates the MAPK/ERK pathway. The receptor is insensitive to the antiestrogen ICI-182,780 (fulvestrant).
|
|
The hands are also very different among the different groups. The most common form among non-avian theropods is an appendage consisting of three fingers; the digits I, II and III (or possibly II, III and IV),See Origin of birds/Digit homology. with sharp claws. Some basal theropods (e.g.
|
|
Journal of Vertebrate Paleontology 7: 121-137. The enlarged supratemporal fenestrae of Dakosaurus skulls would have anchored large adductor muscles (jaw closing),Holliday CM, Witmer LM. Archosaur adductor chamber evolution: integration of musculoskeletal and topological criteria in jaw muscle homology. Journal of Morphology 268 (6): 457-484. ensuring a powerful bite.
|
|
KH domain was the first identified in the human. It is from heterogeneous nuclear ribonucleoprotein (hnRNP) K. Therefore, binding domains that belong to this family are called K-Homology domain. It is a domain that binds to both ssDNA and ssRNA. Eukaryotes, eubacteria and archaea usually have this type of domains.
|
|
This protein is known as a dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. Duox are also implicated in lung defence system and especially in cystic fibrosis. Schema of duox implication in human lung defence system Schematic diagram of the respiratory tract antimicrobial defense system.
|
|
GTx1-15 displays sequence homology with other ion channel toxins from several spider species. It is homologous in sequence with sodium channel blocker PaurTx3 by 76.5%, and it also shares similarities in sequence with HnTx-IV (60%), CcoTx2 (55.9%), TLTx1 (55.6%), ω-GrTx SIA (40%), GsAFII (38.2%) and GsMTx2 (38.2%).
|
|
"Topology and data". AMS Bulletin 46(2), 255-308. To find the persistent homology of a space, the space must first be represented as a simplicial complex. A distance function on the underlying space corresponds to a filtration of the simplicial complex, that is a nested sequence of increasing subsets.
|
|
This gene belongs to the forkhead protein family of transcription factors which is characterized by a DNA- binding forkhead domain. FoxD3 functions as a transcriptional repressor and contains the C-terminal engrailed homology-1 motif (eh1), which provides an interactive surface with a transcriptional co-repressor Grg4 (Groucho-related gene-4).
|
|
In mathematics, a cubical complex or cubical set is a set composed of points, line segments, squares, cubes, and their n-dimensional counterparts. They are used analogously to simplicial complexes and CW complexes in the computation of the homology of topological spaces. graphs are (homeomorphic to) 1-dimensional cubical complexes.
|
|
It is likely responsible for oral infectivity through directly binding the virus particle to host cells. Hz2V106 shows homology with baculovirus p74 and likely mediates the specific binding of the virus particle to host cells by aiding the formattion of disulfide bonds inside its C-terminal transmembrane's membrane anchoring domain.
|
|
One of Robins' publications, from 1999, is one of the three works that independently introduced persistent homology in topological data analysis. As well as working on mathematical research, she has collaborated with artist Julie Brooke, of the Australian National University School of Art & Design, on the mathematical visualization of topological surfaces.
|
|
Halcurin is a polypeptide neurotoxin from the sea anemone Halcurias sp. Based on sequence homology to type 1 and type 2 sea anemone toxins it is thought to delay channel inactivation by binding to the extracellular site 3 on the voltage gated sodium channels in a membrane potential-dependent manner.
|
|
RAC-alpha serine/threonine-protein kinase is an enzyme that in humans is encoded by the AKT1 gene. This enzyme belongs to the AKT subfamily of serine/threonine kinases that contain SH2 (Src homology 2-like) domains. It is commonly referred to as PKB, or by both names as "Akt/PKB".
|
|
Further, a homology model has been created for EPO based on the X-ray diffraction structure. The fold is highly conserved and seems to be optimized for catalytic function. However, differences exist which unsurprisingly account for differences in substrate specificity among peroxidases. This furcation is commonplace in the study of protein evolution.
|
|
These aspects include identity, similarity, and homology. Identity means that the sequences have identical residues at their respective positions. On the other hand, similarity has to do with the sequences being compared having similar residues quantitatively. For example, in terms of nucleotide sequences, pyrimidines are considered similar to each other, as are purines.
|
|
Thus the dreams of the early topologists have long been regarded as a mirage. Cubical higher homotopy groupoids are constructed for filtered spaces in the book Nonabelian algebraic topology cited below, which develops basic algebraic topology, including higher analogues to the Seifert–van Kampen theorem, without using singular homology or simplicial approximation.
|
|
While studying the genome, there are some crucial aspects that should be taken in consideration. Gene prediction is the identification of genetic elements in a genomic sequence. This study is based on a combination of approaches: de novo, homology prediction, and transcription. Tools such as EvidenceModeler are used to merge the different results.
|
|
RhTx is a small peptide toxin, with a compact 3D-structure. The gene encoding for RhTx translates into a 69 amino acid peptide that shows no homology to any known animal toxin. This peptide, after post- translational modifications, yields a mature toxin of 27 amino acids. RhTx has two pairs of disulfide bonds.
|
|
Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q.
|
|
This gene encodes a member of the BTB-kelch superfamily. Initially described as a putative transcriptional regulator based on weak homology to members of the basic leucine zipper-like family, the encoded protein subsequently has been shown to localize exclusively to the Golgi network where it may help stabilize the Golgi complex.
|
|
Not all of the mentioned conditions pertain to cadang-cadang. Tinangaja disease is caused by coconut trinangaja viroid (CTiVd), which has 64% sequence homology with CCCVd. This disease has been found in Guam. Coconuts from Asia and South Pacific have been found to have viroids with similar nucleic acid sequences of CCCVd.
|
|
This protein consists of four Bcl-2 homology domains (abbreviated BH1, BH2, BH3, BH4, respectively) and a C-terminal transmembrane region (Figure 1). Its BH3 domain contains a stretch with many leucine residues. This is unique among the Bcl-2 family members. The leucine-rich stretch functions as a nuclear export signal.
|
|
HIV-2 contains both a Vpr protein and a related (by sequence homology) Vpx protein (Viral Protein X). Two functions of Vpr in HIV-1 are split between Vpr and Vpx in HIV-2, with the HIV-2 Vpr protein inducing cell cycle arrest and the Vpx protein required for nuclear import.
|
|
A multiple sequence alignment of mammalian histone H1 proteins. Alignment positions conserved across all five species analysed are highlighted in grey. Positions with conservative, semi- conservative, and non-conservative amino acid replacements are indicated. As with anatomical structures, sequence homology between protein or DNA sequences is defined in terms of shared ancestry.
|
|
In mathematics, a nonabelian cohomology is any cohomology with coefficients in a nonabelian group, a sheaf of nonabelian groups or even in a topological space. If homology is thought of as the abelianization of homotopy (cf. Hurewicz theorem), then the nonabelian cohomology may be thought of as a dual of homotopy groups.
|
|
The expression of this gene is induced by fasting as well as by progesterone. The protein encoded by this gene contains a t-synaptosome-associated protein receptor (SNARE) coiled-coil homology domain and a peroxisomal targeting signal. Production of the encoded protein leads to phosphorylation and activation of the transcription factor ELK1.
|
|
The Vietoris–Rips complex was originally called the Vietoris complex, for Leopold Vietoris, who introduced it as a means of extending homology theory from simplicial complexes to metric spaces.; ; ; . After Eliyahu Rips applied the same complex to the study of hyperbolic groups, its use was popularized by , who called it the Rips complex.; .
|
|
Siglec-8 was first identified by CD33 homology screening of ESTs from a cDNA library generated from a patient diagnosed with idiopathic hypereosinophilic syndrome and was originally termed SAF-2 (sialoadhesin family 2). At the tissue level, Siglec-8 mRNA was found to be most highly expressed in lung, PBMCs, spleen, and kidney.
|
|
Due to its high level of sequence homology with CD33 (Siglec-3), Siglec-8 is grouped within the CD33-related siglec subfamily. This family is composed of a rapidly evolving group of siglecs that share 50–99% sequence identity. Most members of the subfamily also possess conserved cytoplasmic ITIM and ITIM-like sequences.
|
|
Donaldson has defined the integer invariant of smooth 4-manifolds by using moduli spaces of SU(2)-instantons. These invariants are polynomials on the second homology. Thus 4-manifolds should have extra data consisting of the symmetric algebra of H2. has produced a super-symmetric Lagrangian which formally reproduces the Donaldson theory.
|
|
Kryshtafovych A, Venclovas C, Fidelis K, Moult J. (2005). Progress over the first decade of CASP experiments. Proteins 61(S7):225–36. The rotameric states of side chains and their internal packing arrangement also present difficulties in homology modeling, even in targets for which the backbone structure is relatively easy to predict.
|
|
Gap junction proteins with no sequence homology to connexins were initially identified in fruit flies. It was suggested that these proteins are specific invertebrate gap junctions, and they were thus named "innexins" (invertebrate analog of connexins). They were later identified in diverse invertebrates. Invertebrate genomes may contain more than a dozen innexin genes.
|
|
Mammoths ability to extract the multi-criteria partial overlaps with proteins of known structure and rank these with proper E-values, combined with its speed facilitates scanning vast numbers of decoy models against the PDB data base for identifying the most likely correct decoys based on their remote homology to known proteins.
|
|
Other proteins contain a cullin-homology domain, such as CUL9, also known as p53 cytoplasmic anchor PARC, and the ANAPC2 subunit of the anaphase-promoting complex/cyclosome; both CUL9 and ANAPC2 have ubiquitin ligase activity. The N-terminal region of cullins is more variable, and is used to interact with specific adaptor proteins.
|
|
Although parvulin has no homology with larger prolyl isomerases such as cyclophilin and FKBP, it does share structural features with subdomains of other proteins involved in preparing secreted proteins for export from the cell.Balbach J, Schmid FX. (2000). Proline isomerizarion and its catalysis in protein folding. In Mechanisms of Protein Folding 2nd ed.
|
|
ESyPred3D is an automated homology modeling program. The method gets the benefit of the increased alignment performances of an alignment strategy that uses neural networks. Alignments are obtained by combining, weighting and screening the results of several multiple alignment programs. The final three- dimensional structure is built using the modeling package MODELLER.
|
|
Predictions of protein secondary structure by Benner and colleagues achieved high accuracy. It became possible to model protein folds, detect distant homologs, enable structural genomics, and join protein sequence, structure, and function. Further, this work suggested limits to structure prediction by homology, defining what can and cannot be done with this strategy.
|
|
However, DNA polymerase nu plays an active role in homology repair during cellular responses to crosslinks, fulfilling its role in a complex with helicase. Plants use two Family A polymerases to copy both the mitochrondrial and plastid genomes. They are more similar to bacterial Pol I than they are to mamallian Pol γ.
|
|
The human IFNA gene family shares 70-80% amino acid sequence homology, and about 35% identity with IFNB. The high degree of amino-acid sequence similarity within the IFNA genes suggests a common ancestor gene. It seems likely that the IFNA gene cluster has been generated by gene conversion or recent duplication events.
|
|
This gene encodes a pleckstrin homology (PH) domain-containing protein. The PH domain is found near the N-terminus and contains a putative phosphatidylinositol 3, 4, 5-triphosphate- binding motif (PPBM). Elevated expression of this gene has been observed in some melanomas. Alternate splicing results in multiple transcript variants encoding different isoforms.
|
|
Generated from 1EEJ The common motif is Cys98-Gly-Tyr-Cys101. The fact that Cys 98 is partially solvent exposed supports the mechanism provided above. DsbG has a sequence homology of 24% identity with DsbC, thus suggesting a similar structure with that of DsbC. The Cys98-Gly-Tyr-Cys101 chain in DsbC.
|
|
The most important of these invariants are homotopy groups, homology, and cohomology. Although algebraic topology primarily uses algebra to study topological problems, using topology to solve algebraic problems is sometimes also possible. Algebraic topology, for example, allows for a convenient proof that any subgroup of a free group is again a free group.
|
|
The genetic network linking various types of Bamfordvirae viruses and selfish genetic elements, represented by labeled circles. Links between circles are color-coded by the gene whose sequence homology establishes the link. Bamfordvirae is a kingdom of viruses. This kingdom is recognized for its use of double jelly roll major capsid proteins.
|
|
Major intrinsic proteins comprise a large superfamily of transmembrane protein channels that are grouped together on the basis of homology. The MIP superfamily includes three subfamilies: aquaporins, aquaglyceroporins and S-aquaporins. # The aquaporins (AQPs) are water selective. # The aquaglyceroporins are permeable to water, but also to other small uncharged molecules such as glycerol.
|
|
The last of which has 33% structural identity to the Ca2 domain of IgA-1. The first two of the domains are predicted to be the most important in the α4β7 interaction. The MadCAM-1 protein has structural homology to the vascular surface receptors VCAM1 and ICAM at 28% and 32% respectively.
|
|
The exact function of TNRC18 is not yet well understood by the scientific community. The protein sequence provided by the National Center for Biotechnology Information (NCBI) database includes a Bromo Adjacent Homology (BAH) Domain within TNRC18. BAH domains are often found in chromatin-associated proteins and assist in the silencing of genes.
|
|
Krüppel has shown homology to the mammalian Krüppel-like factors, which play key biological roles in the pathogenesis of many human diseases: cancer, obesity, inflammatory disorders and cardiovascular complications. Moreover, KLFs are known to be involved in inducible pluripotent stem cells generation, and preservation of the pluripotent state of embryonic stem cells.
|
|
The first transcriptome of a loricate choanoflagellate led to the discovery of choanoflagellate silicon transporters. Subsequently, similar genes were identified in a second loricate species, Diaphanoeca grandis. Analysis of these genes found that the choanoflagellate SITs show homology to the SIT-type silicon transporters of diatoms and have evolved through horizontal gene transfer.
|
|
Ground squirrel hepatitis virus is a spherical, enveloped virus. The core particle, or nucleocapsid, contains e antigen, viral DNA, and an endogenous DNA polymerase. The virus particles contain two major structural proteins, surface antigens (sAg) and core antigens (cAg). Both proteins were identified based on homology with analogous proteins in other hepadnaviruses.
|
|
The function of PLEKHM3 is not characterized in any scientific database. It is thought to be associated with cell differentiation and is expressed at ubiquitously low levels in all cell types. The Pleckstrin Homology domains are involved with phosphate binding. The DUF4206 Domain is cysteine rich and forms with 7 CXXC protein motifs.
|
|
These proteins are called MHC class I polypeptide-related sequence A and B. Discovered by sequence homology analysis these proteins are found on the surface of enterocytes of the small intestine, are believed to play a role in disease. Studies to date have revealed no mutation that would increase risk for MICA.
|
|
Metal transporter CNNM3 primary structure Regarding the structure, CNNMs contain an N-terminal extracellular domain, a transmembrane domain called DUF21, a large cytosolic region that includes a pair of cystathionine-β-synthase domains, known as CBS-pair, and, furthermore, a putative cyclic nucleotide-binding homology domain, which name is CNBH (Cyclic Nucleotide-Binding Homology). The CBS-pair domain has been extensively characterized, yet little is known about the CNBH domain. In spite of the fact that active member domains can occur as dimers and monomers, the inactive member, CNNM3, can only as a dimer. It exists an inverse correlation between the propensity of the CNBH domains to dimerize and the ability of CNNMs to mediate Mg2+ efflux, which has been proved with analytical ultracentrifugation experiments.
|
|
The cobl- actin-nucleus is thought to remain at the pointed end of the emerging filament leaving the barbed end free for rapid polymerization. Other critical functional parts are the N-terminal Cobl Homology domain, which can also be found in the ancestor of Cobl, Cobl-like - a protein that is also expressed highly in the nervous system and able to give rise to actin filaments by a mechanism different to Cobl, yet, using in part similar associated components and molecular mechanisms. Cobl Homology domains contain three motifs following the consensus KrRAPpPP (first described as "KRAP" motif of unknown function by Caroll et al., 2003), which represent syndapin I binding sites The polypeptide also contains several further proline-rich sequences, which e.g.
|
|
Small GTPases function as monomers and have a molecular weight of about 21 kilodaltons that consists primarily of the GTPase domain. They are also called small or monomeric guanine nucleotide-binding regulatory proteins, “’small or monomeric GTP-binding proteins”’, or small or monomeric G-proteins, and because they have significant homology with the first-identified such protein, named Ras, they are also referred to as Ras superfamily GTPases. Small GTPases generally serve as molecular switches and signal transducers for a wide variety of cellular signaling events, often involving membranes, vesicles or cytoskeleton. According to their primary amino acid sequences and biochemical properties, the many Ras superfamily small GTPases are further divided into five subfamilies with distinct functions: Ras, Rho (“Ras-homology”), Rab, Arf and Ran.
|
|
For instance, a circle is not a disk because the circle has a hole through it while the disk is solid, and the ordinary sphere is not a circle because the sphere encloses a two-dimensional hole while the circle encloses a one-dimensional hole. However, because a hole is "not there", it is not immediately obvious how to define a hole or how to distinguish different kinds of holes. Homology was originally a rigorous mathematical method for defining and categorizing holes in a manifold. Loosely speaking, a cycle is a closed submanifold, a boundary is a cycle which is also the boundary of a submanifold, and a homology class (which represents a hole) is an equivalence class of cycles modulo boundaries.
|
|
The usual construction of singular homology proceeds by defining formal sums of simplices, which may be understood to be elements of a free abelian group, and then showing that we can define a certain group, the homology group of the topological space, involving the boundary operator. Consider first the set of all possible singular n-simplices \sigma_n(X) on a topological space X. This set may be used as the basis of a free abelian group, so that each singular n-simplex is a generator of the group. This set of generators is of course usually infinite, frequently uncountable, as there are many ways of mapping a simplex into a typical topological space. The free abelian group generated by this basis is commonly denoted as C_n(X).
|
|
Single- cell genomics and metagenomic shotgun sequencing approaches reveal a poribacterial genome size range between about 4.2 and 6.5 megabases encoding 4,254 protein-coding genes, of which an unusually high 24% have no homology to known genes. Among the genes of identifiable homology, reconstructed pathways suggest that the poribacterial central metabolism is capable of glycolysis, tricarboxylic acid cycle, pentose phosphate pathways, oxidative phosphorylation, the Entner-Doudoroff pathway, and autotrophic carbon fixation via Wood–Ljungdahl pathway. Further, Poribacteria seem to engage in assimilatory denitrification and ammonia scavenging with potential relevance in nitrogen re-cycling within the sponge holobiont. The poribacterial genome is also reported to contain an unusually high number of phage defence systems including CRISPR-CAS and restriction modification systems.
|
|
Sequence comparison of msDNAs from Myxococcus xanthus, Stigmatella aurantiaca, and many other bacteria reveal conserved and hypervariable domains reminiscent of conserved and hypervariable sequences found in allorecognition molecules. The major msDNAs of M. xanthus and S. aurantiaca, for instance, share 94% sequence homology except within a 19 base-pair domain that shares sequence homology of only 42%. The presence of such domains is significant because myxobacteria exhibit complex cooperative social behaviors including swarming and formation of fruiting bodies, while E. coli and other pathogenic bacteria form biofilms that exhibit enhanced antibiotic and detergent resistance. The sustainability of social assemblies that require significant individual investment of energy is generally dependent on the evolution of allorecognition mechanisms that enable groups to distinguish self versus non-self.
|
|
As with many biological terms, the use of protein family is somewhat context dependent; it may indicate large groups of proteins with the lowest possible level of detectable sequence similarity, or very narrow groups of proteins with almost identical sequence, function, and three-dimensional structure, or any kind of group in-between. To distinguish between these situations, the term protein superfamily is often used for distantly related proteins whose relatedness is not detectable by sequence similarity, but only from shared structural features. Other terms such as protein class, group, clan and sub-family have been coined over the years, but all suffer similar ambiguities of usage. A common usage is that superfamilies (structural homology) contain families (sequence homology) which contain sub-families.
|
|
Other examples are knot polynomials, such as the Jones polynomial, which are currently among the most useful invariants for distinguishing knots from one another, though currently it is not known whether there exists a knot polynomial which distinguishes all knots from each other. However, there are invariants which distinguish the unknot from all other knots, such as Khovanov homology and knot Floer homology. Other invariants can be defined by considering some integer-valued function of knot diagrams and taking its minimum value over all possible diagrams of a given knot. This category includes the crossing number, which is the minimum number of crossings for any diagram of the knot, and the bridge number, which is the minimum number of bridges for any diagram of the knot.
|
|
In his paper with Jones, he studied the topology of the moduli space of SU(2) instantons over a 4-sphere. They showed that the natural map from this moduli space to the space of all connections induces epimorphisms of homology groups in a certain range of dimensions, and suggested that it might induce isomorphisms of homology groups in the same range of dimensions. This became known as the Atiyah–Jones conjecture, and was later proved by several mathematicians. Harder and M. S. Narasimhan described the cohomology of the moduli spaces of stable vector bundles over Riemann surfaces by counting the number of points of the moduli spaces over finite fields, and then using the Weil conjectures to recover the cohomology over the complex numbers.
|
|
Gromov showed that certain moduli spaces of pseudoholomorphic curves (satisfying additional specified conditions) are compact, and described the way in which pseudoholomorphic curves can degenerate when only finite energy is assumed. (The finite energy condition holds most notably for curves with a fixed homology class in a symplectic manifold where J is \omega-tame or \omega-compatible). This Gromov compactness theorem, now greatly generalized using stable maps, makes possible the definition of Gromov–Witten invariants, which count pseudoholomorphic curves in symplectic manifolds. Compact moduli spaces of pseudoholomorphic curves are also used to construct Floer homology, which Andreas Floer (and later authors, in greater generality) used to prove the famous conjecture of Vladimir Arnol'd concerning the number of fixed points of Hamiltonian flows.
|
|
Its generators are Reeb chords, which are trajectories of the Reeb vector field beginning and ending on a Lagrangian, and its differential counts certain holomorphic strips in the symplectization of the contact manifold whose ends are asymptotic to given Reeb chords. In SFT the contact manifolds can be replaced by mapping tori of symplectic manifolds with symplectomorphisms. While the cylindrical contact homology is well-defined and given by the symplectic Floer homologies of powers of the symplectomorphism, (rational) symplectic field theory and contact homology can be considered as generalized symplectic Floer homologies. In the important case when the symplectomorphism is the time-one map of a time-dependent Hamiltonian, it was however shown that these higher invariants do not contain any further information.
|
|
This N-terminal extension contains a protein kinase domain that has approximately 50% sequence identity to the sequences of ROCK, ROK, myotonic dystrophy protein kinase (MDPK) and the CDC42 effector known as MRCK or GEK. Citron kinase, which resembles the ROCK family of kinases and by comparison to it, is therefore a multiple domain protein containing an N-terminal kinase domain, an internal coiled-coil (CC) domain with Rho/Rac interacting site, and a C-terminal region consisting of a Zn finger, a pleckstrin homology (PH) domain, a Citron homology domain (CNH), a putative SH3 binding domain, and a PDZ-targeting motif. Its fly (Drosophila) ortholog is called Sticky. the importance of different domains of citron-K in its localization at different stages is discussed below.
|
|
FK506 binding protein 6, also known as FKBP6, is a human gene. The encoded protein shows structural homology to FKBP immunophilins, which bind to the immunosuppressants FK506 and rapamycin. FKBP6 is essential for homologous chromosome pairing in meiosis during spermatogenesis. Targeted inactivation of FKBP6 in mice results in infertile males, but apparently normal females.
|
|
An additional opioid receptor was later identified and cloned based on homology with the cDNA. This receptor is known as the nociceptin receptor or ORL1 (opiate receptor-like 1). The opioid receptor types are nearly 70% identical, with the differences located at the N and C termini. The μ receptor is perhaps the most important.
|
|
The various 3-phosphorylated phosphoinositides that are produced by PI3Ks (PtdIns3P, PtdIns(3,4)P2, PtdIns(3,5)P2, and PtdIns(3,4,5)P3) function in a mechanism by which an assorted group of signalling proteins, containing PX domains, pleckstrin homology domains (PH domains), FYVE domains or other phosphoinositide-binding domains, are recruited to various cellular membranes.
|
|
In mathematics, in the area of symplectic topology, relative contact homology is an invariant of spaces together with a chosen subspace. Namely, it is associated to a contact manifold and one of its Legendrian submanifolds. It is a part of a more general invariant known as symplectic field theory, and is defined using pseudoholomorphic curves.
|
|
The proof of the structure theorem relies on the base domain being field, so not many attempts have been made on persistence homology with torsion. Frosini defined a pseudometric on this specific module and proved its stability. One of its novelty is that it doesn't depend on some classification theory to define the metric.
|
|
The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no effect on cell migration or growth.
|
|
A. viteae is an animal parasite. These filarial nematodes and their animal hosts are often used as models for studies on the biology of human infection. It shares considerable antigenic homology with the human filarial worm Onchocerca volvulus; this allows for rapid analysis of larval development, which is essential to efforts in vaccine development.
|
|
SQS contains two conserved aspartate-rich sequences, which are believed to participate directly in the catalytic mechanism. These aspartate-rich motifs are one of several conserved structural features in class I isoprenoid biosynthetic enzymes, although these enzymes do not share sequence homology. Squalene Synthase (Human). Key residues in the central channel are shown as spheres.
|
|
Many participate in phase I metabolism of xenobiotics such as toxins or drugs; the resulting carboxylates are then conjugated by other enzymes to increase solubility and eventually excreted. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases.
|
|
Homology between protein or DNA sequences is defined in terms of shared ancestry. Two segments of DNA can have shared ancestry because of either a speciation event (orthologs) or a duplication event (paralogs). Homologs are similar genes and/or proteins which are related by ancestry. Orthologs are the 'same' gene, but from different organisms.
|
|
At least three alternatively spliced transcript variants encoding distinct isoforms of PRC1 have been observed. Additionally, PRC1 has sequence homology with Ase1 in yeasts, SPD-1 (spindle defective 1) in C. elegans, Feo in D. melanogaster, and MAP65 in plants, all of which fall in a conserved family of nonmotor microtubule-associated proteins (MAPs).
|
|
Being a spherical 3-manifold, it is the only homology 3-sphere, besides the 3-sphere itself, with a finite fundamental group. While it is not known the extent to which such discoveries influenced Metzinger's representation of the radiating sun in Coucher de soleil no. 1, his interest and prowess in mathematics is well documented.
|
|
Hepatitis delta virus (HDV) is a pathogenic human virus whose RNA genome and replication cycle resemble those of plant viroids. Delta-interacting protein A (DIPA), a cellular gene product, has been found to have homology to hepatitis delta virus antigen (HDAg). DIPA interacts with the viral antigen, HDAg, and can affect HDV replication in vitro.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the YmL27 ribosomal protein family.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L1 ribosomal protein family.
|
|
Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified at least two transcript variants encoding the same protein. Pseudogenes corresponding to this gene are found on chromosomes 6p and 12p.
|
|
Dually, it can be tiled with 56 equilateral triangles, with 24 vertices, each of degree 7, as a quotient of the order-7 triangular tiling. Klein's quartic arises in many fields of mathematics, including representation theory, homology theory, octonion multiplication, Fermat's last theorem, and Stark's theorem on imaginary quadratic number fields of class number 1.
|
|
Chromomeres can be observed best when chromosomes are highly condensed. The chromomeres are present during leptotene phase of prophase I during meiosis. During zygotene phase of prophase I, the chromomeres of homologs align with each other to form homologous rough pairing (homology searching). These chromomeres helps provide a unique identity for each homologous pairs.
|
|
The sequence for full tripartite WPRE is: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTA TCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTG GTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGG AACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCT CGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGG CCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG This sequence has 100% homology with base pairs 1093 to 1684 of the Woodchuck hepatitis B virus (WHV8) genome. When used in the 3' untranslated region (UTR) of a mammalian expression cassette, it can significantly increase mRNA stability and protein yield.
|
|
Structural alignment of thioredoxins from humans and the fly Drosophila melanogaster. The proteins are shown as ribbons, with the human protein in red, and the fly protein in yellow. Generated from PDB 3TRX and 1XWC. Structural alignment attempts to establish homology between two or more polymer structures based on their shape and three-dimensional conformation.
|
|
Traditionally, homologous recombination was the main method for causing a gene knockout. This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. The construct will also contain a minimum of 2kb of homology to the target sequence.
|
|
HoxA and HoxD, that regulate finger and toe formation in mice, control the development of ray fins in zebrafish; these structures had until then been considered non-homologous. There is a possible deep homology among animals that use acoustic communication, such as songbirds and humans, which may share unmutated versions of the FOXP2 gene.
|
|
Proteins with no homology to the cyclin family can be direct activators of CDKs. One family of such activators is the RINGO/Speedy family, which was originally discovered in Xenopus. All five members discovered so far directly activate Cdk1 and Cdk2, but the RINGO/Speedy-CDK2 complex recognizes different substrates than cyclin A-CDK2 complex.
|
|
While homology refers to the historical continuity of character identity, the term innovation refers to the origin of novel characters, i.e. the origin of novel homologues. Therefore, Wagner and Müller argue that the origin and maintenance of character identity is a central goal of evolutionary developmental biology.Müller, G. B., and G. P. Wagner. 1991.
|
|
Poincare duality states that the intersection form is unimodular (up to torsion). By Wu's formula, a spin 4-manifold must have even intersection form, i.e., Q(x,x) is even for every x. For a simply-connected 4-manifold (or more generally one with no 2-torsion residing in the first homology), the converse holds.
|
|
First, citryl-coA synthetase catalyzes the formation of citryl-CoA, which is immediately cleaved by citryl-CoA lyase. It was also observed that there is significant level of protein sequence homology between the CCL protein and the C-terminal region of ATP citrate lyase (ACL), an enzyme commonly employed by the reductive TCA cycle.
|
|
The gene contains an open reading frame (ORF) of 8,133 nucleotides, coding for 2,710 amino acids. TcdA and TcdB share 63% homology in their amino acid sequences. These genes are expressed during late log phase and stationary phase in response to environmental factors. Environmental stresses such as antibiotics and catabolite repression can influence toxin expression.
|
|
URM1 is involved in thiolation of cytoplasmic tRNAs; receives sulfur from the E1-like enzyme Uba4 and transfers it to tRNA. Sequence and structural homology studies suggest that Urm1 can be more closely linked to the prokaryotic sulphur transfer proteins, ThiS and MoaD, that can be considered as prokaryotic counterparts of the eukaryotic UBls.
|
|
The Dehn invariants of polyhedra are elements of an infinite-dimensional vector space. As an abelian group, this space is part of an exact sequence involving group homology. Similar invariants can also be defined for some other dissection puzzles, including the problem of dissecting rectilinear polygons into each other by axis-parallel cuts and translations.
|
|
In a different direction, it is finer than the qfh topology, so h locally, algebraic correspondences are finite sums of morphisms.Suslin, Voevodsky, Singular homology of abstract algebraic varieties Finally, every proper surjective morphism is an h covering, so in any situation where de Jong's theorem on alterations is valid, h locally all schemes are regular.
|
|
Homologs of α- and β-tubulin have been identified in the Prosthecobacter genus of bacteria. They are designated BtubA and BtubB to identify them as bacterial tubulins. Both exhibit homology to both α- and β-tubulin. While structurally highly similar to eukaryotic tubulins, they have several unique features, including chaperone-free folding and weak dimerization.
|
|
The full length of mature staphylokinase mRNA is 489bp. The first 27 amino acids code for a signal peptide which is cleaved off in the mature protein (mSak). There is little or no homology between the primary structure of Sak and other plasminogen activators. The natural variants of Sak are Sak42D, SakφC and SakSTAR.
|
|
Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes.
|
|
Three dimensional structure of none of the members of Angiopoietin like proteins (ANGPTLs) is available up till now. However, the structure of ANGPTL8 was predicted by homology modeling and is also reported in literature. It consists of alpha helices and its sequence show high similarity with the coiled-coil domains of ANGPTL3 and ANGPTL4.
|
|
The domain may also be involved in protein-protein interactions. The subdomains are connected by a flexible linker. In proteins a POU-specific domain is always accompanied by a homeodomain. Despite the lack of sequence homology, 3D structure of POUs is similar to 3D structure of bacteriophage lambda repressor and other members of HTH_3 family.
|
|
The one with b = 1 is homeomorphic to {0; (n1, 1); (2, 1), (2, 1)}. The first homology is Z+Z/2Z+Z/2Z if b=0, and Z+Z/4Z if b=1. These two Klein bottle bundle are surface bundles associated to the y-homeomorphism and the product of this and the twist.
|
|
Non-coding RNAs have been discovered using both experimental and bioinformatic approaches. Bioinformatic approaches can be divided into three main categories. The first involves homology search, although these techniques are by definition unable to find new classes of ncRNAs. The second category includes algorithms designed to discover specific types of ncRNAs that have similar properties.
|
|
If all examples of the RNA were upstream of homologous genes, there is the possibility that the RNAs were conserved in that position simply by inheritance. The non-homology of the genes downstream of hya RNAs makes this scenario less likely. The genes presumably regulated by hya RNAs are subunits of nickel-iron hydrogenase I.
|
|
This finding was also confirmed for other cytolethal distending toxins in subsequent studies. The discovery of the homology of cdtB to mammalian DNase I and the current AB model for the toxin were published in early 2000. Further research and the publication of crystal structures for the CDT toxins from two different species continues to support this model.
|
|
Members of the SLITRK family, such as SLITRK6, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1). Most SLITRKs, including SLITRK6, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity.
|
|
Kruszka, P., Li, D., Harr, M.H., Wilson, N.R., Swarr, D., McCormick, E.M., Chiavacci, R.M., Li, M., Martinez, A.F., Hart, R.A., et al. (2015). Mutations in SPECC1L, encoding sperm antigen with calponin homology and coiled-coil domains 1-like, are found in some cases of autosomal dominant Opitz G/BBB syndrome. J. Med. Genet. 52, 104–110.
|
|
D5 receptor is highly homologous to the D1 receptor. Their amino acid sequences are 49% to 80% identical. D5 receptor has a long C-terminus of 93 amino acids, accounting for 26% of the entire protein. In spite of the high degree of homology between D5 and D1 receptors, their c-terminus tails have little similarity.
|
|
One recent result is that the category of Reeb graphs is equivalent to a particular class of cosheaf. This is motivated by theoretical work in TDA, since the Reeb graph is related to Morse theory and MAPPER is derived from it. The proof of this theorem relies on the interleaving distance. Persistent homology is closely related to spectral sequences.
|
|
The GTF genes found in S. mutans most likely are derived from other anaerobic bacteria found in the oral cavity, such as Lactobacillus or Leuconostoc. Additionally, the GTF genes in S. mutans display homology with similar genes found in Lactobacillus and Leuconostoc. The common ancestral gene is believed to have been used for hydrolysis and linkage of carbohydrates.
|
|
It has 530 amino acid residues with 10–12 transmembrane segments, and is not homologous to other known monoamine transporters, such as the high-affinity SERT, DAT, and NET, or the low- affinity SLC22A OCT family. It was initially identified by a search of the draft human genome database by its sequence homology to ENTs (equilibrative nucleoside transporters).
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified alternatively spliced variants that encode different protein isoforms.
|
|
Michael Lounsbery Hutchings is an American mathematician, a professor of mathematics at the University of California, Berkeley.Faculty profile, UC Berkeley, retrieved 2013-01-21. He is known for proving the double bubble conjecture on the shape of two-chambered soap bubbles,. and for his work on circle-valued Morse theory and on embedded contact homology, which he defined.
|
|
They share 57% amino acid sequence homology and have some pharmacological characteristics in common. Both receptors are Gi-coupled (inhibit adenylate cyclase activity) and both receptors have high affinities for 5-HT and low affinities for 5-carboxyamidotryptaine and mesulergine. However, due to major differences in brain expression patterns, these receptors are unlikely to mediate similar functions in humans.
|
|
Methyltransferase-like protein 2B is an enzyme that in humans is encoded by the METTL2B gene. This gene is a member of a family of methyltransferases that share homology with, but are distinct from, the UbiE family of methyltransferases. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 4.
|
|
The lack of homology between NAAA and FAAH makes NAAA-specific targeting drugs far more feasible. However, because the fatty acid concentration circulating throughout one's bloodstream is positively correlated with obesity, decreased NAAA activity is thought to be correlated with obesity. This mechanism shows the inhibition of the catalytic cysteine by the most- tested β-lactone, ARN077.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified two transcript variants that encode different isoforms.
|
|
Bromodomain-containing protein 3 (BRD3) also known as RING3-like protein (RING3L) is a protein that in humans is encoded by the BRD3 gene. This gene was identified based on its homology to the gene encoding the RING3 (BRD2) protein, a serine/threonine kinase. The gene localizes to 9q34, a region which contains several major histocompatibility complex (MHC) genes.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified three transcript variants that encode different isoforms.
|
|
SWISS-MODEL pipeline comprises the four main steps that are involved in building a homology model of a given protein structure: # Identification of structural template(s). BLAST and HHblits are used to identify templates. The templates are stored in the SWISS- MODEL Template Library (SMTL), which is derived from PDB. # Alignment of target sequence and template structure(s).
|
|
Campylobacter mucosalis was initially isolated in 1974 by Lawson and Rowland from the lesions of porcine intestinal adenomatosis. Isolated species were gram-negative, microaerophilic and curve shaped. These organisms resembled Campylobacter sputorum in their morphological and phenotypic characteristics and were given the name Campylobacter sputorum subsp. mucosalis. A study, using DNA homology experiments, found that Campylobacter sputorum subsp.
|
|
These two effects increase the so-called window current, a measure for the non- inactivating fraction of the sodium currents, by 225%. Phaiodotoxin thus combines the actions of α-scorpion toxins (slowed inactivation) and β-scorpion toxins (enhanced activation). This dual action may be explained by the homology of Phaiodotoxin to both types of scorpion toxins.
|
|
They have rarely been associated with chronic kidney disease (secondary to reduced hCG clearance) and hyperthyroidism (given the structural homology with TSH). These cysts resolve after pregnancy. Rarely, when the theca-lutein cysts are stimulated by gonadotropins, massive ascites can result. In most cases, however, abdominal symptoms are minimal and restricted to peritoneal irritation from cyst hemorrhage.
|
|
Actin-binding protein (also known as ABP) are proteins that bind to actin. This may mean ability to bind actin monomers, or polymers, or both. Many actin-binding proteins, including α-actinin, β-spectrin, dystrophin, utrophin and fimbrin, do this through the actin-binding calponin homology domain. This is a list of actin-binding proteins in alphabetical order.
|
|
At the kinase domain it exhibits about 70% similarity with the ERK4 protein. The activation loop of the phosphorylation motif contains only one phospho acceptor site (Ser-Glu-Gly). The structure is predicted by homology modelling using the crystal structure of phoshphorylated ERK2. According to the model, the structure of ERK3/MAPK6 kinase domain resembles other MAP kinases.
|
|
LIM and SH3 domain protein 1 is a protein that in humans is encoded by the LASP1 gene. This gene encodes a member of a LIM protein subfamily which is characterized by a LIM motif and a domain of Src homology region 3. This protein functions as an actin-binding protein and possibly in cytoskeletal organization.
|
|
This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA binding proteins. It was found by homology to the Drosophila dead ringer gene, which is important for normal embryogenesis. Other ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation, and possibly in chromatin structure modification.
|
|
A-type lamins are characterized by a neutral isoelectric point, and they are typically displayed during later stages of embryonic development. Expressed in differentiated cells, A-type lamins originate from the LMNA gene. Two isoforms, lamins A and C, can be created from this gene via alternative splicing. This creates a high amount of homology between the isoforms.
|
|
Am. J. Bot. 85: 1507-1516. Among Eutacta section, New Caledonian species formed a monophyletic group where A. cunninghamii (Papua New Guinea) was derived first, then A. heterophylla (Norfolk Island). The New Caledonian species revealed a strong homology for rcbL sequences (from 99.5 to 100%), where 10 out of 13 species are identical for this gene sequence.
|
|
Dok-7 is a non-catalytic cytoplasmic adaptor protein that is expressed specifically in muscle and is essential for the formation of neuromuscular synapses. Further, Dok-7 contains pleckstrin homology (PH) and phosphotyrosine-binding (PTB) domains that are critical for Dok-7 function. Finally, mutations in Dok-7 are commonly found in patients with limb-girdle congenital myasthenia.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding two different isoforms were identified through sequence analysis.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Two transcript variants encoding distinct isoforms have been described.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 21q.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 11.
|
|
Oxysterol-binding protein 2 is a protein that in humans is encoded by the OSBP2 gene. Oxysterols are byproducts of cholesterol that can have cytotoxic effects on many cell types. The protein encoded by this gene contains a pleckstrin homology (PH) domain and an oxysterol-binding region. It binds oxysterols such as 7-ketocholesterol and may inhibit their cytotoxicity.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has been called mitochondrial ribosomal protein S35 in the literature.
|
|
Ovalbumin (abbreviated OVA) is the main protein found in egg white, making up approximately 55% of the total protein. Ovalbumin displays sequence and three- dimensional homology to the serpin superfamily, but unlike most serpins it is not a serine protease inhibitor. The function of ovalbumin is unknown, although it is presumed to be a storage protein.
|
|
M23 is one of the 26 sporadic groups and was introduced by . It is a 4-fold transitive permutation group on 23 objects. The Schur multiplier and the outer automorphism group are both trivial. calculated the integral cohomology, and showed in particular that M23 has the unusual property that the first 4 integral homology groups all vanish.
|
|
Morse homology can be carried out in the Morse–Bott setting, i.e. when instead of isolated nondegenerate critical points, a function has critical manifolds whose tangent space at a point coincides with the kernel of the Hessian at the point. This situation will always occur, if the function considered is invariant w.r.t a non-discrete Lie group.
|
|
In 1978, Edward B. Lewis helped to found evolutionary developmental biology, discovering that homeotic genes regulated embryonic development in fruit flies. In 1997, the term deep homology first appeared in a paper by Neil Shubin, Cliff Tabin, and Sean B. Carroll, describing the apparent relatedness in genetic regulatory apparatuses which indicated evolutionary similarities in disparate animal features.
|
|
In vertebrates, gap junction hemichannels are primarily homo- or hetero-hexamers of connexin proteins. Invertebrate gap junctions comprise proteins from the innexin family. Innexins have no significant sequence homology with connexins. Though differing in sequence to connexins, innexins are similar enough to connexins to state that innexins form gap junctions in vivo in the same way connexins do.
|
|
Pigeons and rats also discount hyperbolically; tamarin monkeys do not wait more than eight seconds to triple the amount of a food reward. The question arises as to whether this is a difference of homology or analogy—that is, whether the same underlying process underlies human-animal similarities or whether different processes are manifesting in similar patterns of results.
|
|
Before the emergence of cladistics as a school, Joseph Henry Woodger criticized phylogenetic systematics on the grounds that homology by way of common ancestry is "putting the cart before the horse, because descent from a common ancestor is something assumed, not observed. It belongs to theory, whereas morphological correspondence is observed.".Woodger, S. (1945). “On Biological Transformations”.
|
|
Structure of TEV protease. The double β-barrels that define the superfamily are highlighted in red. () The structure of TEV protease has been solved by X-ray crystallography. It is composed of two β-barrels and a flexible C-terminal tail and displays structural homology to the chymotrypsin superfamily of proteases (PA clan, C4 family by MEROPS classification).
|
|
About two-thirds of the secondary protein structure is predicted to consist of alpha helices. The remaining one-third is predicted to be random coils. Analysis of the secondary structure of CXorf38 isoform 1 orthologs from mammals to invertebrates revealed similar results, suggesting that secondary structure is largely conserved (see Homology and Evolution for ortholog details).
|
|
The method, EVfold, uses no homology modeling, threading or 3D structure fragments and can be run on a standard personal computer even for proteins with hundreds of residues. The accuracy of the contacts predicted using this and related approaches has now been demonstrated on many known structures and contact maps, including the prediction of experimentally unsolved transmembrane proteins.
|
|
The genus Rhaphiomidas formerly was considered to be a member of the fly family Apioceridae. However, recent taxonomic studies of the insect order Diptera indicate that it belongs in the family Mydidae.Sinclair, B. J., J. M. Cumming, and D. M. Wood. 1993. Homology and phylogenetic implications of male genitalia in Diptera-lower Brachyera. Ent. Scand. 24:407-342.
|
|
Lymphoid enhancer-binding factor-1 (LEF1) is a 48-kD nuclear protein that is expressed in pre-B and T cells. It binds to a functionally important site in the T-cell receptor-alpha (TCRA) enhancer and confers maximal enhancer activity. LEF1 belongs to a family of regulatory proteins that share homology with high mobility group protein-1 (HMG1).
|
|
Hedgehog acyltransferase (HHAT), also called skinny hedgehog homology in humans, is a human gene. The HHAT gene encodes an enzyme that catalyzes N-terminal palmitoylation of sonic hedgehog. Mutations in HHAT produce a phenotype that is similar to loss of hedgehog function. Finally the HHAT protein shares a short but significant sequence similarity to membrane-bound O-acyltransferases.
|
|
Activated Arp2/3 nucleates new F-actin. WASp is the founding member of a gene family which also includes the broadly expressed N-WASP (neuronal Wiskott–Aldrich Syndrome protein), SCAR./WAVE1, WASH, WHAMM, and JMY. WAML (WASP and MIM like), WAWH (WASP without WH1 domain), and WHIMP (WAVE Homology In Membrane Protrusions) have more recently been discovered.
|
|
Src homology 2 (SH2) domain containing inositol polyphosphate 5-phosphatase 1 (SHIP1) is an enzyme with phosphatase activity. SHIP1 is structured by multiple domain and is encoded by the INPP5D gene in humans. SHIP1 is expressed predominantly by hematopoietic cells but also, for example, by osteoblasts and endothelial cells. This phosphatase is important for the regulation of cellular activation.
|
|
Hierarchic Bayesian models for kernel learning. In Proceedings of the 22nd International Conference on Machine Learning, 2005 These methods have been used successfully in applications such as protein fold recognition and protein homology problems Theodoros Damoulas and Mark A. Girolami. Combining feature spaces for classification. Pattern Recognition, 42(11):2671–2683, 2009Theodoros Damoulas and Mark A. Girolami.
|
|
In mathematics, Alexander duality refers to a duality theory presaged by a result of 1915 by J. W. Alexander, and subsequently further developed, particularly by Pavel Alexandrov and Lev Pontryagin. It applies to the homology theory properties of the complement of a subspace X in Euclidean space, a sphere, or other manifold. It is generalized by Spanier–Whitehead duality.
|
|
They were initially classified as 'proteinases of unknown mechanism' by the Nomenculture Committee on the International Union of Biochemistry in 1978 with EC number 3.4.99 in 1983 (Owen et al., 1983). In the 1990s, they were defined as a serine proteases due to high sequence homology with alkaline protease, and their inhibition by serine protease inhibitors (Wang et al.
|
|
The α2C receptor has been reclassed from α1C, due to its greater homology with the α2 class, giving rise to the somewhat confusing nomenclature. The β receptors are divided into β1, β2 and β3. The receptors are classed physiologically, though pharmacological selectivity for receptor subtypes exists and is important in the clinical application of adrenergic agonists (and, indeed, antagonists).
|
|
IL-36ra is highly expressed by keratinocytes, in psoriatic skin, placenta, uterus, brain, kidneys, monocytes, B-lymphocytes and dendritic cells. IL-36ra is 155 amino acids long and lacks a signal sequence. IL-36ra shares with IL-1ra 52% homology in the amino acid sequence. IL-36ra acts as a non-specific inhibitor of inflammation and innate immunity.
|
|
Wnt ligands are classically described as acting in an autocrine/paracrine manner. Wnts are also hydrophobic with significant post-translational palmitoylation and glycosylation. These post-translational modifications are important for docking to extracellular lipoprotein particles allowing them to travel systemically. Additionally, due to the high degree of sequence homology between Wnts many are characterized by their downstream actions.
|
|
By contrast, the N-terminal part of myotilin is unique, consisting of a serine-rich region with no homology to known proteins. Several disease-associated mutations involve serine residues within the serine-rich domain. Myotilin expression in human tissues is mainly restricted to striated muscles and nerves. In muscles, myotilin is predominantly found within the Z-discs.
|
|
Trypanosoma brucei rhodesiense relies on a different mechanism of resistance: the serum resistance associated protein (SRA). The SRA gene is a truncated version of the major and variable surface antigen of the parasite, the variant surface glycoprotein. It has a low sequence homology with the VSGc (<25%). SRA is an expression site associated gene in T. b.
|
|
The N-terminal area has homology to several conserved domains of DNA helicases belonging to superfamily II, although XPF is not a DNA helicase. The C-terminal region of XPF includes the active site residues for nuclease activity. (Figure 1). Most of the ERCC1 protein is related at the sequence level to the C terminus of the XPF protein.
|
|
PDZ domain-containing protein GIPC3 is a protein that in humans is encoded by the GIPC3 gene. GIPC3 is a member of the GIPC (GAIP-interacting protein C terminus) gene family that also includes GIPC1 and GIPC2. The encoded protein, GIPC3, features a centrally located PDZ domain, which is flanked on each side by a single GIPC-homology domain.
|
|
Though AARP and CARP proteins show significant homology, their expression profiles in muscle cells are markedly different; CARP is expressed throughout atria and ventricles, in development and in adult myocytes, however AARP is almost exclusively ventricular and only in adult myocytes. AARP was also found to be expressed in rhabdomyosarcomas, exhibiting a pattern distinct from actin and desmin.
|
|
Aspartate aminotransferase, cytoplasmic is an enzyme that in humans is encoded by the GOT1 gene. Glutamic-oxaloacetic transaminase is a pyridoxal phosphate- dependent enzyme which exists in cytoplasmic and mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology.
|
|
Fibromodulin is a protein that in humans is encoded by the FMOD gene. Fibromodulin is a 42kDa protein of a family of small interstitial leucine-rich repeat proteoglycans (SLRPs). It can have up to four N-linked keratan sulfate chains attached to the core protein within the leucine-rich region. It shares significant sequence homology with biglycan and decorin.
|
|
However, arachaeal and eukaryotic homologues are now recognized. The mechanism of energy coupling is not established, but homology with the MATE family suggests that they are secondary carriers. These transporters may function together with auxiliary proteins that allow passage across just the cytoplasmic membrane or both membranes of the Gram-negative bacterial envelope. They may also regulate transport.
|
|
ERBB receptor feedback inhibitor 1 is a protein that in humans is encoded by the ERRFI1 gene. MIG6 is a Cytoplasmic protein whose expression is upregulated with cell growth (Wick et al., 1995). It shares significant homology with the protein product of rat gene-33, which is induced during cell stress and mediates cell signaling (Makkinje et al.
|
|
The pores may also be homotetramers or heterotetramers; where heterotetramers may be encoded as distinct genes or as multiple pore domains within a single polypeptide. The HVCN1 and Putative tyrosine-protein phosphatase proteins do not contain an expected ion conduction pore domain, but rather have homology only to the voltage sensor domain of voltage gated ion channels.
|
|
Polymerase (DNA directed) nu is a protein in humans that is encoded by the POLN gene. It is a family A DNA polymerase, considered to be the least effective of the polymerase enzymes. However, DNA polymerase nu plays an active role in homology repair during cellular responses to crosslinks, fulfilling its role in a complex with helicase.
|
|
Insect Immunity: septic injury of Drosophila induces the synthesis of a potent antifungal peptide with sequence homology to plant antifungal peptides. Journal of Biological Chemistry, 269 (1994), pp. 33159–33163L. Michaut, P. Fehlbaum, M. Moniatte, A. Van Dorsselaer, J.M. Reichhart, P. Bulet. Determination of the disulfide array of the first inducible antifungal peptide from insects: drosomycin from Drosophila melanogaster.
|
|
A comparative chromosome map of birds' and mammals' inferred human homologies (right numbers) on chromosome idiograms The third step occurred when molecular techniques were incorporated into cytogenetics. These techniques use DNA probes of diverse sizes to compare chromosomes at the DNA level. Homology can be confidently compared even between phylogenetically distant species or highly rearranged species (e.g., gibbons).
|
|
The serine-threonine protein kinase AKT1 is catalytically inactive in serum- starved primary and immortalized fibroblasts. AKT1 and the related AKT2 are activated by platelet-derived growth factor. The activation is rapid and specific, and it is abrogated by mutations in the pleckstrin homology domain of AKT1. It was shown that the activation occurs through phosphatidylinositol 3-kinase.
|
|
Lysine Adenylosuccinate lyase Biochemical studies of the enzyme have focused on proteins of ADSL from nonhuman species, the ADSL structure from the crystallized protein of Thermotoga maritime has been used, along with DNA sequencing data, to construct homology models for a variety of other organisms, including human ADSL. A variety of studies have been done using the equivalent enzyme from Bacillus subtilis, which shares a significant percentage of identity along with about some percentage of similarity in amino acid sequence with the human enzyme. Homology models overlaid on each other show a high degree of overlap between the enzymes. The family of enzymes to which ADSL belongs and that catalyze β-eliminations in which fumarate is one of the products are homotetramers with four active sites composed of amino acid residues from three distinct subunits.
|
|
The pleckstrin homology domain of AKT binds directly to PtdIns(3,4,5)P3 and PtdIns(3,4)P2, which are produced by activated PI3Ks. Since PtdIns(3,4,5)P3 and PtdIns(3,4)P2 are restricted to the plasma membrane, this results in translocation of AKT to the plasma membrane. Likewise, the phosphoinositide- dependent kinase-1 (PDK1 or, rarely referred to as PDPK1) also contains a pleckstrin homology domain that binds directly to PtdIns(3,4,5)P3 and PtdIns(3,4)P2, causing it to also translocate to the plasma membrane upon PI3K activation. The interaction of activated PDK1 and AKT allows AKT to become phosphorylated by PDK1 on threonine 308, leading to partial activation of AKT. Full activation of AKT occurs upon phosphorylation of serine 473 by the TORC2 complex of the mTOR protein kinase.
|
|
This approach to Morse–Bott homology appeared in the context of unpublished work for contact homology by Bourgeois, in which the critical submanifolds are the sets of Reeb orbits, and the gradient flows between the critical submanifolds are pseudoholomorphic curves in the symplectization of a contact manifold asymptotic to Reeb orbits in the relevant critical manifolds of Reeb orbits. If we extend each Morse function to a function on the entire manifold supported near the critical submanifolds, we can explicitly write down a Morse–Smale function that perturbs the original Morse–Bott function. Namely, multiply each of the extended functions by some small positive constant, sum them and add the result to the original Morse–Bott function. The broken flows described above will be C0 close to the flow lines of this Morse–Smale function.
|
|
Protein threading, also known as fold recognition or 3D-1D alignment, can also be used as a search technique for identifying templates to be used in traditional homology modeling methods. Recent CASP experiments indicate that some protein threading methods such as RaptorX indeed are more sensitive than purely sequence(profile)-based methods when only distantly- related templates are available for the proteins under prediction. When performing a BLAST search, a reliable first approach is to identify hits with a sufficiently low E-value, which are considered sufficiently close in evolution to make a reliable homology model. Other factors may tip the balance in marginal cases; for example, the template may have a function similar to that of the query sequence, or it may belong to a homologous operon.
|
|
Chao-ting Wu (; born January 24, 1954) is an American molecular biologist. After training at Harvard Medical School in genetics with William Gelbart, at Stanford Medical School with David Hogness, and in a fellowship at Massachusetts General Hospital in molecular biology, Wu began her independent academic career as an assistant professor in Anatomy and Cellular Biology and then Genetics at Harvard Medical School in 1993. After a period as Professor of Pediatrics in the Division of Molecular Medicine at the Boston Children's Hospital, she returned to the Department of Genetics at Harvard Medical School as a full professor in 2007. Wu's research has focused on the role of chromosome behavior gene activity and inheritance, with emphasis on widespread homology effects, phenomena in which homology between chromosomes plays a role.
|
|
In algebraic graph theory, the circuit rank is also the dimension of the cycle space of G. Intuitively, this can be explained as meaning that the circuit rank counts the number of independent cycles in the graph, where a collection of cycles is independent if it is not possible to form one of the cycles as the symmetric difference of some subset of the others. This count of independent cycles can also be explained using homology theory, a branch of topology. Any graph may be viewed as an example of a 1-dimensional simplicial complex, a type of topological space formed by representing each graph edge by a line segment and gluing these line segments together at their endpoints. The cyclomatic number is the rank of the first (integer) homology group of this complex,.
|
|
He argues that punk emerged as a mainly white style when black youth became more separatist in the 1970s in response to discrimination in British society. Previous research described a homology between the different aspects of a subcultural style (dress, hairstyle, music, drugs), while Hebdige argues that punk in London in 1976-77 borrowed from all previous subcultures and its only homology was chaos. In making this argument, he draws on the early work of Julia Kristeva who also found such subversion of meaning in French poets such as Mallarmé and Lautréamont. Hebdige’s 1987 book Cut’n’Mix: Culture, Identity and Caribbean Music focuses on the music of the Caribbean including calypso, ska, reggae, and Caribbean club culture. Cut’n’Mix traces the roots of this music and describes the style and cultural identity that have developed alongside it.
|
|
EVI1 is a proto-oncogene conserved across humans, mice, and rats, sharing 91% homology in nucleotide sequence and 94% homology in amino acid sequence between humans and mice. It is a transcription factor localized to the nucleus and binds DNA through specific conserved sequences of GACAAGATA with the potential to interact with both corepressors and coactivators. ;Embryogenesis: The role of EVI1 in embryogenesis and development is not completely understood, but it has been shown that EVI1 deficiency in mice is an embryonic lethal mutation, characterized primarily by widespread hypocellularity and poor/disrupted development of the cardiovascular and neural system. EVI1 is highly expressed in the murine embryo, found in the urinary system, lungs, and heart, but is only minutely detectable in most adult tissues, indicating a likely role in tissue development.
|
|
Like all other Hsp40 members it also contains a classic J domain. Zuotin and related proteins contain a unique Zuotin homology domain (ZHD). It associates with the Hsp70 family Ssz1 to form a ribosome associated complex (RAC). In such a complex, the N-terminal domains (including the J domain) associates with Ssz1p on the surface of the large (60S) ribosomal subunit.
|
|
HHpred is an online server for protein structure prediction that uses homology information from HH-suite. The HH- suite searches for sequences using hidden Markov models (HMMs). The name comes from the fact that it performs HMM-HMM alignments. Among the most popular methods for protein sequence matching, the programs have been cited more than 5000 times total according to Google Scholar.
|
|
More than one way exists to classify the applications of TDA. Perhaps the most natural way is by field. A very incomplete list of successful applications includes data skeletonization, shape study, graph reconstruction, image analysis, material, progression analysis of disease, sensor network,De Silva V, Ghrist R. Coverage in sensor networks via persistent homology[J]. Algebraic & Geometric Topology, 2007, 7(1): 339-358.
|
|
Both of these proteins share a common domain with an 8-stranded beta-barrel fold. This resembles the lipocalin fold, although no sequence homology exists with lipocalins. In TTHA0802, the protein binds the polyisoprenoid chain within the pore of the barrel via hydrophobic interactions. Sequence homologues of this core structure are present in a wide range of bacteria and archaea.
|
|
Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. This gene lies adjacent to and downstream of the gonadotropin-releasing hormone precursor gene.
|
|
Vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase activating polypeptide (PACAP) are homologous peptides that function as neurotransmitters and neuroendocrine hormones. While the receptors for VIP (VIRP 1 and 2) and PACAP (ADCYAP1R1) share homology, they differ in their substrate specificities and expression patterns. VIPR2 transduction results in upregulation of adenylate cyclase activity. Furthermore, VIPR2 mediates the anti-inflammatory effects of VIP.
|
|
Fimbrin is present in several distinct structures in different cell types, including intestinal microvilli, hair cell stereocilia and fibroblast filopodia. It is usually associated with polarized actin filaments in membrane ruffles, filopodia, stereocilia and adhesion plaques. Sequence homology and biochemical properties show that fimbrin is highly conserved from yeast to humans. Yeast mutants lacking fimbrin are defective in morphogenesis and endocytosis.
|
|
Transcription factor LBX1 is a protein that in humans is encoded by the LBX1 gene. This gene and the orthologous mouse gene were found by their homology to the Drosophila lady bird early and late homeobox genes. In the mouse, this gene is a key regulator of muscle precursor cell migration and is required for the acquisition of dorsal identities of forelimb muscles.
|
|
Members of the SLITRK family, such as SLITRK2, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK2, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity.
|
|
Structural Details of TMEM241 Isoform 1 Alpha helix wheel diagram of TMEM241 isoform 1 showing hydrophobic and hydrophilic region interactions with lipid membrane. TMEM241 is composed of 9 transmembrane domains forming a hydrophobic integral component of the membrane composed primarily of alpha helices. TMEM241 contains a VRG4 (Vandate Resistance Glycosylation) domain with homology to the sugar transporter domain VRG4 from Saccharomyces cerevisiae (yeast).
|
|
ATPase WRNIP1 is an enzyme that in humans is encoded by the WRNIP1 gene. Werner's syndrome is a rare autosomal recessive disorder characterized by premature aging. The protein encoded by this gene interacts with the N-terminal portion of Werner protein containing the exonuclease domain. This protein shows homology to replication factor C family proteins, and is conserved from E. coli to human.
|
|
In 1942–45, Samuel Eilenberg and Saunders Mac Lane introduced categories, functors, and natural transformations as part of their work in topology, especially algebraic topology. Their work was an important part of the transition from intuitive and geometric homology to homological algebra. Eilenberg and Mac Lane later wrote that their goal was to understand natural transformations. That required defining functors, which required categories.
|
|
This gene encodes a member of the POP family of proteins which contain three putative transmembrane domains. This membrane associated protein is predominantly expressed in skeletal and cardiac muscle. The Popeye domain, which is located in the cytoplasmic part of the protein displays limited sequence homology to other proteins, while sequence conservation amongst Popeye proteins is high and amounts to approximately 40%–60%.
|
|
RANK is encoded on human chromosome 18q22.1. It shows 85% homology between mouse and human homologues. There are two monomers of RANK related by noncrystallographic 2-fold symmetry perpendicular to the long axis of the molecules in the asymmetric unit. RANK contains four CRDs spanning a length of 100 Angstroms which makes it the longest member of the TNFR family to date.
|
|
Spanning from amino acid 1886 until amino acid 1983, this domain is referred to as a Pleckstrin Homology domain in the BEACH domain. It has a PH because the fold of this domain is similar to the PH domain, but is not identical in the sequence of the canonical PH domains. The PH_BEACH domain is not able to bind phospholipids.
|
|
It has been suggested that SMO is regulated by a small molecule, the cellular localization of which is controlled by PTCH. PTCH1 has homology to Niemann- Pick disease, type C1 (NPC1) that is known to transport lipophilic molecules across a membrane. PTCH1 has a sterol sensing domain (SSD), which has been shown to be essential for suppression of SMO activity.
|
|
The face ring k[Δ] is a multigraded algebra over k all of whose components with respect to the fine grading have dimension at most 1. Consequently, its homology can be studied by combinatorial and geometric methods. An abstract simplicial complex Δ is called Cohen–Macaulay over k if its face ring is a Cohen–Macaulay ring.Miller & Sturmfels (2005) p.
|
|
LIM domain only protein 7 is a protein that in humans is encoded by the LMO7 gene. This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain. An F-box (FBX) domain is present in alternative splice variants. Members of the LIM protein family carry the LIM domain, a unique cysteine-rich zinc-binding domain.
|
|
Signal transduction protein CBL-C is a protein that in humans is encoded by the CBLC gene. CBL proteins, such as CBLC, are phosphorylated upon activation of a variety of receptors that signal via protein tyrosine kinases. Through interactions with proteins containing SRC (MIM 190090) homology-2 (SH2) and SH3 domains, CBL proteins modulate downstream cell signaling (Keane et al., 1999).
|
|
Ib Madsen in Oberwolfach, 2008 Ib Henning Madsen (born April 12, 1942 in Copenhagen)Curriculum vitae, retrieved 2013-02-03. is a Danish mathematician, a professor of mathematics at the University of Copenhagen. He is known for (with Michael Weiss) proving the Mumford conjecture on the cohomology of the stable mapping class group, and for developing topological cyclic homology theory.
|
|
The NLRC4 protein is highly conserved across mammalian species. It bears homology to the C. elegans Ced4 protein. It contains an n-terminal CARD domain, a central nucleotide binding/NACHT domain, and a c-terminal leucine rich repeat (LRR) domain. It belongs to a family of NLR proteins that includes the transcriptional co- activator CIITA and the canonical inflammasome protein NLRP3.
|
|
Modulator of apoptosis 1 is a protein that in humans is encoded by the MOAP1 gene. The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.
|
|
It shows homology (in the functional domains) with other members of the PAR-bZIP subfamily of transcription factors, which include albumin D box-binding protein (DBP), human hepatic leukemia factor (HLF) and chicken vitellogenin gene-binding protein (VBP); VBP is considered the chicken homologue of TEF. Different members of the subfamily can readily form heterodimers, and share DNA-binding, and transcriptional regulatory properties.
|
|
The SH2 (Src Homology 2) domain is a structurally conserved protein domain contained within the Src oncoprotein and in many other intracellular signal- transducing proteins. SH2 domains allow proteins containing those domains to dock to phosphorylated tyrosine residues on other proteins. SH2 domains are commonly found in adaptor proteins that aid in the signal transduction of receptor tyrosine kinase pathways.
|
|
Computer-assisted analysis of the internal homology in amino acid sequence suggested duplication of an ancestral gene thus indicating that Hx consists of two similar halves. Altruda et al. (1988) demonstrated that the HPX gene spans approximately 12 kb and is interrupted by 9 exons. The demonstration shows direct correspondence between exons and the 10 repeating units in the protein.
|
|
Fluorescence recovery protein (FRP) is a small protein involved in regulating non-photochemical quenching in cyanobacteria. It prevents accumulation of the red photoactivated form of orange carotenoid protein (OCP), thereby reducing the amount of fluorescence quenching that occurs between the OCP and the phycobilisome antenna complexes. It interacts with the C-terminal domain of OCP, which shares homology with the NTF2 superfamily.
|
|
The distal end has an articulation for an additional cartilaginous segment or series. Therefore, the difference in pelvic claspers between genders suggests that sexual dimorphism was already present in the arthrodires in the Devonian. Pelvic claspers have also been discovered in pyctodontid fossils suggesting homology. It is therefore suggested that pelvic claspers may characterise all of the pytodontids and arthrodires.
|
|
One may define the cohomology of functions H with respect to the Laplacian. In Geometry of Batalin-Vilkovisky quantization, Albert Schwarz has proven that the integral of a function H over a Lagrangian submanifold L depends only on the cohomology class of H and on the homology class of the body of L in the body of the ambient supermanifold.
|
|
Treacle protein is a protein that in humans is encoded by the TCOF1 gene. This gene encodes a nucleolar protein with an LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development.
|
|
Active conformation of P. marinus cADO (-A) showing active site coordination. Apoenzyme conformation of P.marinus cADO (-B) showing helix 5 unfolding and active site exposure. Cofactors are included for illustration. Cyanobacterial aldehyde deformylating oxygenases are cytosolic nonheme di-iron oxygenases, but are much smaller (29 kDa) than other members of the family, and share sequence homology with ferritin-like or ribonucleotide reductases.
|
|
Early studies with deletions of RAB11 homologs in Saccharomyces cerevisiae proved their importance in cell survival. Despite sharing high sequence homology, Rab11a and Rab11b appear to reside within distinct vesicle compartments. Majority of Rab11b neither colocalize with transferrin receptor nor with the polymeric IgA receptor. This protein also exhibits a dependence on the microtubule cytoskeleton that is different from Rab11a.
|
|
Human endogenous retroviruses were discovered by accident using a couple of different experiments. Human genomic libraries were screened under low- stringency conditions using probes from animal retroviruses, allowing the isolation and characterization of multiple, though defective, proviruses, that represented various families. Another experiment depended on oligonucleotides with homology to viral primer binding sites. HERVs are classified based on their homologies to animal retroviruses.
|
|
These invariants have many interesting relationships with several older branches of mathematics, including de Rham theory, Hochschild (co)homology, group cohomology, and the K-theory. Contributors to the development of the theory include Max Karoubi, Yuri L. Daletskii, Boris Feigin, Jean-Luc Brylinski, Mariusz Wodzicki, Jean-Louis Loday, Victor Nistor, Daniel Quillen, Joachim Cuntz, Ryszard Nest, Ralf Meyer, and Michael Puschnigg.
|
|
In algebraic topology, a branch of mathematics, a simple space is a connected topological space that has a homotopy type of a CW complex and whose fundamental group is abelian and acts trivially on the homotopy and homology of the universal covering space. Though not all authors include the assumption on the homotopy type. For example, any topological group is a simple space.
|
|
Chromodomain-helicase-DNA-binding protein 1-like (ALC1) is an enzyme that in humans is encoded by the CHD1L gene. It has been implicated in chromatin remodeling and DNA relaxation process required for DNA replication, repair and transcription. The ALC1 comprises ATPase domain and macro domain. On the basis of homology within the ATPase domain, ALC1 belongs to Snf2 family.
|
|
Some GEFs are specific to a single GTPase while others have multiple GTPase substrates. While different subfamilies of Ras superfamily GTPases have a conserved GTP binding domain, this is not the case for GEFs. Different families of GEFs correspond to different Ras subfamilies. The functional domains of these GEF families are not structurally related and do not share sequence homology.
|
|
Tianyulong has a row of long, filamentous integumentary structures on the back, tail and neck of the specimen. The similarity of these structures with those found on some theropods suggests their homology with feathers and raises the possibility that the earliest dinosaurs and their ancestors were covered with homologous dermal filamentous structures that can be considered primitive feathers ("proto-feathers").
|
|
Comparative modeling, also known as homology modeling, corresponds to the methodology to construct three- dimensional structures from an amino acid sequence of a target protein and a template with known structure. The literature has described that evolutionarily related proteins tend to present a conserved three-dimensional structure. In addition, sequences of distantly related proteins with identity lower than 20% can present different folds.
|
|
Protein backbone fragment libraries have been used successfully in a variety of structural biology applications, including homology modeling,Kolodny, R., Guibas, L., Levitt, M., and Koehl, P. (2005, March). Inverse Kinematics in Biology: The Protein Loop Closure Problem. The International Journal of Robotics Research 24(2-3), 151-163. de novo structure prediction, Simons, K., Kooperberg, C., Huang, E., and Baker, D. (1997).
|
|
This gives a repertoire of examples, since the first homology group is the abelianization of the fundamental group. With every perfect group G one can associate a (canonical, terminal) acyclic space, whose fundamental group is a central extension of the given group G. The homotopy groups of these associated acyclic spaces are closely related to Quillen's plus construction on the classifying space BG.
|
|
In mathematics, Toda–Smith complexes are spectra characterized by having a particularly simple BP-homology, and are useful objects in stable homotopy theory. Toda–Smith complexes provide examples of periodic self maps. These self maps were originally exploited in order to construct infinite families of elements in the homotopy groups of spheres. Their existence pointed the way towards the nilpotence and periodicity theorems.
|
|
The protein contains three domains. The amino N-terminal domain contains the active site, responsible for the glucosylating activity of the toxin. Both TcdA and TcdB use this highly conserved N-terminal region (74% homology between both toxins) to alter identical substrates. The carboxy C-terminal domain contains repeating units that are responsible for receptor binding on target cell surfaces.
|
|
This gene is a member of the GRB2-associated binding protein gene family. These proteins are scaffolding/docking proteins that are involved in several growth factor and cytokine signaling pathways, and they contain a pleckstrin homology domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. The protein encoded by this gene facilitates macrophage differentiation. Alternative splicing results in multiple transcript variants.
|
|
The first ORF encode a 500 amino acid - 40 kDa protein that lacks homology with any protein of known function. In vertebrates, it contains a conserved C-terminus domain and a highly variable coiled-coil N-terminus that mediates the formation of ORF1 trimeric complexes. ORF1 trimers have RNA-binding and nucleic acid chaperone activity that are necessary for retrotransposition.
|
|
The edges of each triangle can be oriented so as to form a cycle. These two cycles are by construction not boundaries (since every 2-chain is zero). One can compute that the homology group H1(S) is isomorphic to Z2, with a basis given by the two cycles mentioned. This makes precise the informal idea that S has two "1-dimensional holes".
|
|
The protein encoded by IL17A is a founding member of IL-17 family (see below). IL17 protein exhibits a high homology with a viral IL-17-like protein encoded in the genome of T-lymphotropic rhadinovirus Herpesvirus saimiri. In rodents, IL-17 is often referred to as CTLA8. The biologically active IL-17 interacts with type I cell surface receptor IL-17R.
|
|
Ceruloplasmin (or caeruloplasmin) is a ferroxidase enzyme that in humans is encoded by the CP gene. Ceruloplasmin is the major copper-carrying protein in the blood, and in addition plays a role in iron metabolism. It was first described in 1948. Another protein, hephaestin, is noted for its homology to ceruloplasmin, and also participates in iron and probably copper metabolism.
|
|
Streptococcus constellatus is a species of Streptococcus part of the normal flora in the oral cavity, urogenital region, and intestinal tract. However, it can frequently cause purulent infections in other parts of the body. DNA homology studies and 16S rRNA sequence analysis demonstrate S. constellatus belongs to the Streptococcus anginosus group (milleri group) along with Streptococcus intermedius and Streptococcus anginosus.
|
|
Eilenberg's main body of work was in algebraic topology. He worked on the axiomatic treatment of homology theory with Norman Steenrod (whose names the Eilenberg–Steenrod axioms bear), and on homological algebra with Saunders Mac Lane. In the process, Eilenberg and Mac Lane created category theory. Eilenberg was a member of Bourbaki and, with Henri Cartan, wrote the 1956 book Homological Algebra.
|
|
The ROCK isoforms are encoded by two different identified genes and are ubiquitously expressed. GTPase-RhoA binding can increase the activity of ROCK1 by 1.5-2-fold. Without RhoA binding, lipids such as arachidonic acid or sphingosine phosphorylcholine can increase ROCK1 activity 5- to 6-fold. These two lipids interact with the pleckstrin-homology domain, thus disrupting its ability to inhibit ROCK1.
|
|