The tiny red creatures, called dinoflagellates, discolor the water during the day.
|
|
This ghostly light is produced by single-celled planktonic creatures called dinoflagellates.
|
|
They expected the copepods to gobble up the toxin-free dinoflagellates quickly.
|
|
Ironically, dinoflagellates are also responsible for one of nature's nastiest phenomena—red tides.
|
|
Inside the vial is water and a bloom of dinoflagellates, also known as bioluminescent algae.
|
|
Other marine organisms—most notably, dinoflagellates—glow in response to some form of physical stimulation.
|
|
The live dinoflagellates for the Dino Sphere are contained in a Blue Dino Food formulation.
|
|
Blue-green algae are cyanobacteria, for instance, while red tide is composed of tiny dinoflagellates.
|
|
Created by a company called BioPop, my Dino Pet contains lots of itty bitty dinoflagellates.
|
|
Like humans, dinoflagellates follow a roughly 24-hour circadian cycle triggered by phases of sunlight.
|
|
I do feel bad about this now that I know more about dinoflagellates' circadian rhythms.
|
|
In other words, the dinoflagellates on my night stand in New York had severe jet lag.
|
|
Scientists would later discover that the glow was caused by dinoflagellates that also produce a hazardous neurotoxin.
|
|
Another project involves harvesting light-producing marine plankton called dinoflagellates to produce a liquid that glows at night.
|
|
Full dino disclosure: The dinoflagellates in the batch at top are different from my original slow-adjusting batch.
|
|
The same dinoflagellates that light up this aquarium treated the shores of Tasmania to an underwater light show earlier this year.
|
|
By contrast, in colonies where L. polyedra were able to glow normally, the dinoflagellates formed only a quarter of the copepod diet.
|
|
Wornowiid dinoflagellates, for example, are single cells, but have tiny eyes with a lens and retina that they apparently use to hunt down prey.
|
|
In some cases, the researchers tinkered with the dinoflagellates' internal biological clocks, to rob them of their ability to glow during the experimental period.
|
|
Dinoflagellates, if you are having trouble summoning a sixth-grade biology lesson, are usually ocean-dwelling, single-celled organisms also known as marine plankton.
|
|
But in the grand scheme of circadian disruptions, a biannual shift in an hour is not the end of the world for humans — or dinoflagellates.
|
|
There is a kind of arms race between hunting dinoflagellates and their prey, Dr. Gavelis said, with a buildup of armor and more effective darts.
|
|
And then upon revisiting the instructions, everything was illuminated: Until now, your dinoflagellates were raised in San Diego, Calif.. They've been waking up at 5 a.m.
|
|
The results are less stunning during the day: The dinoflagellates discolor the water in a phenomenon known as red tide, according to the Scripps Institution of Oceanography.
|
|
When physically agitated, dinoflagellates give rise to the telltale sparkling wakes that get churned up behind boats at night, like those in the famed Bioluminescent Bay in Vieques, Puerto Rico.
|
|
Dr. Gavelis has been fascinated by the dinoflagellates that hunt with projectiles since he was an undergraduate student, and wondered whether their darts were related to the stingers in jellyfish.
|
|
Examples include single-celled dinoflagellates that accumulate on coral and giant clams and use photosynthesis to provide sustenance to their hosts, and gut bacteria that helps bugs break down plant compounds.
|
|
All you have to do is pour some dinoflagellates and dino food into the Dino Pet (there's an opening on the bottom) and it will naturally start glowing within two days.
|
|
When travelers go on a dark night with a tour guide (avoid days around and on a full moon), they can get in the water and swim with microscopic sea life called dinoflagellates.
|
|
When Satbir Multani and Mathura Govindarajan, two students at New York University's Tisch School of the Arts, heard that these dinoflagellates did this in response to vibration, they wondered what would happen if they played music around them.
|
|
Unlike humans who may find ways to mask their irritability, sleepiness or lack of concentration, dinoflagellates are very direct about their inability to perform when their schedule is out of whack: They simply won't glow the same way.
|
|
Reports of glowing waves down the California coast have spiked since early January, most likely due to a combination of high nutrient rates and calm conditions that form layers of highly concentrated dinoflagellates in the water, Haddock explains.
|
|
Meanwhile, in the third set of colonies—those in which the dinoflagellates had been primed to the presence of copepods by exposure to copepodamide—they flashed brightly as the copepods approached, and in doing so drove the crustaceans instantly away.
|
|
Vieques, eight miles to the east of the main island, offers up one of Puerto Rico's most impressive national natural landmarks: Thanks to an overabundance of marine organisms called dinoflagellates, its bioluminescent bay glows neon blue whenever the water is disturbed.
|
|
Mixotrophic dinoflagellates can feed on various organisms including bacteria, picoeukaryotes, nanoflagellates, diatoms, protists, metazoans and other dinoflagellates, as well. Feeding and digestion rates in mixotrophic dinoflagellates are lower than those in strictly heterotrophic dinoflagellates. Mixotrophic dinoflagellates do not feed on blood, eggs, adult metazoans, and flesh, such as occurs in some heterotrophic dinoflagellates.
|
|
Food inclusions contain bacteria, bluegreen algae, small dinoflagellates, diatoms, ciliates, and other dinoflagellates. Mechanisms of capture and ingestion in dinoflagellates are quite diverse. Several dinoflagellates, both thecate (e.g. Ceratium hirundinella, Peridinium globulus) and nonthecate (e.g.
|
|
Dinoflagellates are eukaryotic plankton, existing in marine and freshwater environments. Previously, dinoflagellates had been grouped into two categories, phagotrophs and phototrophs. Mixotrophs, however include a combination of phagotrophy and phototrophy. Mixotrophic dinoflagellates are a sub-type of planktonic dinoflagellates and are part of the phylum Dinoflagellata.
|
|
Calcareous dinoflagellate cysts or calcareous dinocysts are dinoflagellate cysts produced by a group of peridinoid dinoflagellates, called calcareous dinoflagellates.
|
|
Dinoflagellates produce characteristic lipids and sterols. In: One of these sterols is typical of dinoflagellates and is called dinosterol.
|
|
Haplozoon (/hæploʊ’zoʊən/) are unicellular endo-parasites, primarily infecting maldanid polychaetes. They belong to Dinoflagellata but differ from typical dinoflagellates. Most dinoflagellates are free-living and possess two flagella. Instead, Haplozoon belong to a 5% minority of parasitic dinoflagellates that are not free-living.
|
|
The main source for identification of freshwater dinoflagellates is the Süsswasser Flora. Calcofluor-white can be used to stain thecal plates in armoured dinoflagellates.
|
|
Dinoxanthin is a type of xanthophyll found in dinoflagellates. This compound is a potential antioxidant and may help to protect dinoflagellates against reactive oxygen species.
|
|
Mixotroph dinoflagellates belonging to the species Gymnodinium sanguineum feed on nanociliate populations in Chesapeake Bay. Predation on ciliates is advantageous for G. sanguineum as the ciliates provide a source of nitrogen which is limiting to the growth of purely photosynthetic dinoflagellates. By preying on ciliates, these dinoflagellates reverse the normal flow of material from primary producer to consumer and influence the trophodynamics of the microbial food web in Chesapeake Bay Several established ecological models of marine microbial food webs have not included feeding by mixotrophic dinoflagellates. These additions would include feeding by mixotrophic dinoflagellates on bacteria, phytoplankton, other mixotrophic dinoflagellates and nanoflagellates, and heterotrophic protists.
|
|
If both forms are required, the organisms are mixotrophic sensu stricto. Some free-living dinoflagellates do not have chloroplasts, but host a phototrophic endosymbiont. A few dinoflagellates may use alien chloroplasts (cleptochloroplasts), obtained from food (kleptoplasty). Some dinoflagellates may feed on other organisms as predators or parasites.
|
|
Marine dinoflagellate species undergo three major trophic modes: autotrophy, mixotrophy and heterotrophy. Many species of dinoflagellates were previously assumed to be exclusively autotrophic; however, recent research has revealed that many dinoflagellates that were thought to be exclusively phototrophic are actually mixotrophic. Mixotrophic dinoflagellates can undergo both photosynthesis and phagocytosis as methods of feeding. Mixotrophic dinoflagellates with individual plastids that depend mostly on photosynthesis can prey on other cells as their secondary source of nutrients.
|
|
Organisms producing calcareous structures are exclusively found in a small group of peridinoid dinoflagellates, called calcareous dinoflagellates. Such calcareous structures are either dinocysts (systematized as CalciodinelloideaeFensome, R.A., Taylor, F.J.R., Norris, G., Sarjeant, W.A.S., Wharton, D.I., Williams, G.L., 1993. A classification of living and fossil dinoflagellates. Micropalaeontology (Special Publication) 7, 1–245.), which are formed during the life cycle (i.e.
|
|
Dinoroseobacter shibae is a facultative anaerobic anoxygenic photoheterotroph belonging to the family, Rhodobacteraceae. First isolated from washed cultivated dinoflagellates, they have been reported to have mutualistic as well as pathogenic symbioses with dinoflagellates.
|
|
Ceratiaceae is a family of dinoflagellates in the order Gonyaulacales.
|
|
Gonyaulacales is an order of dinoflagellates found in marine environments.
|
|
Cleistosphaeridium is a genus of dinoflagellates in the order Gonyaulacales.
|
|
Corythodinium is a genus of dinoflagellates in the family Oxytoxaceae.
|
|
Amphidinium is a genus of dinoflagellates. The type for the genus is Amphidinium operculatum Claparède & Lachmann. The genus includes the species Amphidinium carterae which is used as a model organism. As dinoflagellates, Amphidinium spp.
|
|
Many of these organisms contribute to the formation of reefs. Also, Unicellular dinoflagellates live in the tissues of corals, and have a mutualistic relationship in which the dinoflagellates provide the corals with organic molecules.
|
|
Red tide off the coast of La Jolla, California. Gonyaulax is a genus of dinoflagellates with the type species Gonyaulax spinifera (Claparède et Lachmann) Diesing. Gonyaulax belongs to red dinoflagellates and commonly causes red tides.
|
|
Tripos elegans is a species of dinoflagellates in the family Ceratiaceae.
|
|
Suessiales is an order of dinoflagellates. It includes Polarella and Symbiodinium.
|
|
Most of these clams live in symbiosis with photosynthetic dinoflagellates (zooxanthellae).
|
|
Neoceratium tripos is a species of dinoflagellates of the genus Neoceratium.
|
|
Dinoflagellates are mainly represented as fossils by fossil dinocysts, which have a long geological record with lowest occurrences during the mid-Triassic, whilst geochemical markers suggest a presence to the Early Cambrian. Some evidence indicates dinosteroids in many Paleozoic and Precambrian rocks might be the product of ancestral dinoflagellates (protodinoflagellates). Molecular phylogenetics show that dinoflagellates are grouped with ciliates and apicomplexans (=Sporozoa) in a well-supported clade, the alveolates. The closest relatives to dinokaryotic dinoflagellates appear to be apicomplexans, Perkinsus, Parvilucifera, syndinians, and Oxyrrhis.
|
|
Each cell produces numerous gametes, which resemble more typical athecate dinoflagellates and have the dinokaryotic nuclei. Evidence suggests that they diverged from most other dinoflagellates early on, and they are generally placed in their own class.
|
|
Polarella is a genus of dinoflagellates. It includes the species Polarella glacialis.
|
|
Oxyphysis is a genus of dinoflagellates. It includes the species Oxyphysis oxytoides.
|
|
Prorocentrum donghaiense is a species of bloom-forming species of planktonic dinoflagellates.
|
|
Ostreopsidaceae is a family of free-living dinoflagellates found in marine environments.
|
|
Dinoflagellates are alveolates possessing two flagella, the ancestral condition of bikonts. About 1,555 species of free-living marine dinoflagellates are currently described. Another estimate suggests about 2,000 living species, of which more than 1,700 are marine (free-living, as well as benthic) and about 220 are from fresh water. The latest estimates suggest a total of 2,294 living dinoflagellate species, which includes marine, freshwater, and parasitic dinoflagellates.
|
|
Glowing dinoflagellate bloom Marine dinoflagellates at night can emit blue light by bioluminescence, a process also called “the phosphorescence of the seas”. Light production in these single celled organisms is produced by small structures in the cytoplasm called scintillons. Among bioluminescent organisms, only dinoflagellates have scintillons. In the dinoflagellates, the biochemical reaction that produces light involves a luciferase-catalysed oxidation of a linear tetrapyrrole called luciferin.
|
|
This action is thought to be one of the driving forces for dinoflagellates to switch to this protein instead of histone for packaging. Some dinoflagellates have further switched to dinoflagellate histone-like proteins (HLPs) for packaging. The version of DVNPs in dinoflagellates have a variable N-terminal tail with a nuclear localization signal. It also has many phosphorylation sites, a feature not seen in viral counterparts.
|
|
Observations of Coccidinium showed that they were coccidian-like in their vegetative and replication stages, but their dinospores, a biflagellate zoospore, resembled syndinian dinoflagellates. Chatton and Biecheler therefore gave this new genera of endoparasitic dinoflagellates the name of Coccidinium.
|
|
Studies demonstrated that phlorotannins can act as an algicide against some dinoflagellates species.
|
|
In dinoflagellates that are armoured their covering is made up of thecal plates.
|
|
Three nutritional strategies are seen in dinoflagellates: phototrophy, mixotrophy, and heterotrophy. Phototrophs can be photoautotrophs or auxotrophs. Mixotrophic dinoflagellates are photosynthetically active, but are also heterotrophic. Facultative mixotrophs, in which autotrophy or heterotrophy is sufficient for nutrition, are classified as amphitrophic.
|
|
Dinotoxins are a group of toxins which are produced by flagellate, aquatic, unicellular protists called dinoflagellates. Dinotoxin was coined by Hardy and Wallace in 2012 as a general term for the variety of toxins produced by dinoflagellates. Dinoflagellates are an enormous group of marine life, with much diversity. With great diversity comes many different toxins, however, there are a few toxins (or derivatives) that multiple species have in common.
|
|
Three other groups - the Perkinsids, Syndiniales and Oxyrrhis are distantly related to the dinoflagellates.
|
|
Noctiluca species are unusual among dinoflagellates in appearing to have a diplontic life cycle.
|
|
On the other hand, mixotrophic dinoflagellates with individual plastids that depend mainly on phagocytosis are also photosynthetic due to chloroplasts 'stolen' from their prey (kleptochloroplasts) or because of algal endosymbionts. It was discovered that the mixotrophic dinoflagellates Gonyaulax polygramma and Scrippsiella spp. can engulf small-size prey using their apical horn while larger prey are engulfed via their sulcus, showing that dinoflagellates can have more than one mouth for feeding. Moreover, mixotrophic dinoflagellates belonging to the species Karlodinium armiger, can capture small prey by direct engulfment or can use an extendable peduncle to capture larger prey.
|
|
Parvilucifera is a genus of marine alveolates that parasitise dinoflagellates. Parvilucifera is a parasitic genus described in 1999 by Norén et al. It is classified perkinsozoa in the supraphylum of Alveolates. This taxon serves as a sister taxon to the dinoflagellates and apicomplexans.
|
|
The dinoflagellates (Greek δῖνος dinos "whirling" and Latin flagellum "whip, scourge") are single-celled eukaryotes constituting the phylum Dinoflagellata. Usually considered algae, dinoflagellates are mostly marine plankton, but they also are common in freshwater habitats. Their populations are distributed depending on sea surface temperature, salinity, or depth. Many dinoflagellates are known to be photosynthetic, but a large fraction of these are in fact mixotrophic, combining photosynthesis with ingestion of prey (phagotrophy and myzocytosis).
|
|
In dinoflagellate species with desmokont flagellation (e.g., Prorocentrum), the two flagella are differentiated as in dinokonts, but they are not associated with grooves. Dinoflagellates have a complex cell covering called an amphiesma or cortex, composed of a series of membranes, flattened vesicles called alveolae (= amphiesmal vesicles) and related structures. In In armoured dinoflagellates, these support overlapping cellulose plates to create a sort of armor called the theca or lorica, as opposed to athecate dinoflagellates.
|
|
Dinoflagellata life cycle: 1-mitosis, 2-sexual reproduction, 3-planozygote, 4-hypnozygote, 5-planomeiocyte Dinoflagellates have a haplontic life cycle, with the possible exception of Noctiluca and its relatives. The life cycle usually involves asexual reproduction by means of mitosis, either through desmoschisis or eleuteroschisis. More complex life cycles occur, more particularly with parasitic dinoflagellates. Sexual reproduction also occurs, though this mode of reproduction is only known in a small percentage of dinoflagellates.
|
|
The Noctilucaceae are a family of dinoflagellates. The family contains the widely distributed species Noctiluca scintillans.
|
|
Dinophysis ovum is a species of toxic dinoflagellates suspected to cause diarrhetic shellfish poisoning in humans.
|
|
Perkinsidae is a family of alveolates in the phylum Perkinsozoa, a sister group to the dinoflagellates.
|
|
Notable members include marine algae, potato blight, dinoflagellates, Paramecium, brain parasite (Toxoplasma) and malarial parasite (Plasmodium).
|
|
A possible explanation for the occurrence of different dominant mixotrophic dinoflagellates during serial red tides is the ability of mixotrophic dinoflagellates to feed on both heterotrophic bacteria and cyanobacteria (such as Synecchococcus) spp., which provide limiting nutrients such as phosphorus, and nitrogen simultaneously. It is proposed that during serial red tides, feeding by larger mixotrophic dinoflagellates on smaller species may be a driving force for the succession of dominant species. Nitrogen and phosphorus is taken up by direct transfer of the materials and energy between the mixotrophic dinoflagellates; therefore, nutrient supply does not rely on the release of nitrogen and phosphorus by other organisms.
|
|
Akashiwo sanguinea is a species of marine dinoflagellates well known for forming blooms that result in red tides. The organism is unarmored (naked). Therefore, it lacks a thick cellulose wall, the theca, common in other genera of dinoflagellates. Reproduction of the phytoplankton species is primarily asexual.
|
|
Peridinium is a genus of motile, marine and freshwater dinoflagellates. Their morphology is considered typical of the armoured dinoflagellates, and their form is commonly used in diagrams of a dinoflagellate's structure. Peridinium can range from 30-70 μm in diameter, and has very thick thecal plates.
|
|
Genome Evolution of a Tertiary Dinoflagellate Plastid - PLOS Most (but not all) dinoflagellates have a dinokaryon, described below (see: Life cycle, below). Dinoflagellates with a dinokaryon are classified under Dinokaryota, while dinoflagellates without a dinokaryon are classified under Syndiniales. Although classified as eukaryotes, the dinoflagellate nuclei are not characteristically eukaryotic, as some of them lack histones and nucleosomes, and maintain continually condensed chromosomes during mitosis. The dinoflagellate nucleus was termed ‘mesokaryotic’ by Dodge (1966),Dodge (1966).
|
|
In the Northwestern Mediterranean, the most abundant phytoplankton present are coccolithophorids, flagellates, and dinoflagellates. The Southeastern Mediterranean has a similar composition, where coccolithophorids and monads (nano- and picoplankton) make up the majority of the phytoplankton community in the DCM. In the Indian Ocean, the most abundant microorganisms present in the DCM are cyanobacteria such as prochlorophytes, coccolithophorids, dinoflagellates and diatoms. In the North Sea, dinoflagellates are the main phytoplankton species present in the DCM at and below the pycnocline.
|
|
Coccidinium is a genus of parasitic syndinian dinoflagellates that infect the nucleus and cytoplasm of other marine dinoflagellates. Coccidinium, along with two other dinoflagellate genera, Amoebophyra and Duboscquella, contain species that are the primary endoparasites of marine dinoflagellates. While numerous studies have been conducted on the genus Amoebophyra, specifically Amoebophyra ceratii, little is known about Coccidinium. These microscopic organisms have gone relatively unstudied after the initial observations of Édouard Chatton and Berthe Biecheler in 1934 and 1936.
|
|
A 1984 study was conducted which established the dinoflagellate origin for dinosterane based on distributions of modern dinoflagellates and dinosterane abundance in sediment. In 1993, dinosteranes were discovered in a section of the Bristol Trough that was dated to the Rhaetian Age. Due to the co-deposition of these dinosteranes with dinoflagellate cysts and comparison of microfossil abundance with hydrocarbon abundance, the dinosterane was associated with marine dinoflagellates. This was the first stratigraphic evidence for Mesozoic dinoflagellates.
|
|
In: Tomas, C.R. (Ed.), Identifying Marine Diatoms and Dinoflagellates. Academic Press, San Diego (California), pp. 387–583.).
|
|
In shallower parts of the DCM - above the pycnocline, dinoflagellates are also present, as well as nanoflagellates.
|
|
Since diatoms do not appear at this time, the authors contribute these abnormally high levels to dinoflagellates.
|
|
Erythropsidinium (formerly Erythropsis) is a genus of dinoflagellates (a type of unicellular eukaryote) of the family Warnowiaceae.
|
|
The walls of organic-walled dinocysts are composed of the resistant biopolymer called dinosporin.Fensome, R.A., Taylor, F.J.R., Norris, G., Sarjeant, W.A.S., Wharton, D.I., and Williams, G.L., 1993. A classification of modern and fossil dinoflagellates, Sheridan Press, Hanover. . This organic compound has similarities to sporopollenin, but is unique to dinoflagellates.
|
|
Unlike other dinoflagellates, Syndinium does not possess the conventional dinokaryon or the associated process of dinomitosis. Instead, Syndinium possess fewer but larger chromosomes than most dinoflagellates, as few as 4 compared to the typical 20 plus.Ris, H. 1975: Primitive mitotic mechanisms. Biosystems, 7(3-4), Elsevier Ireland Ltd.
|
|
The walls of organic-walled dinocysts are composed of the resistant biopolymer called dinosporin.Fensome, R.A., Taylor, F.J.R., Norris, G., Sarjeant, W.A.S., Wharton, D.I., and Williams, G.L., 1993. A classification of modern and fossil dinoflagellates, Sheridan Press, Hanover. . This organic compound has similarities to sporopollenin, but is unique to dinoflagellates.
|
|
These dinoflagellate histone-like proteins replace histone in some dinoflagellates and package DNA into a liquid-crystalline state.
|
|
Impletosphaeridium elegans is an extinct species of dinoflagellates in the order Gonyaulacales. It is from the Early Tertiary.
|
|
In many cases this reflects a recognizable part of the tabulation (one or more plates). However, one large group of dinoflagellates (athecate - or naked dinoflagellates) do not have thecal plates and therefore produce cysts lacking all forms of reflected tabulation.Dale, B. & Dale, A.L. 2002. Environmental applications of dinoflagellate cysts and acritarchs .
|
|
Karenia papilionacea is a species from the genus Karenia, which are dinoflagellates. It was first discovered in New Zealand.
|
|
Dinokaryota is a main grouping of dinoflagellates. They include all species where the nucleus remains a dinokaryon throughout the entire cell cycle, which is typically dominated by the haploid stage. All the "typical" dinoflagellates, such as Peridinium and Gymnodinium, belong here. Others are more unusual, including some that are colonial, amoeboid, or parasitic.
|
|
Cymbodinium elegans is a species of marine dinoflagellates in the order Noctilucales. It is the only species in its genus.
|
|
Gambierdiscus caribaeus is a species of toxic dinoflagellates, which among others causes ciguatera fish poisoning. It is photosynthetic and epibenthic.
|
|
Gambierdiscus carolinianus is a species of toxic dinoflagellates, which among others causes ciguatera fish poisoning. It is photosynthetic and epibenthic.
|
|
Gambierdiscus ruetzleri is a species of toxic dinoflagellates, which among others causes ciguatera fish poisoning. It is photosynthetic and epibenthic.
|
|
Ceratocorys is a genus of marine dinoflagellates first described in 1883. It is the only genus in the family Ceratocoryaceae.
|
|
Marine algae have traditionally been placed in groups such as: green algae, red algae, brown algae, diatoms, coccolithophores and dinoflagellates.
|
|
Oxyrrhis marina is a species of dinoflagellates with flagella. A marine heterotroph, it is found in much of the world.
|
|
Luciferin of dinoflagellates (R = H) resp. of euphausiid shrimps (R = OH). The latter is also called Component F. Dinoflagellate luciferin is a chlorophyll derivative (i. e. a tetrapyrrole) and is found in some dinoflagellates, which are often responsible for the phenomenon of nighttime glowing waves (historically this was called phosphorescence, but is a misleading term).
|
|
Together with various other structural and genetic details, this organization indicates a close relationship between the dinoflagellates, the Apicomplexa, and ciliates, collectively referred to as the alveolates. Dinoflagellate tabulations can be grouped into six "tabulation types": gymnodinoid, suessoid, gonyaulacoid-peridinioid, nannoceratopsioid, dinophysioid, and prorocentroid. The chloroplasts in most photosynthetic dinoflagellates are bound by three membranes, suggesting they were probably derived from some ingested algae. Most photosynthetic species contain chlorophylls a and c2, the carotenoid beta-carotene, and a group of xanthophylls that appears to be unique to dinoflagellates, typically peridinin, dinoxanthin, and diadinoxanthin.
|
|
Some dinoflagellates that live as parasites are probably mixotrophic. Karenia, Karlodinium, and Lepidodinium are some of the dinoflagellate genera which are thought to contain peridinin, a carotenoid pigment necessary for photosynthesis in dinoflagellates; however, chlorophyll b has been found in these genera as an accessory pigment. This discovery has led scientists to assume that the pigment chlorophyll b actually came from prey which had been ingested by the dinoflagellates. Some species of mixotrophic dinoflagellate are able to feed on toxic prey such as toxic algae and other toxic organisms.
|
|
The impact of grazing by mixotrophic dinoflagellates will affect particular prey species and be influenced by the abundance of dinoflagellate predators and their ingestion rates. Another consideration would be to include predator-prey relationships of mixotrophic dinoflagellates at a species level due to co-existence in offshore and oceanic waters. The diversity of mixotrophic dinoflagellate species and their interactions with other marine organisms contributes to their diverse roles in different niche environments. For example, mixotrophic and heterotrophic dinoflagellates may act as predators on a wide range of prey types due to their diverse feeding mechanisms.
|
|
A rapid accumulation of certain dinoflagellates can result in a visible coloration of the water, colloquially known as red tide (a harmful algal bloom), which can cause shellfish poisoning if humans eat contaminated shellfish. Some dinoflagellates also exhibit bioluminescence—primarily emitting blue-green light. Thus, some parts of the Indian Ocean light up at night giving blue-green light.
|
|
Long exposure image of bioluminescence of N. scintillans in the yacht port of Zeebrugge, Belgium the Bioluminescent Bay, Vieques, Puerto Rico At night, water can have an appearance of sparkling light due to the bioluminescence of dinoflagellates. More than 18 genera of dinoflagellates are bioluminescent,Poupin, J., A.-S. Cussatlegras, and P. Geistdoerfer. 1999. Plancton marin bioluminescent.
|
|
Some studies have shown that certain dinoflagellates produce sterols that have the potential to serve as genera-specific biomarkers. Recent work showed that dinoflagellate genera, which formed discrete clusters in the 18S rDNA-based phylogeny, shared similar sterol compositions. This suggested that the sterol compositions of dinoflagellates are explained by the evolutionary history of this lineage.
|
|
The two colleagues identified more than 30 different stages to the life cycle of dinoflagellates of the genus Cystodinedria. Pfiester was an associate editor for the Journal of Phycology from 1980 to 1988. In 1990 she was the president of the Phycological Society of America. She was an internationally recognized expert on dinoflagellates, especially the genus Peridinium.
|
|
The Lentin and Williams index of fossil dinoflagellates. College Park: American Association of Stratigraphic Palynologists.Streng, M., Hildebrand-Habel, T., & Willems, H. (2004).
|
|
Calcareous nanofossils: the first planktonic calcifiers occurred just after the CPE and might have been calcareous dinocysts, i.e., calcareous cysts of dinoflagellates.
|
|
In microbiology and planktology, a theca is a subcellular structural component out of which the frustules of diatoms and dinoflagellates are constructed.
|
|
1–22, Cambridge University Press, Cambridge, U.K. These functions have implications for the population dynamics, seasonal succession, genetic diversity, and biogeography of dinoflagellates.
|
|
In terms of number of species, dinoflagellates are one of the largest groups of marine eukaryotes, although this group is substantially smaller than diatoms. Some species are endosymbionts of marine animals and play an important part in the biology of coral reefs. Other dinoflagellates are unpigmented predators on other protozoa, and a few forms are parasitic (for example, Oodinium and Pfiesteria). Some dinoflagellates produce resting stages, called dinoflagellate cysts or dinocysts, as part of their lifecycles, and is known from 84 of the 350 described freshwater species, and from a little more than 10% of the known marine species.
|
|
Dinocyst drawn by Ehrenberg in 1837 The first person to recognize fossil dinoflagellates was Christian Gottfried Ehrenberg, who reported his discovery in a paper presented to the Berlin Academy of Sciences in July 1836. He had observed clearly tabulate dinoflagellates in thin flakes of Cretaceous flint and considered those dinoflagellates to have been silicified. Along with them, and of comparable size, were spheroidal to ovoidal bodies bearing an array of spines or tubes of variable character. Ehrenberg interpreted these as being originally siliceous and thought them to be desmids (freshwater conjugating algae), placing them within his own Recent desmid genus Xanthidium.
|
|
Acute pfiesteriosis in tilapia. Top row: unaffected fish; bottom row: fish preyed upon by the carnivorous alga Pfiesteria shumwayae. Predatory dinoflagellates are predatory heterotrophic or mixotrophic alveolates that derive some or most of their nutrients from digesting other organisms. About one half of dinoflagellates lack photosynthetic pigments and specialize in consuming other eukaryotic cells, and even photosynthetic forms are often predatory.
|
|
On the inner periplast part there may be seen intermembrane particles that penetrate the plasma membrane into the protoplasm. These intermembrane particles are larger around the plate boundaries. The Dinophyceae has a cell covering called the amphiesma–cisternae-like vesicles in a thecal form structure. Many of the dinoflagellates have thicker thecal plates giving them the name of armoured dinoflagellates.
|
|
Publishers, Fourth edition, 764 pp In diatoms and dinoflagellates, the xanthophyll cycle consists of the pigment diadinoxanthin, which is transformed into diatoxanthin (diatoms) or dinoxanthin (dinoflagellates) under high-light conditions.Jeffrey, S. W. & M. Vesk, 1997. Introduction to marine phytoplankton and their pigment signatures. In Jeffrey, S. W., R. F. C. Mantoura & S. W. Wright (eds.), Phytoplankton pigments in oceanography, pp 37-84.
|
|
They are flagellated eukaryotes that combine photoautotrophy when light is available, and heterotrophy via phagocytosis. Dinoflagellates are one of the most diverse and numerous species of phytoplankton, second to diatoms. Dinoflagellates have long whip-like structures called flagella that allow them to move freely throughout the water column. They are mainly marine but can also be found in freshwater environments.
|
|
National Office for Harmful Algal Blooms, Ciguatera Fish Poisoning. Woods Hole Oceanographic Institution. Other dinoflagellates that may cause ciguatera include Prorocentrum spp., Ostreopsis spp.
|
|
Dinoflagellates are the major organic component and the most abundant microfossils. Manganese is present, such as in the Toarcian deposits of Hungary.Szabó-Drubina, M. (1959).
|
|
D. shibae was first isolated in 2003 with two strains, both isolated from washed single cells of cultivated marine dinoflagellates (Prorocentrum lima and Alexandrium ostenfeldii).
|
|
Some dinoflagellate blooms are not dangerous. Bluish flickers visible in ocean water at night often come from blooms of bioluminescent dinoflagellates, which emit short flashes of light when disturbed. Algal bloom (akasio) by Noctiluca spp. in Nagasaki The same red tide mentioned above is more specifically produced when dinoflagellates are able to reproduce rapidly and copiously on account of the abundant nutrients in the water.
|
|
Human inputs of phosphate further encourage these red tides, so strong interest exists in learning more about dinoflagellates, from both medical and economic perspectives. Dinoflagellates are known to be particularly capable of scavenging dissolved organic phosphorus for P-nutrient, several HAS species have been found to be highly versatile and mechanistically diversified in utilizing different types of DOPs. The ecology of harmful algal blooms is extensively studied.
|
|
Yessotoxins are a group of lipophilic, sulfur bearing polyether toxins that are related to ciguatoxins. They are produced by a variety of dinoflagellates, most notably Lingulodinium polyedrum and Gonyaulax spinifera. When the environmental conditions encourage the growth of YTX producing dinoflagellates, the toxin(s) bioaccumulate in edible tissues of bivalve molluscs, including mussels, scallops, and clams, thus allowing entry of YTX into the food chain.
|
|
As mentioned above, the origin of the plastids in Durinskia is different from the origin of the secondary plastid present in other typical dinoflagellates. In multiple secondary endosymbiotic events, an alga with a primary plastid was integrated into a eukaryotic host as a secondary plastid. The common red plastid found in dinoflagellates is a red secondary plastid that is different as it is bound by three rather than four membrane. These red plastids also contain peridinin, a major carotenoid pigment specific to dinoflagellates. In Durinskia, the function of the secondary red plastid is replaced by incorporating a diatom and its diatom’s plastid as a tertiary endosymbiont.
|
|
Springer, Berlin, pp. 267–286.Willems, H., 1994. New calcareous dinoflagellates from the Upper Cretaceous white chalk of northern Germany. Rev. Palaeobot. Palynol. 84, 57–72.
|
|
Systematic Biology, p. 684-689, 2007, .Elbrächter, M. et al. Establishing an Agenda for Calcareous Dinoflagellates Research (Thoracosphaeraceae, Dinophyceae) including a nomenclatural synopsis of generic names.
|
|
Researchers capture dinoflagellate on video shooting harpoons at prey The feeding mechanisms of the oceanic dinoflagellates remain unknown, although pseudopodial extensions were observed in Podolampas bipes.
|
|
Oxyrrhis is a genus of dinoflagellates. It includes the species Oxyrrhis marina. It is sometimes considered to be a monotypic genus.Lowe, C. D., et al. (2011).
|
|
Saxitoxin is a neurotoxin naturally produced by certain species of marine dinoflagellates (Alexandrium sp., Gymnodinium sp., Pyrodinium sp.) and freshwater cyanobacteria (Anabaena sp., some Aphanizomenon spp.
|
|
Ecology of autotrophic marine dinoflagellates with reference to red water conditions. In: The luminescence of biological systems (Johnson, F. H. (Ed.)), Am. Assoc. Adv. Sci., pp.
|
|
Including mixotrophic dinoflagellates would better explain the control of prey population and cycling of limited materials as well as competition between other organisms for larger prey.
|
|
Dinoflagellates can occur in all aquatic environments: marine, brackish, and fresh water, including in snow or ice. They are also common in benthic environments and sea ice.
|
|
Within the United States, Central Florida is home to the Indian River Lagoon which is abundant with dinoflagellates in the summer and bioluminescent ctenophore in the winter.
|
|
Azadinium spinosum is a species of dinoflagellates that produces azaspiracid toxins (toxins associated with shellfish poisoning), particularly AZA 1, AZA 2 and an isomer of AZA 2.
|
|
In other dinoflagellates, kleptoplasty has been hypothesized to represent either a mechanism permitting functional flexibility, or perhaps an early evolutionary stage in the permanent acquisition of chloroplasts.
|
|
In This sort of nucleus was once considered to be an intermediate between the nucleoid region of prokaryotes and the true nuclei of eukaryotes, so were termed mesokaryotic, but now are considered derived rather than primitive traits (i.e. ancestors of dinoflagellates had typical eukaryotic nuclei). In addition to dinokaryotes, DVNPs can be found in a group of basal dinoflagellates (known as Marine Alveolates, "MALVs") that branch as sister to dinokaryotes (Syndiniales).
|
|
Dinoflagellate evolution has been summarized into five principal organizational types: prorocentroid, dinophysoid, gonyaulacoid, peridinioid, and gymnodinoid. The transitions of marine species into fresh water have been infrequent events during the diversification of dinoflagellates and in most cases have not occurred recently, possibly as late as the Cretaceous. Recently, the "living fossil" Dapsilidinium pastielsii was found inhabiting the Indo-Pacific Warm Pool, which served as a refugium for thermophilic dinoflagellates.
|
|
Amoebophyra (or Amoebophrya) is a genus of dinoflagellates. Amoebophyra is a syndinian parasite that infects free-living dinoflagellates that are attributed to a single species by using several host-specific parasites. It acts as "biological control agents for red tides and in defining species of Amoebophrya." Researchers have found a correlation between a large amount of host specify and the impact host parasites may have on other organisms.
|
|
Polykrikos kofoidii is a species of phagotrophic marine pseudocolonial dinoflagellates that can capture and engulf other protist prey, including the toxic dinoflagellate, Alexandrium tamarense. P. kofoidii is of scientific interest due to its status as a predator of other dinoflagellates, a behavior that is significant in the control of algal blooms. It has a complex life cycle of both vegetative (asexual) and sexual reproduction complicated by its pseudocolonial structure.
|
|
In: Palynology: principles and applications (Ed. by J. Jansonius & D. C. McGregor), pp. 1197–1248. American Association of Stratigraphic Palynologists Foundation, Dallas, Texas. and for freshwater dinoflagellates 24%.
|
|
Parvilucifera rostrata sp nov (perkinsozoa), a novel parasitoid that infects planktonic dinoflagellates. Protist, 165(1), 31-49. 10.1016/j.protis.2013.09.005 Norén, F., Moestrup, Ø., & Rehnstam-Holm, A. (1999).
|
|
Although the biosynthesis of saxitoxin seems complex, organisms from two different kingdoms, indeed two different domains, species of marine dinoflagellates and freshwater cyanobacteria, are capable of producing these toxins. While the prevailing theory of production in dinoflagellates was through symbiotic mutualism with cyanobacteria, evidence has emerged suggesting that dinoflagellates, themselves, also possess the genes required for saxitoxin synthesis. Saxitoxin biosynthesis is the first non-terpene alkaloid pathway described for bacteria, though the exact mechanism of saxitoxin biosynthesis is still essentially a theoretical model. The precise mechanism of how substrates bind to enzymes is still unknown, and genes involved in the biosynthesis of saxitoxin are either putative or have only recently been identified.
|
|
Tripos is a genus of marine dinoflagellates in the family Ceratiaceae. It was formerly part of Ceratium, then separated out as Neoceratium, a name subsequently determined to be invalid.
|
|
Protoodinium, Crepidoodinium, Piscinoodinium, and Blastodinium retain their plastids while feeding on their zooplanktonic or fish hosts. In most parasitic dinoflagellates, the infective stage resembles a typical motile dinoflagellate cell.
|
|
They have thick tentacles up to long. This coral is usually some shade of grey or brown. It is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues.
|
|
Oxytoxum elegans is species of dinoflagellates in the order Peridiniales. It is found in the Gulf of Mexico, the Lebanese Exclusive Economic Zone waters and the North Atlantic Ocean.
|
|
The colour of the coral is usually some shade of yellowish or greenish brown and is caused by the presence of symbiotic dinoflagellates called zooxanthellae in the coral's tissues.
|
|
Because these events involve endosymbiosis of cells that have their own endosymbionts, the process is called secondary endosymbiosis. The chloroplasts of such eukaryotes are typically surrounded by more than two membranes, reflecting a history of multiple engulfment. The chloroplasts of euglenids, chlorarachniophytes and a small group of dinoflagellates appear to be captured green algae, whereas those of the remaining photosynthetic eukaryotes, such as heterokont algae, cryptophytes, haptophytes, and dinoflagellates, appear to be captured red algae.
|
|
Polykrikos (from Greek “poly” - many, and “krikos” – ring or circle) is one of the genera of family Polykrikaceae that includes athecate pseudocolony-forming dinoflagellates. Polykrikos are characterized by a sophisticated ballistic apparatus, named the nematocyst-taeniocyst complex, which allows species to prey on a variety of organisms. Polykrikos have been found to regulate algal blooms as they feed on toxic dinoflagellates. However, there is also some data available on Polykrikos being toxic to fish.
|
|
Generally, these dinoflagellates enter the host cell through phagocytosis, persist as intracellular symbionts, reproduce, and disperse to the environment. The exception is in most mollusks, where these symbionts are intercellular (between the cells). Cnidarians that are associated with Symbiodinium occur mostly in warm oligotrophic (nutrient-poor), marine environments where they are often the dominant constituents of benthic communities. These dinoflagellates are therefore among the most abundant eukaryotic microbes found in coral reef ecosystems.
|
|
A classification of living and fossil dinoflagellates. American Museum of Natural History, Micropaleontology, Special Publication 7: 1-351. In terms of asexual division of motile cells, desmoschisis is generally the case in gonyaulacaleans whereas eleutheroschisis is generally the case in peridinialeans. FENSOME R.A., TAYLOR F.J.R., NORRIS G., SARJEANT W.A.S., WHARTON D.I. & WILLIAMS G.L. 1993. A classification of living and fossil dinoflagellates. American Museum of Natural History, Micropaleontology, Special Publication 7: 1-351.
|
|
The role of phytoplankton is better understood due to their critical position as the most numerous primary producers on Earth. Phytoplankton are categorized into cyanobacteria (also called blue-green algae/bacteria), various types of algae (red, green, brown, and yellow-green), diatoms, dinoflagellates, euglenoids, coccolithophorids, cryptomonads, chrysophytes, chlorophytes, prasinophytes, and silicoflagellates. Zooplankton tend to be somewhat larger, and not all are microscopic. Many Protozoa are zooplankton, including dinoflagellates, zooflagellates, foraminiferans, and radiolarians.
|
|
Combinations of phototrophy and phagotrophy allow organisms to supplement their inorganic nutrient uptake This means an increased trophic transfer to higher levels in food web compared to the traditional food web. Mixotrophic dinoflagellates have the ability to thrive in changing ocean environments, resulting in shifts in red tide phenomenon and paralytic shellfish poisoning. It is unknown as to how many species of dinoflagellates have mixotrophic capabilities, as this is a relatively new feeding-mechanism discovery.
|
|
Under certain conditions, dinoflagellates can become very numerous and cause algal blooms. These can lower the oxygen concentration of the water and can clog the gills of filter feeding organisms. Some of these dinoflagellates contain toxic chemicals which may be sequestered by animals that eat them, and can threaten public health and cause economic damage to fisheries. Some species of Ostreopsis contain the vasoconstrictor palytoxin, one of the most toxic, non-protein substances known.
|
|
Although Gonyaulax is predominantly found in seawater, it can also have a detrimental effect on humans. Filter feeding organisms e.g. mussels, clams etc. can accumulate these dinoflagellates in their bodies.
|
|
All Zooxanthellae are dinoflagellates and most of them are members within Symbiodiniaceae (e.g. the genus Symbiodinium).Freudenthal et al. 2007 The association between Symbiodinium and reef-building corals is widely known.
|
|
Ornithocercus lacks photosynthetic pigments (and chloroplasts) and they are thus obligate heterotrophs.Gaines, G., & Elbrachter, M. (1987). Heterotrophic nutrition. In: F. J. R. Taylor (Ed.), The biology of dinoflagellates (pp. 224–281).
|
|
This indicates that RNA is important for DNA packaging in zooxanthellae. Zooxanthellae, in addition to all other dinoflagellates, possess 5-hydroxymethylmuracil and thymidine in their genomes, unlike any other eukaryotic genome.
|
|
These pigments give many dinoflagellates their typical golden brown color. However, the dinoflagellates Karenia brevis, Karenia mikimotoi, and Karlodinium micrum have acquired other pigments through endosymbiosis, including fucoxanthin. This suggests their chloroplasts were incorporated by several endosymbiotic events involving already colored or secondarily colorless forms. The discovery of plastids in the Apicomplexa has led some to suggest they were inherited from an ancestor common to the two groups, but none of the more basal lines has them.
|
|
Dinoflagellates sometimes bloom in concentrations of more than a million cells per millilitre. Under such circumstances, they can produce toxins (generally called dinotoxins) in quantities capable of killing fish and accumulating in filter feeders such as shellfish, which in turn may be passed on to people who eat them. This phenomenon is called a red tide, from the color the bloom imparts to the water. Some colorless dinoflagellates may also form toxic blooms, such as Pfiesteria.
|
|
Dinosterol is a type of steroid produced by several genera of dinoflagellates. It is a 4α-methyl sterol (4α,23,24-trimethyl-5α-cholest-22E-en-3β-ol), a derivative of dinosterane, rarely found in other classes of protists. This sterol and others have been considered as class-specific, being biomarkers for dinoflagellates, although dinosterol is produced in minor amounts by a small number of other phytoplankton, such as the marine diatom Navicula speciosa. and Prymnesiophytes of the genus Pavlova.
|
|
Coccidinium are endophytic, therefore live inside other organisms for the majority of their life. They tend to parasitize other dinoflagellates, thus are often found in aquatic environments, ranging from freshwater to marine. Coccidinium are able to inhabit environments with variable salinity levels as a result, though the exact range is not known due to insufficient research. Coccidinium, while carrying little relevance to humans, contain species that have other marine dinoflagellates as hosts and therefore are relevant to these protists.
|
|
Moreover, temperatures increased during the PETM, as indicated by the brief presence of subtropical dinoflagellates,the dinoflagellates Apectodinium spp. and a marked increase in TEX86. The latter record is intriguing, though, because it suggests a 6 °C (11 °F) rise from ~ before the PETM to ~ during the PETM. Assuming the TEX86 record reflects summer temperatures, it still implies much warmer temperatures on the North Pole compared to the present day, but no significant latitudinal amplification relative to surrounding time.
|
|
Through a variety of phylogenetic tests on the orthologous genes found in similar organisms, researchers were able to relate C. velia to dinoflagellates and apicomplexans which are alveolates. Both the nucleus and the plastid of C. velia showed alveolate ancestry. A subsequent study of the C.velia and V. brassicaformis plastid genomes has shown in greater detail that the plastids of peridinin dinoflagellates, apicomplexans and chromerids share the same lineage, derived from a red-algal-type plastid.
|
|
The presence of Perkinsozoa has been demonstrated in freshwater, marine waters, and sediments (Reñé et al. 2017). P.infectans has been found in coastal Sweden where it was first discovered, especially being commonly found in marine sediment (Alacid et al. 2015). Nearly all of the species of Parvilucifera have been found to be generalist parasites for dinoflagellates, but increasing studies are allowing a better understanding for the preferences of specific species for particular species of dinoflagellates (Reñé et al. 2016).
|
|
Below are three of the most common dinotoxins, these toxins are produced by a large variety of dinoflagellates. There is thought to be more than a few hundred different toxins produced by dinoflagellates. Saxitoxins and Gonyautoxins are deadly neurotoxins which cause paralytic shellfish poisoning. Saxitoxin B1 has a lethal concentration of 86 to 788 micrograms per kilogram of body weight, while Gonyautoxins C1 and C2 are lethal in concentrations of 411 micrograms per kilogram of body weight.
|
|
For example, Lingulodinium polyedrum and Akashiwo sanguinea are two species of mixotrophic dinoflagellates that are known to feed on the toxic dinoflagellate, Alexandrium tamarense. Certain species of mixotrophic dinoflagellates can be affected by light intensity and nutrient conditions . For example, ingestion rates of Fragilidium subglobosum, Gymnodinium gracilentum, and Karlodinium veneficum increase as light intensity increases up to 75 to 100 µmol photon m−2 s−1. In contrast, other species are not affected by light intensity.
|
|
Larval yelloweye feed on diatoms, dinoflagellates, crustaceans, tintinnids, and cladocerans, and juveniles consume copepods and euphausiids of all life stages. Adults eat demersal invertebrates and small fishes, including other species of rockfish.
|
|
Perkinsus marinus and the Apicomplexa both have histones while the dinoflagellates appear to have lost theirs. Chromerida are ancestrally myzocytotic, on the basis of evidence for myzocytosis by the chromerid Vitrella brassicaformis.
|
|
The Polykrikaceae (also known as Polykrikidae) are a family of athecate dinoflagellates of the order Gymnodiniales. Members of the family are known as polykrikoids. The family contains two genera: Polykrikos and Pheopolykrikos.
|
|
The Noctilucales are an order of marine dinoflagellates. They differ from most others in that the mature cell is diploid and its nucleus does not show a dinokaryotic organization. They show gametic meiosis.
|
|
Colonies of Trichodesmium provide a pseudobenthic substrate for many small oceanic organisms including bacteria, diatoms, dinoflagellates, protozoa, and copepods (which are its primary predator); in this way, the genus can support complex microenvironments.
|
|
The endosymbiont dinoflagellates are used for their ability to photosynthesise and provide energy, giving the host cnidarians such as corals, and anemones, plant properties. Free-living dinoflagellates are ingested into the gastrodermal cells of the host, and their symbiosome membrane is derived from the host cell. The process of symbiosome formation is often seen in the animal host to be that of phagocytosis, and it is hypothesised that the symbiosome is a phagosome that has been subject to early arrest.
|
|
The practical importance of the Parvilucifera has recently become a topic of interest as the genus can be seen to be a controlling factor of many harmful blooms of dinoflagellates (Norén et al.). Dinoflagellate blooms have been regarded as very harmful to the shellfish industry (Norén et al. 1999), as well as, have been noted to produce potent toxins (Alacid et al. 2015). Some dinoflagellates are also known to create massive faunal mortality and can even be fatal for humans.
|
|
Alexandrium fundyense is a species of dinoflagellates. It produces toxins that induce paralytic shellfish poisoning (PSP), and is a common cause of red tide. A. fundyense regularly forms massive blooms along the northeastern coasts of the United States and Canada,ANDERSON, D.M., KULIS, D.M., DOUCETTE, G.J., GALLAGHER, J.C. & BALECH, E. 1994 Biogeography of toxic dinoflagellates in the genus Alexandrium from the northeastern United States and Canada; Marine Biology, 120: 467-478.Martin, J.L., Page, F.H., Hanke, A., Strain, P.M., LeGresley, M.M., 2005.
|
|
Quaternary calcareous dinoflagellates (Calciodinelloideae) and their natural affinities. J. Paleont. 42, 1395–1408Janofske, D., 1992. Kalkiges Nannoplankton, insbesondere kalkige Dinoflagellaten-Zysten der alpinen Ober- Trias: Taxonomie, Biostratigraphie und Bedeutung für die Phylogenie der Peridiniales.
|
|
DSPs cause gastrointestinal distress in humans and are produced by dinoflagellates that may be ingested by scallops.Yautomo T, Murata M, Oshima Y, Matsumoto GK & Clardy J (1984). Diarrehetic shellfish poisoning. In: Seafood Toxins (ed.
|
|
Corythodinium elegans is a species of dinoflagellates in the family Oxytoxaceae. It is found Worldwide. The type locality is the Mediterranean.Gómez, F. (2005). A list of free-living dinoflagellate species in the world’s oceans.
|
|
Tappan gave a survey of dinoflagellates with internal skeletons. This included the first detailed description of the pentasters in Actiniscus pentasterias, based on scanning electron microscopy. They are placed within the order Gymnodiniales, suborder Actiniscineae.
|
|
The presence of alveoli, the structure of the cilia, the form of mitosis and various other details indicate a close relationship between the ciliates, Apicomplexa, and dinoflagellates. These superficially dissimilar groups make up the alveolates.
|
|
Coccoid Symbiodinium cells are metabolically active, as they photosynthesize, undergo mitosis, and actively synthesize proteins and nucleic acids. While most dinoflagellates undergo mitosis as a mastigote, in Symbiodinium, mitosis occurs exclusively in the coccoid cell.
|
|
Paragoniastrea australensis is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live within its soft tissues, supplementing this with the planktonic organisms caught by the polyps.
|
|
The development of plastids among the alveolates is intriguing. Cavalier-Smith proposed the alveolates developed from a chloroplast-containing ancestor, which also gave rise to the Chromista (the chromalveolate hypothesis). Other researchers have speculated that the alveolates originally lacked plastids and possibly the dinoflagellates and Apicomplexa acquired them separately. However, it now appears that the alveolates, the dinoflagellates, the Chromerida and the heterokont algae acquired their plastids from a red alga with evidence of a common origin of this organelle in all these four clades.
|
|
P. hartmanii feeds on algal species by engulfment after anchoring a prey using a nematocyst-taeniocyst complex (later referred to as NTC). Tang et al. observed P. hartmannii bloom that caused 100% mortality in juvenile sheepshead minnows (Cyprinodon variegates) within 24 hours suggesting P. hartmannii is an ichthyotoxic, harmful alga. P.hartmannii feeds on chain- forming dinoflagellates Cochlodinium polykrikoides and Gymnodinium catenatum that are also known to cause fish mortality, and therefore P. hartmannii is thought to have enzymes that detoxify toxins produced by these prey dinoflagellates.
|
|
The genus was first described by Noren and Moestrup in 1999 and was isolated off the west coast of Sweden. The discovery was made through the collection of dinoflagellates Dinophysis on the Swedish West Coast, which were found to contain round bodies that were assumed to be products of sexual reproduction. After preservation in the refrigerator for two weeks, the dinoflagellates had all died but what had remained were the round bodies. These were further found to be sporangia of parasitic protist, later described as Parvilucifera infectans.
|
|
Torodinium was first characterized as a distinct genus by Charles A. Kofoid and Olive Swezy in their 1921 book on unarmoured dinoflagellates. Kofoid and Swezy used silk planktonic nets to collect numerous dinoflagellates from the ocean off the coast of La Jolla, California in the summer of 1921, between June 1st and August 25th. Prior to this study, species of the Torodinium genus were instead considered Gymnodinium, a relative of Torodinium now classified under their common order, Gymnodiniales.M.D. Guiry in Guiry, M.D. and Guiry, G.M. 2020: AlgaeBase.
|
|
Members of the Roseobacter clade are widely associated with marine phytoplankton such as dinoflagellates and diatoms in the water column as well as shallow sediments. They play important roles in the carbon cycle by assimilating dissolved organic matter produced by phytoplankton and also in the sulfur cycle by removing DMS from the algal osmolyte dimethylsulfoniopropionate (DMSP).Wang H, Tomasch J, Jarek M, Wagner-Dobler I: A dual-species co-cultivation system to study the interactions between Roseobacters and dinoflagellates. Frontiers of Microbiology 2014, 5:311.
|
|
Sournia (1986) gave descriptions and illustrations of the marine genera of dinoflagellates, excluding information at the species level.SOURNIA, A., 1986: Atlas du Phytoplancton Marin. Vol. I: Introduction, Cyanophycées,Dictyochophycées, Dinophycées et Raphidophycées. Editions du CNRS, Paris.
|
|
In the brine, there are fewer cells; extremophiles predominate, including members of the deep-sea hydrothermal vent euryarchaeota (DHVEs), Methanohalophilus and Proteobacteria. Eukaryotes are also found in l'Atalante, including ciliates (45%), dinoflagellates (21%) and choanoflagellates (10%).
|
|
A potato plant infected with Phytophthora infestans. Many chromalveolates affect our ecosystem in enormous ways. Some of these organisms can be very harmful. Dinoflagellates produce red tides, which can devastate fish populations and intoxicate oyster harvests.
|
|
According to the fossil record, calcareous dinoflagellates originate in the Upper Triassic and are highly diverse during the Cretaceous and throughout the Tertiary.Keupp, H., 1991. Fossil calcareous dinoflagellate cysts. In: Riding, R. (Ed.), Calcareous Algae and Stromatolites.
|
|
In some groups of mixotrophic protists, like some dinoflagellates (e.g. Dinophysis), chloroplasts are separated from a captured alga and used temporarily. These klepto chloroplasts may only have a lifetime of a few days and are then replaced.
|
|
Pfiesteria was discovered in 1988 by North Carolina State University researchers JoAnn Burkholder and Ed Noga. The genus was named after Lois Ann Pfiester (1936–1992), a biologist who did much of the early research on dinoflagellates.
|
|
Alexandrium ostenfeldii, also known as the sea fire, is a species of dinoflagellates. It is among the group of Alexandrium species that produce toxins cause paralytic shellfish poisoning. These organisms have been found in the Baltic Sea.
|
|
For example, Gymnodinium nagasakiense can cause harmful red tides, dinoflagellates Gonyaulax polygramma can cause oxygen depletion and result in large fish kills, cyanobacteria Microcystis aeruginosa can make poisonous toxins, and diatom Chaetoceros convolutus can damage fish gills.
|
|
Corculum cardissa, the heart cockle, is a species of marine bivalve mollusc in the family Cardiidae. It is found in the Indo-Pacific region. It has a symbiotic relationship with dinoflagellates (zooxanthellae), which live within its tissues.
|
|
Another modification this species lacks is the ability to accumulate zooxanthellae, microscopic photosynthetic dinoflagellates, in the branched digestive tract. The non-symbiotic species such as P. poindimiei were thought to have evolved earlier than the symbiotic clades.
|
|
Heterotrophic dinoflagellates can form symbioses with cyanobacteria (phaeosomes), most often in tropical marine environments. The function of the cyanobiont depends on its host species. Abundant marine cyanobacteria in the genus Synechococcus form symbionts with dinoflagellates in the generaOrnithocercus, Histionesis and Citharistes where it is hypothesized to benefit its host through the provision of fixed nitrogen in oligotrophic, subtropical waters. Increased instances of phaeosome symbiosis have been documented in a stratified, nitrogen-limited environment, and living within a host can provide an anaerobic environment for nitrogen fixation to occur.
|
|
As this genus containing species is part of the subphylum Alveolata and phylum Dinoflagellata, it has the defining characteristics of these groups. As in all alveolates, species in Durinskia have flattened vesicles known as alveoli under the plasma membrane. One of Durinskia’s shared characteristics with some dinoflagellates is the cellulose plates contained in alveoli forming the outer armor, theca. The other shared characteristics between Durinskia and dinoflagellates include the presence of condensed chromosomes in the large nucleus called the dinokaryon, and the two surface grooves that each bears one flagellum.
|
|
Ocelloids are considered a synapomorphic character for the warnowiids - that is, they are present in all warnowiids and presumed present in the common ancestor, but are not present in the closest extant relatives, the polykrikoid dinoflagellates. These two groups share other unusually complex subcellular structures such as nematocysts and pistons. The molecular evidence is compelling that ocelloids are composed of multiple endosymbionts: mitochondria and at least one type of plastid. Ocelloids are likely to be homologous to much less complex plastid-containing eyespots found in other, distantly related dinoflagellates.
|
|
There is a variation in nutrient acquisition among Polykrikos species as some exclusively rely on photosynthesis, some are mixothrophs, while some are obligate heterotrophs which makes Polykrikos a useful group to study for organellar evolution. Early-branching polykrikoids, Polykrikos geminatum and P. hartmanii, have three-membrane plastids with triple stacked thylakoids that are indicative of secondary peridinin-type plastids common for dinoflagellates. However, mixothrophic P. lebouriae, phylogenetically nested among heterothropic polykrikoids, has plastids atypical of dinoflagellates. It has two membranes and contain the double-stacked thylakoids that are found in diatoms and haptophytes.
|
|
A red tide off the coast of San Diego, California The other types of algae are diatoms and dinoflagellates, found primarily in marine environments, such as ocean coastlines or bays, where they can also form algal blooms, commonly called red tides. Red tides, however, may be a natural phenomenon,FAQs about red tides, Texas Parks & Wildlife Department although when they form close to coastlines or in estuaries. They can occur when warmer water, salinity, and nutrients reach certain levels, which then stimulates their growth. Most red tide algae are dinoflagellates.
|
|
Dinoflagellates normally have a low toxin production rate, therefore in small concentrations their toxins are not potent. However their toxins are highly poisonous in large concentrations. They are capable of poisoning various species of marine life such as many fish and shellfish, and affecting the nervous system of any wildlife or humans that consume the infected marine life, or drink the contaminated water. Under bloom conditions, commonly referred to as red tides or harmful algal blooms, dinoflagellates are capable of producing immense dinotoxin concentrations causing large fish die-offs, and contamination of shellfish.
|
|
These rapidly sink to the sediment. Many species may spend longer periods resting in the sediment than active in the water column.RENGEFORS K. 1998. Seasonal succession of dinoflagellates coupled to the benthic cyst dynamics in Lake Erken, Sweden.
|
|
Ostreopsis is a genus of free-living dinoflagellates found in marine environments. Some species are benthic; the planktonic species in the genus are known for the toxic algal blooms that they sometimes cause, threatening human and animal health.
|
|
The stability of transient plastids varies considerably across plastid-retaining species. In the dinoflagellates Gymnodinium spp. and Pfisteria piscicida, kleptoplastids are photosynthetically active for only a few days, while kleptoplastids in Dinophysis spp. can be stable for 2 months.
|
|
A hypnozygote is a resting cyst resulting from sexual fusion; it is commonly thick-walled. A synonym of zygotic cyst.FENSOME R.A., TAYLOR F.J.R., NORRIS G., SARJEANT W.A.S., WHARTON D.I. & WILLIAMS G.L. 1993. A classification of living and fossil dinoflagellates.
|
|
Buono, 2013, p.36 The Eocene succession in boreholes of the basin has provided many species of dinoflagellates,Daners et al., 2016, p.293 and in the Permian sequence 131 species of spores, algae, funghi and pollen were registered.
|
|
This is an established feeding method among other alveolate parasites.Gómez, F., Moreira, D., & López-García, P. (2009). Life cycle and molecular phylogeny of the dinoflagellates Chytriodinium and Dissodinium, ectoparasites of copepod eggs. European Journal of Protistology, 45(4), 260-270.
|
|
In 1753, the first modern dinoflagellates were described by Henry Baker as "Animalcules which cause the Sparkling Light in Sea Water",Baker, M., 1753. Employment for the microscope. Dodsley, London, 403 pp. and named by Otto Friedrich Müller in 1773.
|
|
A classification of living and fossil dinoflagellates. American Museum of Natural History, Micropaleontology, Special Publication 7: 1-351. In terms of asexual division of motile cells, desmoschisis is generally the case in gonyaulacaleans whereas eleutheroschisis is generally the case in peridinialeans.
|
|
This colonial species reaches diameters of up to and its colonies frequently divide. The species is green, yellow or brown in colour and its corallites are tube-shaped and long. This zooxanthellate stony coral houses symbiont dinoflagellates in its tissues.
|
|
Karenia selliformis is a species from the genus Karenia, which are dinoflagellates. It was first discovered in New Zealand. Karenia selliformis produces the highly toxic gymnodimine, and as such is a potentially harmful ocean dweller.McKenzie, L., Veronica Beuzenberg, and Paul McNabb.
|
|
Motile plankton have been observed to be able to detect and swim towards higher nutrient concentrations and/or light intensities. This mechanism is called chemotaxis and is partly responsible for the formation of thin layers at depths where nutrients are abundant. Another mechanism specific to dinoflagellates is called helical klinotaxis where the algal cell's ability to respond to both positive and negative chemosensory signals is crucial to their motility. If dinoflagellates were not capable of both positive and negative chemotaxis, they would not navigate successfully due to the nature of the transverse and longitudinal flagella causing rotating and translating motions, respectively.
|
|
During this period he continued and expanded his studies of circadian rhythms in dinoflagellates and luminescence in bacteria, dinoflagellates and other organisms. He was elected to the National Academy of Sciences in 2003 and received the Farrell Prize in Sleep Medicine for his work on circadian rhythms in 2006.Dept of MCB, Harvard U: News and Events - MCB News For over 50 years he also had an affiliation with the Marine Biological Laboratory in Woods Hole, Massachusetts. He was the director of the Physiology Course there from 1962–1966, and served as a trustee from 1966–1970.
|
|
The ocelloid of warnowiids functions similarly to eyes found in much larger organisms, containing structures similar to a retina and lens. It is receptive only to the polarized light that is created as light passes through the thecal plates of other dinoflagellates. Because dinoflagellates are the main source of food for warnowiids, this trait is particularly useful for locating prey. A gene fragment that is expressed in the rhodopsin of the retinal body of the ocelloid has been shown to be most closely related to those of bacteria, suggesting a bacterial endosymbiont as the origin of the organelle.
|
|
Aside from human chronobiology, Roenneberg has significantly contributed to other aspects of the chronobiology field. He has done extensive work on dinoflagellates, a unicellular organism, and has been able to show that even this simple organism is capable of possessing two independent rhythms, providing evidence that a single cell can have two different oscillators. In addition, his work on dinoflagellates has been able to show that these two independent oscillators differ to a significant extent in that they respond differently when treated with various light pulses. They found that the two oscillators have varying sensitivities to different types of light.
|
|
In the south-eastern part of the lake, phytoplanktons are dominated by various species of cyanobacterias, some of which are nitrogen-binding and potentially poisonous, and exceptionally other nutrient-demanding algae and dinoflagellates. Zooplankton are only found in small quantities. Variations in quantity appears between the southern and northern parts of the lake, with more an abundant presence of green algae in the northern end where dinoflagellates are substituted also by diatoms. Striking when it comes to aquatic plants is the abundance of spiked water-milfoil and rigid hornswort in the north-western part of the lake.
|
|
Predation of toxic microalgae by heterotrophic dinoflagellates is one of the factors controlling the algal blooms. Polykrikos are known to modulate populations of dinoflagellates like Alexandrium tamarense, and G. catenatum, which are among prevalent agents of toxic algal blooms. Such heterothrophic polykrikoids may not only cut down on the toxicity levels induced by their prey in marine food webs, but can cease the toxic blooms and could be used in bioremediation. Thus, reduction in water toxicity may help regulate the balance of marine food webs and decrease mortality rates of finfish, marine mammals, and sea birds.
|
|
Algal bloom (akasio) by Noctiluca spp. in Nagasaki Many mixotrophic and some heterotrophic dinoflagellates are known to cause red tides or harmful blooms that result in large-scale mortality of fish and shellfish. Studies on red tides have been conducted to determine the mechanism of outbreak and the persistence of red tides caused by mixotrophic dinoflagellates such as Karenia brevis, Prorocentrum donghaiense and Prorocentrum minimum in low nutrient concentration waters. In the case of serial red tides, one mixotrophic dinoflagellate species is dominated by another mixotrophic species in rapid succession over a short span of days.
|
|
There is also a group of parasitic dinoflagellates, the Blastodiniales, that do not have dinokarya during their trophic stage. Because of this, they have been treated as a separate class Blastodiniphyceae, but some or all may actually have developed within the Dinophyceae.
|
|
The mode of transmission is also an important aspect of the biology of beneficial microbial symbionts, such as coral-associated dinoflagellates or human microbiota. Organisms can form symbioses with microbes transmitted from their parents, from the environment or unrelated individuals, or both.
|
|
English-language taxonomic monographs covering large numbers of species are published for the Gulf of Mexico, the Indian Ocean, the British Isles,Dodge, J. D. 1982. Marine Dinoflagellates of the British Isles. Her Majesty's Stationery Office, London. the Mediterranean and the North Sea.
|
|
Observations on possible life cycle stages of the dinoflagellates Dinophysis cf. acuminata, Dinophysis acuta and Dinophysis pavillardi. Aquatic Microbial Ecology, 9: 183–189. The smaller cells that give rise to gametes tend to have thinner thecae and less developed cingular and sulcal lists.
|
|
Syndinium is a cosmopolitan genus of parasitic dinoflagellates that infest and kill marine planktonic species of copepods and radiolarians.Chatton , E. 1910: The existence of coleom Dinoflagellate parasites. The Syndinium in pelagic copepods. Comptes Rendus Hebdomadaires Des Seances De L Academie des Sciences.
|
|
This colour is due to the zooxanthellae, the minute symbiotic dinoflagellates which reside within the tissues of the coral. These photosynthetic algae use sunlight to create organic compounds and the coral is able to use these as part of its nutritional needs.
|
|
Shellfish poisoning includes four syndromes that share some common features and are primarily associated with bivalve molluscs (such as mussels, clams, oysters and scallops.) As filter feeders, these shellfish may accumulate toxins produced by microscopic algae, such as cyanobacteria, diatoms and dinoflagellates.
|
|
It is a colonial stony coral where its colonies contain bifacial fronds in small diameters. Immersed in them are small corallites and its colour is commonly cream or pale brown. It is a zooxanthellate rare coral that houses symbiont dinoflagellates in its tissues.
|
|
Cladopsammia is a genus of stony cup corals in the family Dendrophylliidae. Members of this genus are found at depths down to about . They are azooxanthellate corals, meaning that they do not contain symbiotic photosynthetic dinoflagellates as do many species of coral.
|
|
Dendrophyllia is a genus of stony cup corals in the family Dendrophylliidae. Members of this genus are found at depths down to about . They are azooxanthellate corals, meaning that they do not contain symbiotic photosynthetic dinoflagellates as do many species of coral.
|
|
Astreopora listeri is a zooxanthellate species of coral, harbouring symbiotic dinoflagellates which provide their host with the products of photosynthesis. This coral is sometimes host to the bio-eroding demosponge Cliona orientalis which attacks various calcareous substrates including corals and weakens their structure.
|
|
The surface waters were generally cool, although they sometimes increased in temperature when warmer water from the Tethys Sea entered the region. Sedimentation rates were high, and the bottom waters were rather anoxic. Organisms that inhabited this sea include dinoflagellates, ammonites, and belemnites.
|
|
Karlodinium ballantinum is a species of unarmored dinoflagellates from the genus Karlodinium. It was first isolated from the Australian region of the Southern Ocean. It is small-sized and is characterized by its very short apical groove. It is considered potentially ichthyotoxic.
|
|
Dinosporin is a macromolecular, highly resistant organic compound which forms or partly forms, the enclosing wall of fossilizable organic-walled dinoflagellate cysts.Fensome, R.A., Taylor, F.J.R., Norris, G., Sarjeant, W.A.S., Wharton, D.I., and Williams, G.L., 1993. A classification of modern and fossil dinoflagellates, Sheridan Press, Hanover.
|
|
1\. Ornithocercus; 2. diagram; 3. Exuviaeella; 4. Prorocentrum; 5, 6. Ceratium; 7. Pouchetia; 8. Citharistes; 9. Polykrikos Dinoflagellates are protists which have been classified using both the International Code of Botanical Nomenclature (ICBN, now renamed as ICN) and the International Code of Zoological Nomenclature (ICZN).
|
|
Molecular phylogenies are similar to phylogenies based on morphology. The earliest stages of dinoflagellate evolution appear to be dominated by parasitic lineages, such as perkinsids and syndinians (e.g. Amoebophrya and Hematodinium). All dinoflagellates contain red algal plastids or remnant (nonphotosynthetic) organelles of red algal origin.
|
|
In each case, the wall is rigid and essentially inorganic. It is the non-living component of cell. Some golden algae, ciliates and choanoflagellates produces a shell-like protective outer covering called lorica. Some dinoflagellates have a theca of cellulose plates, and coccolithophorids have coccoliths.
|
|
The diet is plankton, mostly consisting of dinoflagellates. The sand crab mates in spring and summer. The female lays batches of up to 45,000 eggs each month and carries them about beneath her abdomen tucked under her telson. The eggs hatch in about four weeks.
|
|
A wide variety of microorganisms inhabited the coastal waters at the time of the deposition of the Santa Marta Formation. Microfossils include ostracods and dinoflagellates. Invertebrates were also common. Fossils of ammonites can be found in the formation, often embedded vertically in the bedding plane.
|
|
Gambierdiscus toxicus is a species of dinoflagellates that can cause ciguatera, and is known to produce several polyether marine toxins, including ciguatoxin, maitotoxin, gambieric acid, and gambierol. The species was discovered attached to the surface of brown macroalgae in the Gambier Islands, French Polynesia.
|
|
Description, host-specificity, and strain selectivity of the dinoflagellate parasite Parvilucifera sinerae sp. nov. (Perkinsozoa).Protist, 159(4), 563-578. 10.1016/j.protis.2008.05.003 Garces, E., Alacid, E., Bravo, I., Fraga, S., Figueroa, R(2013). Parvilucifera sinerae (alveolata, myzozoa) is a generalist parasitoid of dinoflagellates.
|
|
Its colonies contain upright fronds that are not folded uniformly and contain inclined tube-shaped corallites. Its corallites have openings of elliptical shapes. It is green, grey or brown in colour. T. patula is a zooxanthellate coral and houses symbiont dinoflagellates in its tissues.
|
|
Ceratoperidinium is a genus of dinoflagellates in the order Gymnodiniales. The genus contains two species. It was first created in 1969 by Margalef, with Ceratoperidinium yeye as the type species. However, because it was not correctly described it was considered invalid, as was C. yeye.
|
|
Metagenomic studies of Arctic sea ice using 454 sequencing of 18S rDNA and 18S rRNA. These studies showed dominance of three supergroups: Alveolata, Stramenophile, and Rhizaria. Within the Alveolates most common were Ciliates, and Dinoflagellates. Within the Stramenophile group most organisms were classified as Bacillariophyceae.
|
|
This clam is a filter feeder and consumes microscopic algae such as dinoflagellates, diatoms, and cyanobacteria. Some dinoflagellates produce neurotoxins, such as saxitoxin and its derivates, that bioaccumulate in the clams and other bivalve mollusks and can cause paralytic shellfish poisoning (PSP) when the clams are eaten. Despite this fact, the clam was eaten by Native Americans and is still used as a food for humans. According to a 1996 report from the Marine Advisory Program at the University of Alaska, the United States Food and Drug Administration (FDA) considers seafood unsafe if it contains more than 80 μg of PSP-causing toxins per 100 g of tissue of the seafood.
|
|
Paralytic shellfish poisoning (PSP) is one of the four recognized syndromes of shellfish poisoning, which share some common features and are primarily associated with bivalve mollusks (such as mussels, clams, oysters and scallops). These shellfish are filter feeders and accumulate neurotoxins, chiefly saxitoxin, produced by microscopic algae, such as dinoflagellates, diatoms, and cyanobacteria. Dinoflagellates of the genus Alexandrium are the most numerous and widespread saxitoxin producers and are responsible for PSP blooms in subarctic, temperate, and tropical locations. The majority of toxic blooms have been caused by the morphospecies Alexandrium catenella, Alexandrium tamarense, Gonyaulax catenella and Alexandrium fundyense, which together comprise the A. tamarense species complex.
|
|
Haplozoon lack visible flagella, where traditional dinoflagellates have two – one transverse and one longitudinal. H. axiothellae possesses a longitudinal row of ventral pores along the cell surface, a possible vestigial feature from lost flagella. The exterior of Haplozoon cells are covered in amphiesmal projections (syn. thecal barbs).
|
|
This is consistent with our understanding that some lineages of dinoflagellates have experienced plastid loss as they evolved.Saldarriaga, J., Taylor, F., Keeling, P., & Cavalier-Smith, T. (2001). Dinoflagellate nuclear SSU rRNA phylogeny suggests multiple plastid losses and replacements. Journal of Molecular Evolution, 53(3), 204–213.
|
|
In addition to being parasites themselves, copepods are subject to parasitic infection. The most common parasite is the marine dinoflagellates, Blastodinium spp., which are gut parasites of many copepod species. Currently, 12 species of Blastodinium are described, the majority of which were discovered in the Mediterranean Sea.
|
|
Palynology is the study of pollen, spores, and other microscopic plant bodies such as dinoflagellates (marine algal cysts). Pollen carries the male gametes (sex cells) of flowering plants and plants that produce cones (e.g. spikey trees). Spores are asexual reproductive bodies of ferns, mosses and fungi.
|
|
Ceratiums have zygotic meiosis in their alternation of generation. Ceratium dinoflagellates may reproduce sexually or asexually. In asexual reproduction, the pellicle (shell) pulls apart and exposes the naked cell. The cell then increases in size and divides, creating 4–8 daughter cells, each with two flagella.
|
|
Blastodinium (also known as Blastodiniphycaea) is a diverse genus of dinoflagellates and important parasites of planktonic copepods. They exist in either a parasitic stage, a trophont stage, and a dinospore stage. Although morphologically and functionally diverse, as parasites they live exclusively in the intestinal tract of copeods.
|
|
The polyps of Acropora pulchra extend their tentacles to catch plankton. However, much of the nutrition the coral receives comes from the symbiotic zooxanthellae found in the tissues. These photosynthetic dinoflagellates produce energy when exposed to sunlight and the coral makes use of this. Acropora spp.
|
|
Since 24-norcholestane origins are still unknown, the synthesis of it is also unknown as well. However, some pathways have been proposed. Possible sources of 24-norcholestane include 24-norcholesterol, which is present in many marine invertebrates and some algae in addition to diatoms and dinoflagellates.
|
|
The evidence from fossil plants, mammals, molluscs, foraminifers and dinoflagellates has been used to make biostratigraphic correlations between chronostratigraphic Stages recognised in East Anglia and the more complete sequence on the Continent. Wider correlation is made with Marine Isotope Stages (MIS) and magnetostratigraphy, despite uncertainties in interpretation.
|
|
Eleuteroschisis is asexual reproduction in dinoflagellates in which the parent organism completely sheds its theca (i.e. undergoes ecdysis) either before or immediately following cell division. Neither daughter cell inherits part of the parent theca.FENSOME R.A., TAYLOR F.J.R., NORRIS G., SARJEANT W.A.S., WHARTON D.I. & WILLIAMS G.L. 1993.
|
|
Turbinaria bifrons is a zooxanthellate hermatypic coral and its tissues contain symbiont dinoflagellates. Its colonies begin as thin layers that become bifacial fronds that are vertical and elongated. It has conical corallites with regular shapes and sizes. The coral is mostly brown, green or grey in colour.
|
|
Gonyautoxins are naturally produced by several marine dinoflagellates species (Alexandrium sp., Gonyaulax sp., Protogonyaulax sp.).The Human Metabolome Database The paralytic shellfish poisoning caused by these toxins is connected with dinoflagellate blooms known as “red tides”, even though the coloration of the water isn’t a necessity.
|
|
The genus Dinoroseobacter name originates from the Greek dinos meaning whirling rotation and the first part of Dinophyceae (dinoflagellates) from which it was isolated, and Roseobacter a bacterial genus with similar traits. Shibae was named after Professor Tsuneo Shiba who discovered the marine aerobic anoxygenic phototrophic bacteria.
|
|
Alvernaviridae is a family of viruses. Dinoflagellates serve as natural hosts. There is currently only one species in this family: the type species Heterocapsa circularisquama RNA virus 01. Diseases associated with this family include: control of the host population possibly through lysis of the host cell.
|
|
Ninety percent of marine life lives in the photic zone, which is approximately two hundred meters deep. This includes phytoplankton (plants), including dinoflagellates, diatoms, cyanobacteria, coccolithophorids, and cryptomonads. It also includes zooplankton, the consumers in the photic zone. There are carnivorous meat eaters and herbivorous plant eaters.
|
|
Some of the layers at that locality expose also influence of temporal hypersaline conditions on bottom waters, due to the abundance of methylsteranes, associated with Dinoflagellates or halophylic microorganisms and gammacerane. This salinity stratification might have had an impact on the presence of organic matter on the level.
|
|
The endosymbiotic origin, diversification and fate of plastids - NCBI In most of the species, the plastid genome consist of just 14 genes. The DNA of the plastid in the peridinin-containing dinoflagellates is contained in a series of small circles. Each circle contains one or two polypeptide genes.
|
|
Pyrodinium bahamense, considered the sister taxon to Alexandrium, is a tropical photosynthetic euryhaline species of dinoflagellates found mainly in the Atlantic ocean.Usup, G., Ahmad, A., Matsuoka, K., Lim, P.T., Leaw ,C.P., 2012. Biology, ecology and bloom dynamics of the toxic marine dinoflagellate Pyrodinium bahamense. Harmful algae 14, 301-312.
|
|
Unicellular and symbiotic cyanobacteria were discovered in cells of coral belonging to the species Montastraea cavernosa from Caribbean Islands. These cyanobionts coexisted within the symbiotic dinoflagellates zooxanthellae within the corals, and produce the nitrogen-fixing enzyme nitrogenase. Details on the interaction of the symbionts with their hosts remains unknown.
|
|
Phytoplankton are key primary producers in estuaries. They move with the water bodies and can be flushed in and out with the tides. Their productivity is largely dependent upon the turbidity of the water. The main phytoplankton present is diatoms and dinoflagellates which are abundant in the sediment.
|
|
Contrarily, planktonic foraminifera diversified, and dinoflagellates bloomed. Success was also enjoyed by the mammals, who radiated extensively around this time. The deep-sea extinctions are difficult to explain, because many species of benthic foraminifera in the deep-sea are cosmopolitan, and can find refugia against local extinction.Thomas, E., 2007.
|
|
Ontologically, the term cyst can apply to (1) a temporary resting state (pellicle, temporary or ecdysal cyst), (2) a dormant zygote (resting cysts or hypnozygotes) or (3) a coccoid condition in which the cells are still photosynthetically active.Pfiester L.A. & Anderson D.M. 1987. Dinoflagellate reproduction. In: The biology of dinoflagellates.
|
|
Another method, rarely used, uses a sucrose gradient. Recent times have brought about the possibility to get molecular sequences from single cysts or single cells. The proportion of cyst-forming species for marine dinoflagellates is between 15 and 20%HEAD M.J. 1996. Modern dinoflagellate cysts and their biological affinities.
|
|
Once silicate is depleted in the environment, diatoms are succeeded by smaller dinoflagellates. This scenario has been observed in Rhode Island,Smayda, T.J.(1957). "Phytoplankton studies in lower Narragansett Bay". Limnology and Oceanography 2(4) 342-359Nixon, S.W., Fulweiler, R.W., Buckley, B.A., Granger, S.L., Nowicki, B.L., Henry, K.M. (2009).
|
|
Coolia tropicalis is a species of dinoflagellates, first found in Belize. Its cell size ranges from 23–40 μm long, 25–39 μm wide and 35–65 μm in dorsoventral diameter. Cells are spherical, smooth and covered with scattered round pores. Its epitheca is smaller than its hypotheca.
|
|
Puffer fish and some marine dinoflagellates also produce saxitoxin. Saxitoxins bioaccumulate in shellfish and certain finfish. Ingestion of saxitoxin, usually through shellfish contaminated by toxic algal blooms, can result in paralytic shellfish poisoning. Saxitoxin has been used in molecular biology to establish the function of the sodium channel.
|
|
Takayama helix is a species of dinoflagellates with sigmoid apical grooves first found in Tasmanian and South African waters. It contains fucoxanthin and its derivatives as its main accessory pigments. Takayama helix has an apical groove being practically straight while still clearly bent. It possesses one ventral pore.
|
|
She graduated from Elverum Teachers' College in 1942, and graduated from the University of Oslo in 1949. Her first publication was Phototactic vertical migration in marine dinoflagellates. She took the dr.philos. degree in 1968 on the thesis An Analysis of the Phytoplankton of the Pacific Southern Ocean. Bacillariophyceae.
|
|
Karlodinium conicum is a species of unarmored dinoflagellates from the genus Karlodinium. It was first isolated from the Australian region of the Southern Ocean. It is large-sized and is characterized by having a distinct conical epicone and spherical posterior nucleus, hence its name. It is considered potentially ichthyotoxic.
|
|
An isolate of Erythropsidinium. The arrow indicates the piston; the double arrowhead indicates the ocelloid. Scale bar 20 µm. A piston (also known as a dart, prod, or tentacle) is a complex contractile organelle found in some dinoflagellates, namely the Erythropsidinium and Greuetodinium genera of the family Warnowiaceae.
|
|
Dinophysis is a genus of dinoflagellates common in tropical, temperate, coastal and oceanic waters.Hallegraeff, G.M., Lucas, I.A.N. 1988: The marine dinoflagellate genus Dinophysis (Dinophyceae): photosynthetic, neritic and non-photosynthetic, oceanic species. Phycologia, 27: 25–42. 10.2216/i0031-8884-27-1-25.1 It was first described in 1839 by Christian Gottfried Ehrenberg.
|
|
Balanophyllia elegans, the orange coral or orange cup coral, is a species of solitary cup coral, a stony coral in the family Dendrophylliidae. It is native to the eastern Pacific Ocean. As an azooxanthellate species, it does not contain symbiotic dinoflagellates in its tissues in the way that most corals do.
|
|
The main source of photosynthetically derived energy is phytoplankton. Generally speaking, diatoms and microflagellates produce most of the bioavailable carbon in the estuary.Jassby and Cloern 2000 Other types, notably the dinoflagellates, may produce harmful algal blooms, or red tides, that are less readily available for assimilation into the foodweb.Anderson et al.
|
|
In 1998, dinosteranes were found in high relative abundance in samples from the Lükati Formation, which were collected from the Kopli quarry in Estonia. This evidence was used to place the origin of dinoflagellates as early as the Early Cambrian, much earlier than the Bristol Trough studies had been able to.
|
|
Karlodinium antarcticum is a species of unarmored dinoflagellates from the genus Karlodinium. It was first isolated from the Australian region of the Southern Ocean, near the polar front. It is medium-sized and is characterized by its long ovoid cell shape and rather long apical groove. It is considered potentially ichthyotoxic.
|
|
The most common species is Noctiluca scintillans, also called N. miliaris. Blooms of this species are red-orange and can be bioluminescent when disturbed, as are various other dinoflagellates, and large blooms can sometimes be seen as flickering lights on the ocean, known as the milky seas effect. Another example is Spatulodinium pseudonoctiluca.
|
|
Like most photosynthetic coral, this species hosts zooxanthellae, dinoflagellates that convert sunlight into sugar for energy. Like a subset of other corals, it also has a "mouth" that it uses to ingest bits of other food gathered by its large tendrils. The behavior and adaptation are similar to those of sea anemones.
|
|
The genus Ceratium is restricted to a small number (about 7) of freshwater dinoflagellate species. Previously the genus contained also a large number of marine dinoflagellate species. However, these marine species have now been assigned to a new genus called Tripos. Ceratium dinoflagellates are characterized by their armored plates, two flagella, and horns.
|
|
Sometimes, young trophocytes possess an anterior beak, although its function is unknown. The trophont stage is a multicellular growth stage, composed of many individual cells wrapped by a cellulosic layer. Dinospores are free-swimming flagellates that exhibit the typical morphology of dinoflagellates. Although initially binucleated, they later divide into four uni-nucleated dinospores.
|
|
Eleanor Beatrice Marcy "Beazy" Sweeney (-) was an American plant physiologist and a pioneering investigator into circadian rhythms. She was professor emerita at University of California, Santa Barbara. Having started her career as a botanist, serendipity led her to dinoflagellate research. She investigated circadian rhythms in photoluminescent dinoflagellates, and other single celled organisms.
|
|
Acropora secale is a zooxanthellate species of coral. This means that it has symbiotic dinoflagellates living within its tissues. These, combined with pigments in the tissue, are responsible for the colour of the colony. Acropora secale is a hermaphrodite and both female gonads and testes are present and mature once a year.
|
|
There registered a transgression on the sea level on the Lower Toarcian, with a rise, giving the Umbria-Marche Basin pelagic conditions, and a regression during the Middle Toarcian. Those changes implicate the disappearance of genera of dinoflagellates from the strata to be replaced with new ones.Palliani et al., 1998Palliani et al.
|
|
Coral polyps do not photosynthesize, but have a symbiotic relationship with microscopic algae (dinoflagellates) of the genus Symbiodinium, commonly referred to as zooxanthellae. These organisms live within the polyps' tissues and provide organic nutrients that nourish the polyp in the form of glucose, glycerol and amino acids.Zooxanthellae… What's That?. Oceanservice.noaa.gov (March 25, 2008).
|
|
The taxonomic history of the group has been tumultuous and has included a variety of affiliations, such as silicoflagellates, dinoflagellates, 'radiolarians' and 'neomonads'. Recently the Ebridea is treated as a eukaryotic taxon with an unclear phylogenetic position, but last molecular studies (Canadian Institute for Advanced Research) place of ebriids within the Cercozoa.
|
|
Amphidinium carterae is a species of dinoflagellates. It was first described by Edward M. Hulburt in 1957, and was named in honour of the British phycologist Nellie Carter-Montford. The type locality is Great Pond, Barnstable County, Massachusetts, USA. Some strains of this species are considered as toxic (against fungi, for example).
|
|
The life stages of dinoflagellates in the genus Symbiodinium. (A) Electron micrographs of a Symbiodinium mastigote (motile cell) with characteristic gymnodinioid morphology (S. natans; Hansen & Daugbjerg 2009) and (B) the coccoid cell in hospite. As free-living cells the mastigote allows for short-range dispersal and can exhibit chemotaxis toward sources of nitrogen.
|
|
All members of this phylum are parasitic and evolved from a free-living ancestor. This lifestyle is presumed to have evolved at the time of the divergence of dinoflagellates and apicomplexans. Further evolution of this phylum has been estimated to have occurred about . The oldest extant clade is thought to be the archigregarines.
|
|
The molecular genetics of dinotoxin synthesis is not widely understood, but the polyketide pathway involving polyketide synthase (PKS) is known to be associated with the production of dinotoxins. The toxins released by dinoflagellates commonly include sulfated polysaccharides. One common toxin, saxitoxin, blocks sodium ions from moving through sodium channels on cell membranes.
|
|
Leptogorgia sarmentosa with polyps extended, colonised by Alcyonium coralloides Leptogorgia sarmentosa is a suspension feeder. The polyps extend their tentacles to filter particles from the water flowing past the colony. The diet includes zooplankton such as dinoflagellates, diatoms and ciliates as well as particles of organic detritus. Colonies are either male or female.
|
|
Dinoflagellate/viral nucleoproteins (DVNPs) are a family of positively- charged, DNA-binding nucleoproteins found exclusively in dinoflagellates and Nucleocytoviricota. It serves to compact DNA in these organisms. The proteins are known to pack DNA more tightly than histones do. When expressed in eukaryotes that possess histones, they displace nucleosomes and impair translation.
|
|
This sea slug feeds on hydroids which contain Symbiodinium, microscopic dinoflagellates that are photosynthetic. The microscopic Symbiodinium acquired from the hydroids are 'farmed' in the sea slug's digestive diverticula, where the Symbiodinium photosynthesizes sugars to be used by the slug. The slug gains enough photosythetically derived sugars to sustain it without feeding.
|
|
As CO2 concentrations in the atmosphere increase via anthropogenic causes, acidification of the ocean will increase as the result of increasing CO2 sequestration by the ocean; the ocean is a great sink for carbon, absorbing more as its concentration in the atmosphere increases. As this occurs, there will be species and community composition shifts in marine plankton communities. Mixotrophic dinoflagellates will be favoured over photosynthetic dinoflagellates, as the oceans will become more nutrient limited and mixotrophs will not have to rely only on inorganic nutrients but will be able to take advantage of being able to consume particulate organic matter. With an increase in temperature, there is an increase in water column stability, which leads to favourable conditions for mixotrophic growth.
|
|
N. from the Devonian of the Rudnyy Altay (a unique find of dinoflagellate fossils), Doklady Akademii Nauk SSSR 307, 442–445 (in Russian). however Fensome et al. (1999) consider its dinoflagellate affinity (and also supposed age) unlikely. The fossil record supports a major adaptive radiation of dinoflagellates during later Triassic and earlier Jurassic times.
|
|
Roseobacter clade can establish symbiotic and pathogenic relationships. Roseobacter strains can form symbiotic relationships with varies eukaryotic marine organisms. Roseobacter phylotypes has been identified in the species of the marine red alga Prionitis. In addition, Roseobacters can develop close relationship with Pfiesteria, where they are found to be within or attached to these dinoflagellates.
|
|
Vaadhoo island is famous for the 'sea of stars.' This marine bioluminescence is generated by phytoplankton known as dinoflagellates. Woodland Hastings of Harvard University has for the first time identified a special channel in the dinoflagellate cell membrane that responds to electrical signals—offering a potential mechanism for how the algae create their unique illumination.
|
|
DNA sequence comparisons suggest that the closest relative of the genus Noctiluca is Spatulodinium. Spatulodinium pseudonoctiluca seems to be more closely related to N. scintillans than to other Spatulodinium species. N. scintillans is also placed within a classification scheme that has a class Diniferea, or Dinophyceae, which includes nonparasitic dinoflagellates that lack armor plating.
|
|
This colonial species is found as irregular encrusting plates and has non-uniform corllites. Its uniform coenosteum is smooth, and the species is mainly dark brown in colour; the colour can be blotched. It has a similar appearance to Turbinaria stellulata. T. irregularis is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues.
|
|
Red tides occur naturally off coasts all over the world. Marine dinoflagellates produce ichthyotoxins, but not all red tides are harmful. Where red tides occur, dead fish wash up on shore for up to two weeks after a red tide has been through the area. In addition to killing fish, the toxic algae contaminate shellfish.
|
|
Coquille. Tridacna squamosa is sometimes kept in aquaria, where it requires a moderate amount of care. This species is a relatively hardy member of the Tridacnidae. A moderate amount of light is required by this species because it relies on zooxanthellae for part of its nutrition. These dinoflagellates use the mantle as a habitat.
|
|
The Prorocentrales are a small order of dinoflagellates. They are distinguished by having their two flagella inserted apically, rather than ventrally as in other groups. One flagellum extends forward and the other circles its base, and there are no flagellar grooves. This arrangement is called desmokont, in contrast to the dinokont arrangement found in other groups.
|
|
Taxon 57, p. 1289–1303, 2008, Groups claimed by protozoologists and phycologists include euglenids, dinoflagellates, cryptomonads, haptophytes, glaucophytes, many heterokonts (e.g., chrysophytes, raphidophytes, silicoflagellates, some xanthophytes, proteromonads), some monadoid green algae (volvocaleans and prasinophytes), choanoflagellates, bicosoecids, ebriids and chlorarachniophytes. Slime molds, plasmodial forms and other "fungus-like" organisms claimed by protozoologists and mycologists include mycetozoans, plasmodiophorids, acrasids, and labyrinthulomycetess.
|
|
Compass jellyfish are carnivores, consuming other marine invertebrates and plankton. They feed on a variety of benthic and pelagic organisms including but not limited to: dinoflagellates, copepods, crustacean eggs, larval fish, and chaetognaths. They stun and capture their prey with stinging cells on their tentacles. The oral arms facilitate movement of captured prey into the oral opening.
|
|
In 1972 Trench moved to Yale University as an Assistant Professor. Trench moved to the University of California, Santa Barbara in 1976. His research considered corals and symbiotic algae, with a focus on the adaption of zooxanthellae and how they adapt to different coral environments. He studied dinoflagellates, which can be used as an indicator of water quality.
|
|
Gonyaulax is a genus of dinoflagellates that are aquatic organisms with two separate flagella: one extends backward and the other wraps around the cell in a lateral groove helping to keep the organism afloat by rotational motility. The plate formula in the genus Gonyaulax Diesing was redefined as Po, 3', 2a, 6", 6c, 4-8s, 5'", 1p, 1"".
|
|
Gonyaulax dinoflagellates have evolved a type of resting spore (or resting cyst), to enable it to survive harsh weather conditions. Resting cysts can be formed when temperature or salinity changes in the surrounding water. These cysts are round mucous covered bodies that appear reddish in color. Gonyaulax catenella has been recorded forming vegetative cysts in response to cold water.
|
|
Small gobies can often be found perching on this coral or swimming around the surface searching for food. This coral is a zooxanthellate species; the coral houses symbiotic dinoflagellates within its tissues which supply it with much of the nourishment it needs. The polyps supplement this by extending their tentacles to feed, but do so only at night.
|
|
These blooms also deplete the dissolved oxygen in the water, which is known to cause fish kills. Fish kills result from depleting oxygen levels caused by Ceratium blooms. These dinoflagellates play important roles at the base of the food web. They are sources of nutrients for larger organisms and also prey on smaller organisms such as diatoms.
|
|
The medusa usually lives upside-down on the bottom, which has earned them the common name. These jellyfish partake in a symbiotic relationship with photosynthetic dinoflagellates and therefore, must lay upside-down in areas with sufficient light penetration to fuel their energy source. Where found, there may be numerous individuals with varying shades of white, blue, green and brown.
|
|
Acropora grandis is a zooxanthellate species of coral. This means that it has symbiotic dinoflagellates living within its tissues. These photosynthetic microalgae, combined with pigments in the tissue, are responsible for the colour of the colony and provide a proportion of its nutritional needs. Acropora grandis liberates its gametes into the sea where fertilisation takes place.
|
|
The warnowiids as a group possess unusually complex subcellular structures. The ocelloid light sensitive structure is recognized as a synapomorphic character of warnowiids. Other complex subcellular structures, such as nematocysts, trichocysts, and pistons, are present in some (but not all) warnowiids and are shared with the polykrikoid dinoflagellates, the closest extant relatives as defined by molecular phylogenetics.
|
|
The ciliate Mesodinium rubrum retains functioning plastids from the cryptophyte algae on which it feeds, using them to nourish themselves by autotrophy. These, in turn, may be passed along to dinoflagellates of the genus Dinophysis, which prey on Mesodinium rubrum but keep the enslaved plastids for themselves. Within Dinophysis, these plastids can continue to function for months.
|
|
The motile flagellated form is gymnodinioid and athecate. The relative dimensions of the epicone and hypocone differ among species. The alveoli are most visible in the motile phase but lack fibrous cellulosic structures found in thecate ("armored") dinoflagellates. Between the points of origin of the two flagella is an extensible structure of unknown function called the peduncle.
|
|
It lives attached to stones or shells (fragments) in between large grains of sand. Like in all brachiopods, it filters food particles, chiefly diatoms and dinoflagellates. Gwynia capsula harbors a small number of larvae inside a brood pouch, but it has separate sexes, unlike also very small and pouch brooding Argyrotheca and Joania, which are hermaphrodite.
|
|
Turbinaria bifrons, commonly known as disc coral, is a species of colonial stony coral in the family Dendrophylliidae. It is native to the Indo-Pacific region. It is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues. This is an uncommon species and the International Union for Conservation of Nature has rated its conservation status as being "vulnerable".
|
|
P. clavata is a filter feeder, the polyps extending their tentacles to catch food particles floating past. Its diet includes copepods, diatoms, dinoflagellates, ciliates, and organic carbon particles in suspension. Each colony is either male or female. Sperm is liberated into the sea by the male colonies and fertilisation occurs on the surface of the female colonies.
|
|
Gambierdiscus pacificus is a species of toxic (ciguatoxin- and maitotoxin-like toxicity) dinoflagellates. It is 67–77 μm long and 60–76 μm wide dorsoventrally and its surface is smooth. It is identified by a four-sided apical pore plate surrounded by 30 round pores. Its first plate occupies 20% of the width of the hypotheca.
|
|
Gambierdiscus australes is a species of toxic (ciguatoxin- and maitotoxin-like toxicity) dinoflagellates. It is 76–93 μm long and 65–85 μm wide dorsoventrally and its surface is smooth. It is identified by a broad ellipsoid apical pore plate surrounded by 31 round pores. Its first plate occupies 30% of the width of the hypotheca.
|
|
Ceratoperidiniaeceae is a family of unarmored dinoflagellates in the order Gymnodiniales, first described in 2013. The family is named for the first described species, Ceratoperidinium margalefii. Members of the family were found to have morphological similarities, particularly the acrobase structure which was found to be common among the species included in the family. Member species possess chloroplasts.
|
|
Perna perna is harvested as a food source in Africa and South America. The bivalve is considered for cultivation as it can grow quickly to the commercial size of 60 to 80 mm in just 6 or 7 months. It is also well- suited to tropical and subtropical regions. However, the mussel can harbor saxitoxin from consumed dinoflagellates.
|
|
Takayama tuberculata is a species of unarmored dinoflagellates from the genus Takayama, being closely related to T. tasmanica. It was first isolated from the Australian region of the Southern Ocean, just north of the polar front. It is medium-sized and is characterized by its long ovoid cell shape and rather long apical groove. It is considered potentially ichthyotoxic.
|
|
There are often clear examples of sudden outbreaks of parasitism by specific dinoflagellates in a short time period, leading to a sudden decrease in zooplankton population density, implying that parasitic dinoflagellates can create fluctuations in marine plankton. There is insufficient information however regarding the parasitism process in Coccidinium, such as how the sporozoite enters the host and its specific effects on the dinoflagellate population. What is clear though is that the initial infection site is inside the nucleus of the host. Juvenile trophozoite generally lie close to the host’s nucleus, where it will undergo growth through the consumption of either the nucleus and chromosomes, or cytoplasm, depending on the species. The trophozoite will depress the host’s nucleus before infecting and destroying it, though the exact mechanism is yet to be known.
|
|
Sweeney introduced Greider to research during her freshman year, and mentored her throughout the rest of her time at UCSB. Sweeney was president of the American Society for Photobiology in 1979, the American Institute of Biological Sciences in 1980, the pacific division of the American Association for the Advancement of Science in 1981, and the Phycological Society of America in 1986. In 1983, the Botanical Society of America awarded her the Darbaker Prize for Study of Microscopic Algae, with the citation as follows: > Dr. Sweeney is a world-respected innovator in the study of circadian > rhythms, particularly in the dinoflagellates. By bringing dinoflagellates > into culture and by defining their multiple photoperiodic responses, > especially the physiological and ultrastructural aspects of the circadian > rhythms of their bioluminescence, she has influenced the research direction > of many laboratories.
|
|
An anion exchanger will then be used to secrete DIC at the site of calcification. This DIC pool is also utilized by algal symbionts (dinoflagellates) that live in the coral tissue. These algae photosynthesize and produce nutrients, some of which are passed to the coral. The coral in turn will emit ammonium waste products which the algae uptake as nutrients.
|
|
The number of scintillons is higher during night than during day, and breaks down during the end of the night, at the time of maximal bioluminescence. The luciferin-luciferase reaction responsible for the bioluminescence is pH sensitive. When the pH drops, luciferase changes its shape, allowing luciferin, more specifically tetrapyrrole, to bind. Dinoflagellates can use bioluminescence as a defense mechanism.
|
|
The most notable shared characteristic is the presence of cortical (outer-region) alveoli (sacs). These are flattened vesicles (sacs) packed into a continuous layer just under the membrane and supporting it, typically forming a flexible pellicle (thin skin). In dinoflagellates they often form armor plates. Alveolates have mitochondria with tubular cristae (ridges), and their flagellae or cilia have a distinct structure.
|
|
The radial corallites are cylindrical, large and close together or touching, and project from the branches by up to . Each has a distinct, large irregularly shaped opening near the tip. The colour of this coral is greenish, creamy or pale brown. This colour comes from minute symbiotic dinoflagellates known as zooxanthellae which live within the tissues of the coral polyps.
|
|
The alveolates are a major clade of unicellular eukaryotes of both autotrophic and heterotrophic members. The most notable shared characteristic is the presence of cortical (outer-region) alveoli (sacs). These are flattened vesicles (sacs) packed into a continuous layer just under the membrane and supporting it, typically forming a flexible pellicle (thin skin). In dinoflagellates they often form armor plates.
|
|
First discovered by Édouard Chatton and Berthe Biecheler in 1934, Coccidinium was initially observed in the cytoplasm of the dinoflagellates Glenodinium sociale and Peridinium sp., both taken from the waters of Sète. They identified two species of Coccidinium, C. legeri and C. duboscquii. In 1936, C. mesnili and C. punctatum were added to the list of existing Coccidinium species by Chatton and Biecheler.
|
|
Parasitism in organisms usually implies ecological and human economic repercussions, but in the case of Coccidinium, these repercussions carry relatively little importance in the ecology of host organisms from an anthropocentric point of view. Unless the host species is commercially significant, studies conducted on parasitic dinoflagellates are few and far between, therefore not much is known about the ecological importance of Coccidinium specifically.
|
|
Such dinoflagellates are Ostreopsis lenticularis, O. siamensis, O. mascarensis and O. ovata. Such fish are scrawled filefish, pinktail triggerfish, Ypsiscarus ovifrons, Decapterus macrosoma (shortfin scad), bluestripe herring and Epinephelus sp. Such crabs are Lophozosimus pictor, Demania reynaudii and gaudy clown crab. Certain bacteria might be able to produce palytoxin and may be the actual producers in some of the organisms listed above.
|
|
Multispecies microbial mutualizes on coral reefs: the host as a habitat. Am. Nat. 162:S51-S62, Knowlton N., Rohwer F. The problem is that these dinoflagellates are also nitrogen limited and must form a symbiotic relationship with another organism; here it is suggested to be diazotrophs. In addition, cyanobacteria have been found to possess genes that enable them to undergo nitrogen fixation.
|
|
This is a zooxanthellate species of coral and has symbiotic dinoflagellates living within its tissues. These are photosynthetic and provide much of the energy used by the coral. In combination with pigments in the tissue, they are responsible for the yellowish-brown colour of the colony. Acropora loripes is a hermaphrodite and the different colonies in an area synchronise their breeding activity.
|
|
The majority of living thecate dinoflagellates can be interpreted as having either a peridinalean or gonyaulacalean tabulation, and that these tabulations, and hence the orders Gonyaulacales and Peridiniales, have been separate since at least the Early Jurassic. The biostratigraphical application of dinoflagellate cysts has been thoroughly studied.Powell, A. J. (ed.), 1992: A Stratigraphic Index of Dinoflagellate Cysts. London: Chapman & Hall, 300 pp.
|
|
Karenia are naked, flat, unicellular, photosynthetic cells that are quite pleomorphic: size tends to range from about 20–90 um. The cell contains a straight apical groove, and differences in apical grooves (acrobases) are often used to distinguish between species. Thecal plates are not present. The cell body can be divided into an episome and a hyposome like other dinoflagellates.
|
|
Waminoa litus is a species of dinoflagellate-bearing acoels which are epizoic on living corals. This species is unique in that it transmits its endosymbiotic dinoflagellates (zooxanthellae) vertically (from the parent host to the offspring) via eggs, regardless of the heterogeneity of the zooxanthellae. Two dinoflagellate genera have been found to simultaneously live in the parenchyma of W. litus: Symbiodinium and Amphidinium.
|
|
At night, the polyps of Isophyllia sinuosa extend their tentacles to feed on zooplankton. This coral is a zooxanthellate species, which means that it harbours symbiotic dinoflagellates (unicellular algae) in its tissues. These contain chlorophyll and can provide the coral with organic carbon compounds by photosynthesis. These are important to the coral and provide up to 50% of its nutrient requirements.
|
|
Reef-building corals are well-studied holobionts that include the coral itself together with its symbiont zooxanthellae (photosynthetic dinoflagellates), as well as its associated bacteria and viruses.Knowlton, N. and Rohwer, F. (2003) "Multispecies microbial mutualisms on coral reefs: the host as a habitat". The American Naturalist, 162(S4): S51-S62. . Co-evolutionary patterns exist for coral microbial communities and coral phylogeny.
|
|
Many dinoflagellates are meroplanktonic, undergoing a seasonal cycle of encystment and dormancy in the benthic zone followed by excystment and reproduction in the pelagic zone before returning to the benthic zone once more. There also exist meroplanktonic diatoms; these have a seasonal resting phase below the photic zone and can be found commonly amongst the benthos of lakes and coastal zones.
|
|
The benthos in a shallow region will have more available food than the benthos in the deep sea. Because of their reliance on it, microbes may become spatially dependent on detritus in the benthic zone. The microbes found in the benthic zone, specifically dinoflagellates and foraminifera, colonize quite rapidly on detritus matter while forming a symbiotic relationship with each other.
|
|
P. marinus is a protozoan of the protist superphylum Alveolata, the alveolates. Its phylum, Perkinsozoa, is a relatively new taxon positioned between the dinoflagellates and the Apicomplexa, and is probably more closely related to the former. P. marinus is the type species of the genus Perkinsus, which was erected in 1978. When first identified in 1950, it was mistaken for a fungus.
|
|
Many more studies of its genetics are now underway. There are some limitations to using the species as a model, in part because dinoflagellates are so diverse. O. marina itself is very diverse, with many varied strains, and their biology is influenced by the environment, so it can be hard to find a representative specimen to use as a model.
|
|
Turbinaria stellulata tends to be submassive with encrusting margins and does not produce vertical structures to any extent. The corallites are about in diameter and have thick walls. This coral is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues. It is usually some shade of brown or green, but other colours sometimes occur, depending on which species of symbiont is present.
|
|
Karlodinium corrugatum is a species of unarmored dinoflagellates from the genus Karlodinium. It was first isolated from the Australian region of the Southern Ocean, just south of the polar front. It is small-sized and is characterized by having distinctive striations on the epicone surface which are parallel, and a distinctively shaped and placed ventral pore. It is considered potentially ichthyotoxic.
|
|
Recent Fourier-transform infrared spectroscopy (FTIR) work shows both differences and similarities between the major dinocyst lineages, which are suggested to be related to nutritional strategies.Bogus, K. Mertens, K.N., Lauwaert, J., Harding, I.C., Vrielinck, H., Zonneveld, K.A.F., Versteegh, G.J.M. (2014). Variations in the chemical composition of organic-walled dinoflagellate resting cysts produced by phototrophic and heterotrophic dinoflagellates. Journal of Phycology doi: 10.1111/jpy.12170.
|
|
Mitochondria are mainly located below the amphiesmal vesicles towards the outside of the cell and possess tubular cristae. TEM sections have revealed multiple triple membrane-bound organelles within the gonocytes. They are roughly spherical and range in size from 200 nm – 750 nm. They appear like relic non-photosynthetic plastids, which have been found among other members of Myzozoa (apicomplexans as well as dinoflagellates).
|
|
Montipora digitata is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
In addition to their disproportionately large genomes, dinoflagellate nuclei are unique in their morphology, regulation, and composition. Their DNA is so tightly packed it is still uncertain exactly how many chromosomes they have. The dinoflagellates share an unusual mitochondrial genome organisation with their relatives, the Apicomplexa. Both groups have very reduced mitochondrial genomes (around 6 kilobases (kb) in the Apicomplexa vs ~16kb for human mitochondria).
|
|
Green algae have been taken up by the euglenids, chlorarachniophytes, a lineage of dinoflagellates, and possibly the ancestor of the CASH lineage (cryptomonads, alveolates, stramenopiles and haptophytes) in three or four separate engulfments. Many green algal derived chloroplasts contain pyrenoids, but unlike chloroplasts in their green algal ancestors, storage product collects in granules outside the chloroplast. Euglena, a euglenophyte, contains secondary chloroplasts from green algae.
|
|
The diatom endosymbiont's nucleus is present, but it probably can't be called a nucleomorph because it shows no sign of genome reduction, and might have even been expanded. Diatoms have been engulfed by dinoflagellates at least three times. The diatom endosymbiont is bounded by a single membrane, inside it are chloroplasts with four membranes. Like the diatom endosymbiont's diatom ancestor, the chloroplasts have triplet thylakoids and pyrenoids.
|
|
Chrysophyte populations peaked in April, while Dinoflagellates (Pyrrhophyta) and green algae (Chlorophyta) both peaked in June. The summer was then dominated by cyanobacteria (Cyanophyta), with an increase in Cryptomonad (Cryptophyta) abundance by October. Brownie Lake is inhabited by methanogenic archaea in the anoxic bottom waters, and a population of methanotrophic bacteria at the chemocline, which consume methane diffusing out of the anoxic portion of the lake.
|
|
Syndinium are notable for their mitotic nuclear division mechanisms involving nuclear membrane attached kinetochores and associated V-shaped chromosomes pushed away from each other by axially aligned microtubules.Kubai, D. F., Ris, H. 1974: An Unusual Mitotic Mechanism in the Parasitic Protozoan Syndinium sp. Journal of Cell Biology, 60, Rockefeller University Press. This method of nuclear division, while not altogether rare within dinoflagellates, were first studied in Syndinium.
|
|
Most of the Palynomorphs found on the Toarcian strata are connected with the ones found on the Sorthat Formation. With nearly 40 m thick, the upper section of the formation is composed mostly by a series of cross-bedded, cross-laminated, wave-rippled and bioturbated sand and heteroliths with sporadic Syneresis cracks, Pyrite nodules, the ichnofossils Planolites isp. and Teichichnus isp. and brackish-marine palynomorphs, mostly dinoflagellates.
|
|
The first species of Coccidinium that were described were C. legeri and C. duboscquii, found in the cytoplasm of dinoflagellates in brackish waters near Sète, France. They have been noted as lacking photosynthetic stages in their life cycles, which is to be expected given their parasitic nature. Sexual reproduction has been observed “time and again” in C. mesnili as stated by Chatton and Biecheler.
|
|
Goniastrea retiformis is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
It can also live in waters as cold as and as warm as . Other environmental conditions and their ranges include salinity (18–36 pps), oxygen (1–9 mL/L), nitrate (0–45 μmol/L), phosphate (0–3 μmol/L) and silicate (1–181 μmol/L) levels. Calanus finmarchicus primarily feeds on different forms of phytoplankton. This includes diatoms, dinoflagellates, ciliates, and other photosynthetic marine organisms.
|
|
Dinocysts or dinoflagellate cysts are typically 15 to 100 µm in diameter and produced by around 15–20% of living dinoflagellates as a dormant, zygotic stage of their lifecycle, which can accumulate in the sediments as microfossils. Organic-walled dinocysts are often resistant and made out of dinosporin. There are also calcareous dinoflagellate cysts and siliceous dinoflagellate cysts. Many books provide overviews on dinocysts.
|
|
Because C. adunca filter feeds, it uses cilia to bring the small organisms over its gills where it filters out the bacteria from the water using mucus made by the gill cells. Once caught by the mucus, the cilia, known as ciliary action, carries the organisms to the mouth along the dorsal surface. The organisms that C. adunca filters for are diatoms, dinoflagellates, phytoplankton, bacteria, etc.
|
|
Oda et al. found that differences in the production of ROS were due to the size of the cell. By comparing four species of flagellates, they showed that the larger species Ichatonella produced the most superoxide and hydrogen peroxide per cell than Heterosigma akashiwo, Olisthodiscus luteus, and Fibrocapsa japonica. In a comparison of 37 species of marine microalgae, including dinoflagellates, rhaphidophytes, and chlorophytes, Marshall et al.
|
|
Palynomorphs, which are organic- walled microfossils that include the spores and pollen of ancient plants, can be particularly useful for determining what the ancient climate was like. Another variety of palynomorphs called dinoflagellates can be as valuable for age determinations as foraminifera. Invertebrate fossils found in the Great Valley Sequence include various bivalves, gastropods, and even coiled ammonites.Bailey, Irwin and Jones (1965), pp. 115–123.
|
|
Foams can form following the degradation of harmful algal blooms (HABs). These are primarily composed of algal species, but can also consist of dinoflagellates and cyanobacteria. Biomass from algae in the bloom is integrated into sea foam in the sea surface microlayer. When the impacted sea foam breaks down, toxins from the algae are released into the air causing respiratory issues and occasionally initiating asthma attacks.
|
|
Lobophyllia ishigakiensis is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Micromussa regularis is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
This coral is a zooxanthellate species, which contains single-celled dinoflagellates in its tissues. These are photosynthetic and provide the coral with 70% to 95% of its energy needs. The rest of its needs are supplied by the polyps which expand at night and trap passing plankton. This is a small and relatively short-lived species but new young colonies are frequently to be found.
|
|
Acanthastrea rotundoflora is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Anthopleura ballii contains unicellular dinoflagellates living inside the tissues. These are species of Symbiodinium and are commonly known as zooxanthellae. They are photosynthetic organisms and provide the sea anemone with nutrients and energy, the products of photosynthesis. This type of arrangement is common in corals and sea anemones in nutrient-deficient tropical seas but is rare in temperate waters, which tend to be nutrient-rich.
|
|
Acropora florida is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
The coenosteum (the coral's stony skeleton) is covered with tiny spines. This is a zooxanthellate species of coral, the tissues of which harbour single-celled dinoflagellates living in symbiosis with the coral and providing it with nourishment. The polyps expand to feed at night and are retracted during the daytime. This coral is pale brown in colour, sometimes with pinkish bases to the branches.
|
|
Acropora lovelli is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Acropora microphthalma is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Alveopora allingi is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Growing at San Salvador Island, Bahamas Some of the polyps of Millepora complanata are dactylozooids with hair-like processes and stinging cells that detect the presence of zooplankton and help entrap it. Other polyps are gastrozooids and their chief function is the ingestion of food for the colony. Copepods form the main part of the diet. The soft tissues of M. complanata contain zooxanthellae, symbiotic photosynthetic dinoflagellates.
|
|
Adding urea to the ocean can cause phytoplankton blooms that serve as a food source for zooplankton and in turn feed for fish. This may increase fish catches. However, if cyanobacteria and dinoflagellates dominate phytoplankton assemblages that are considered poor quality food for fish then the increase in fish quantity may not be large. Some evidence links iron fertilization from volcanic eruptions to increased fisheries production.
|
|
Some of these (such as dinoflagellates) are also phytoplankton; the distinction between plants and animals often breaks down in very small organisms. Other zooplankton include cnidarians, ctenophores, chaetognaths, molluscs, arthropods, urochordates, and annelids such as polychaetes. Many larger animals begin their life as zooplankton before they become large enough to take their familiar forms. Two examples are fish larvae and sea stars (also called starfish).
|
|
Montipora aequituberculata is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Anthelia glauca is a zooxanthellate soft coral; embedded within its tissues are single-celled symbiotic dinoflagellates which provide their host with the products of photosynthesis such as organic carbon and nitrogen compounds. The polyps supplement this with the planktonic particles caught by the widely-spread tentacles. During the day the polyps sway and contract in a rhythmic fashion. Colonies of A. glauca are either male or female.
|
|
Heterocapsa circularisquama is a species of dinoflagellates notable for the production of a biotoxin affecting marine fauna. It is known to produce large red tides off western Japan, causing high bivalve mortality, particularly pearl oysters. It is very similar to Heterocapsa illdefina, however H. circularisquama carries six radiating ridges on its circular basal plate, and its scales have longer spines, among other subtle differences in morphology.
|
|
Alveopora fenestrata is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Alveopora spongiosa is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Alveopora verrilliana is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Turbinaria reniformis is a zooxanthellate coral. It lives in symbiosis with unicellular dinoflagellates known as zooxanthellae. These photosynthetic protists provide their host coral with nutrients and energy, but in order to benefit from this, the coral needs to live in relatively shallow water and in a brightly lit position. In conditions of thermal stress, the coral may expel the zooxanthellae, become bleached and ultimately die.
|
|
Turbinaria frondens, commonly known as disc coral, is a species of colonial stony coral in the family Dendrophylliidae. It is native to the Indo-Pacific region. It is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues. This is a common species throughout its wide range and the International Union for Conservation of Nature has rated its conservation status as being of "least concern".
|
|
Turbinaria irregularis, commonly known as disc coral, is a species of colonial stony coral in the family Dendrophylliidae. It is native to the Indo-Pacific region and is rated as a least-concern species. It is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues. It was described by Bernard in 1896 and is found at depths of in shallow rocky areas and reefs.
|
|
Acanthastrea brevis is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
When herbivores eat seagrass leaves they ingest algal epiphytes and toxic dinoflagellates that live on the seagrass leaves.Kitting CL, Fry B and Morgan MD (1984) "Detection of inconspicuous epiphytic algae supporting food webs in seagrass meadows" Oecologia, 62 :145–149. The German anthropologist Christian Rätsch thinks that dreamfish might contain the hallucinogen DMT.Pickover, Clifford A (2005) [ Sex, Drugs, Einstein, and Elves] Chapter 1, page 9, Smart Publications. .
|
|
Red tide in a harbor, Japan Red tide is a common name for algal blooms, which are large concentrations of aquatic microorganisms, such as protozoans and unicellular algae (e.g. dinoflagellates and diatoms). The upwelling of nutrients from the sea floor, often following massive storms, provides for the algae and triggers bloom events. Harmful algal blooms can occur worldwide, and natural cycles can vary regionally.
|
|
Arguments put forwards by Obut (1973) proposed that the organisms were one- celled "plants" similar to the dinoflagellates, which would now be grouped into the Alveolata. However, as mentioned previously, spines and appendages are attached from the exterior of the vessel: only animals have the cellular machinery necessary to perform such a feat. Further, no analogy for the cocoon envelope can be found in this kingdom.
|
|
Corals often form symbiosis with other organisms, particularly photosynthetic dinoflagellates. In this symbiosis, the coral provides shelter and the other organism provides nutrients to the coral, including oxygen. Fig. 15. Cross section of a nematode. The roundworms (Nematoda), flatworms (Platyhelminthes), and many other small invertebrate animals living in aquatic or otherwise wet habitats do not have a dedicated gas-exchange surface or circulatory system.
|
|
They are armed with cnidocytes (stinging cells). In many species, additional nourishment comes from a symbiotic relationship with single-celled dinoflagellates, zooxanthellae or with green algae, zoochlorellae, that live within the cells. Some species of sea anemone live in association with hermit crabs, small fish or other animals to their mutual benefit. Sea anemones breed by liberating sperm and eggs through the mouth into the sea.
|
|
P. daedalea with polyps expanded The polyps of P. daedalea expand at night to catch planktonic particles floating by. However, this coral obtains most of its nourishment from the dinoflagellates known as zooxanthellae it houses within its tissues. These provide organic carbon and nitrogen, the products of photosynthesis, to their host. To benefit from this symbiotic arrangement, P. daedalea needs to grow in shallow, sunlit environments.
|
|
Oulophyllia crispa is a zooxanthellate coral that has unicellular dinoflagellates embedded in its soft, transparent tissues. These use sunlight to create organic carbon molecules that the coral can use. As this coral grows, the polyps do not divide completely, resulting in several mouths being present in each large corallite. Boring sponges (Cliona spp.), polychaete worms and bivalve molluscs bore holes into colonies of this coral, causing bioerosion.
|
|
Astroides calycularis is nocturnal, the polyps remaining retracted back into their calices during the day. When expanded at night, they feed on zooplankton, small fish and perhaps bacteria. This coral is azooxanthellate, meaning it does not contain symbiotic dinoflagellates in its tissues as do many species of coral. A. calycularis colonies are gonochoristic with all the polyps in a colony being of the same sex.
|
|
Karlodinium decipiens is a species of unarmored dinoflagellates from the genus Karlodinium. It was first isolated from the Australian region of the Southern Ocean, but has a widespread distribution, through the Southern Ocean to the Tasman Sea, to the coast of Spain. It is large-sized and is characterized by having a helicoidal chloroplast arrangement and a big central nucleus. It is considered potentially ichthyotoxic.
|
|
Homophyllia bowerbanki is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Acanthastrea brevis is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the tentacles of the polyps.
|
|
Most polykrikoids are planktonic, although one species - P. lebourae - is benthic. The family includes photosynthetic, heterotrophic, and mixotrophic species. Some species, such as P. kofoidii, are of scientific interest due to their status as predators of other dinoflagellates, a behavior that is significant in the regulation of algal blooms. Others, such as Ph. hartmanii (which has been reclassified P. hartmanii) are themselves causes of ichthyotoxic algal blooms.
|
|
It is now known that in many pathogenic bacteria, there is delayed production of toxins, which serve to greatly augment their pathogenicity, this is similar to what happens for luciferase proteins. By curtailing their toxin output until the bacterial populations are substantial, these bacteria can generate massive quantities of toxin quickly and thereby swamp the defences of the host. Luminescent Dinoflagellates: In early 1954 at Northwestern University, Hastings, his students and colleagues studied cellular and molecular aspects of bioluminescence in dinoflagellates [especially Lingulodinium polyedrum (formerly Gonyaulax polyedra)]. They elucidated the structures of the luciferins and luciferases,Hastings, J.W. and Sweeney, B.M. (1957), Sweeney, B.M. and Hastings, J.W. (1957) the organization and regulation of their associated genes, temporal control mechanisms,Fogel, M. and Hastings, J.W. (1972), McMurry, L. and Hastings, J.W. (1972) and the actual sub-cellular identity and location of the light emitting elements, which they termed scintillons.
|
|
Hence, mixotrophy can cause uncoupling between nutrient concentrations and the abundance of mixotrophic dinoflagellates in natural environments. Red tides are a type of harmful algal bloom (HABs); both are the result of massive proliferation of algae that result in very high concentrations of cells that visibly colour the water. The very high levels of biomass in Red Tides or HABs can have direct toxic effects through the release of toxic compounds or indirect effects through oxygen depletion on mammals, fish, shellfish, and humans. PSP (Paralytic Shellfish Poisoning) is one example of a toxin that is produced by dinoflagellates that can have lethal consequences if contaminated shellfish are ingested; the toxin is a neuro- inhibitor that is concentrated in the flesh of bivalves and molluscs that have fed on toxic algae The toxin concentrations can cause harmful and even deadly effects on humans and marine mammal populations that feed on contaminated shellfish.
|
|
Dolphins also known as a Dolphins in Phosphorescent Sea is a woodcut print by the Dutch artist M. C. Escher. This work was first printed in February, 1923. Escher had been fascinated by the glowing outlines of ocean waves breaking at night and this image depicts the outlines made by a school of dolphins swimming and breaching ahead of the bow of a ship. The glow was created by bioluminescent dinoflagellates.
|
|
This has been observed in aquatic yeasts, cyanobacteria, marine dinoflagellates and some Antarctic diatoms. When MAAs absorb UV light the energy is dissipated as heat. UV-B photoreceptors have been identified in cyanobacteria as the molecules responsible for the UV light induced responses, including synthesis of MAAs. An MAA known as palythine, derived from seaweed, has been found to protect human skin cells from UV radiation even in low concentrations.
|
|
Carlgren and F. Pax have described more species than all other authors combined) use Zoantharia, and most recent specialists on the orderSinniger F., Montoya-Burgos J.I., Chevaldonne P., Pawlowski J. (2005) Phylogeny of the order Zoantharia (Anthozoa, Hexacorallia) based on the mitochondrial ribosomal genes. Mar. Biol. 147 (5): 1121-1128.Reimer J.D., Takishita K., Maruyama T. (2006) Molecular identification of symbiotic dinoflagellates (Symbiodinium spp.) from Palythoa spp. (Anthozoa: Hexacorallia) in Japan.
|
|
However, endosymbiontic Zooxanthellae inhabit a great number of other invertebrates and protists, for example many sea anemones, jellyfish, nudibranchs, the giant clam Tridacna, and several species of radiolarians and foraminiferans. Many extant dinoflagellates are parasites (here defined as organisms that eat their prey from the inside, i.e. endoparasites, or that remain attached to their prey for longer periods of time, i.e. ectoparasites). They can parasitize animal or protist hosts.
|
|
Commonly used zone fossils (from the Cambrian onwards). A great variety of species can be used in establishing biozonation. Graptolites and ammonites are some of the most useful as zone fossils, as they preserve well and often have relatively short biozones. Microfossils, such as dinoflagellates, foraminaferans, or plant pollen are also good candidates because they tend to be present even in very small samples and evolve relatively rapidly.
|
|
Plerogyra sinuosa is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues including the walls of the vesicles. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. Its remaining needs are met by the planktonic organisms caught by the polyps.
|
|
This coral is some shade of grey, pink, violet or yellowish-brown, sometimes a uniform colour or sometimes with contrasting regions. L. hemprichii is a zooxanthellate coral, having single-celled photosynthesizing organisms known as dinoflagellates living within the tissues. Photosynthesis of these protists provides the coral with nutrients. The thick, fleshy polyps can retract back into the corallite cups in which they sit or extend their tentacles to feed.
|
|
The polyps remain retracted in the skeleton during the day but extend at night to feed. The tentacles search for zooplankton and small invertebrates which are transferred to the mouth. Another major source of energy is the result of the symbiotic dinoflagellates which live within the coenenchyme and which produce nutrients by photosynthesis. The coral benefits from the carbohydrates produced and the algae use the coral's nitrogenous waste products.
|
|
Ceratium hirundinella. Ceratium species are characterized by their horns and two flagella located in the transverse and longitudinal positions. Ceratium tripos is recognisable by its U-shaped horns Ceratium species belong to the group of dinoflagellates known as dinophysiales, meaning they contain armored plates. They contain a pellicle, which is a shell, that is made from the cell membrane and vesicles; vesicles are composed of cross-linked cellulose, forming the plates.
|
|
The pellicle divides into two structures known as the epicone and hypocone that lie above and below the transverse groove, the cingulum, respectively. Two rows of plates surround the epicone and hypocone in a particular pattern that may be inherited by offspring. These patterns may be used to identify groups of dinoflagellates or even species of Ceratium. The plates contain expanded horns, which is a characteristic feature of Ceratium species.
|
|
There are four forms of RuBisCO (Form I, II, III, and IV), with Form I being the most abundantly used form. Form I is used extensively by higher plants, eukaryotic algae, cyanobacteria, and proteobacteria. Form II is also used but much less widespread, and can be found in some species of Proteobacteria and in dinoflagellates. RuBisCOs from different photosynthetic organisms display varying abilities to distinguish between CO2 and O2.
|
|
Stratigraphic sections of rock from this period reveal numerous other changes. Fossil records for many organisms show major turnovers. For example, in the marine realm, a mass extinction of benthic foraminifera, a global expansion of subtropical dinoflagellates, and an appearance of excursion, planktic foraminifera and calcareous nanofossils all occurred during the beginning stages of PETM. On land, modern mammal orders (including primates ) suddenly appear in Europe and in North America.
|
|
In the ocean, this allows the larvae to disperse widely and have greater chances of finding optimum sites for settling. The polyps of Micromussa lordhowensis are large and fleshy. When the tentacles are extended, they search for zooplankton and small invertebrates which are transferred to the mouth when caught. Another source of energy is the symbiotic dinoflagellates, microscopic algae that live within the coral's tissues and which produce nutrients by photosynthesis.
|
|
In contrast, most other algae (e.g. brown algae/diatoms, haptophytes, dinoflagellates, and euglenids) not only have different pigments but also have chloroplasts with three or four surrounding membranes. They are not close relatives of the Archaeplastida, presumably having acquired chloroplasts separately from ingested or symbiotic green and red algae. They are thus not included in even the broadest modern definition of the plant kingdom, although they were in the past.
|
|
Oodinium, a genus of parasitic dinoflagellates, causes velvet disease in fish Velvet disease (also called gold-dust, rust and coral disease) is a fish disease caused by dinoflagellate parasites of the genus Piscinoodinium, specifically Amyloodinium in marine fish, and Oodinium in freshwater fish. The disease gives infected organisms a dusty, brownish-gold color. The disease occurs most commonly in tropical fish, and to a lesser extent, marine aquaria.
|
|
Locations of coral reefs around the world Many corals in the order Scleractinia are hermatypic, meaning that they are involved in building reefs. Most such corals obtain some of their energy from zooxanthellae in the genus Symbiodinium. These are symbiotic photosynthetic dinoflagellates which require sunlight; reef-forming corals are therefore found mainly in shallow water. They secrete calcium carbonate to form hard skeletons that become the framework of the reef.
|
|
In oligotrophic oceanic regions such as the Sargasso Sea or the South Pacific Gyre, phytoplankton is dominated by the small sized cells, called picoplankton and nanoplankton (also referred to as picoflagellates and nanoflagellates), mostly composed of cyanobacteria (Prochlorococcus, Synechococcus) and picoeucaryotes such as Micromonas. Within more productive ecosystems, dominated by upwelling or high terrestrial inputs, larger dinoflagellates are the more dominant phytoplankton and reflect a larger portion of the biomass.
|
|
During summers phytoplankton are dominated by cyanobacteria and occasionally diatoms, most commonly Aphanizomenon cf gracile but also Pseudanabaena limnetica, Planktolyngbya sp. and various species of Anabaena, of whom only Aphanizomenon is potentially poisonous and Anabaena frequently causes algal bloom. Carapace flagellates such as Ceratium hirundinella and various dinoflagellates, are few but important to the lake's biomass. Various rotifers are common zooplankton but cyclopoid copepods can also be found.
|
|
Under starvation conditions the planozygote disassembled into two 2-zooid with one lacking nucleus, but further fate was not examined. Under culture conditions most organisms undergone meiosis and directly entered vegetative cycle. Very few planozygotes went through a resting cyst stage. The cyst stage persisted for 1 month, which is considered as a relatively short period in comparison to other dinoflagellates, which obligate dormancy period may reach up to 6 month.
|
|
There are no thylakoid membranes invading the pyrenoid, which is unlike other symbiotic dinoflagellates. The lipid components of thylakoids include the galactolipids (monogalactosyl-diglycerides, digalactosyl-diglycerides), the sulpholipid, (sulphoquinovosyl-diglyceride), phosphatidyl glycerol, and phosphatidyl choline. Associated with these are various fatty acids. The light-harvesting and reaction centre components in the thylakoid membrane include a water-soluble peridinin-chlorophyll (chl.) a-protein complex (PCP), and a membrane-bound chl. a-chl.
|
|
Desmoschisis is asexual reproduction in dinoflagellates which the parent cell divides to produce two daughter cells, each daughter retaining half the parent theca, at least temporarily. During desmoschisis, the theca undergoes fission along a predetermined suture between thecal plates. The fission suture is oblique, usually from the top left to the bottom right (as in oblique binary fission).FENSOME R.A., TAYLOR F.J.R., NORRIS G., SARJEANT W.A.S., WHARTON D.I. & WILLIAMS G.L. 1993.
|
|
Pfiesteria presumably kills fish via releasing a toxin into the water to paralyze its prey. This hypothesis has been questioned as no toxin could be isolated and no toxicity was observed in some experiments. However, toxicity appears to depend on the strains and assays used. Polymerase chain reaction- analyses suggested that the organism lacks the DNA for polyketide synthesis, the type of toxins associated with most toxic dinoflagellates.
|
|
A variety of organisms regulate their light production using different luciferases in a variety of light-emitting reactions. The majority of studied luciferases have been found in animals, including fireflies, and many marine animals such as copepods, jellyfish, and the sea pansy. However, luciferases have been studied in luminous fungi, like the Jack-O-Lantern mushroom, as well as examples in other kingdoms including luminous bacteria, and dinoflagellates.
|
|
Deuterium has been shown to lengthen the period of oscillation of the circadian clock when dosed in rats, hamsters, and Gonyaulax dinoflagellates. In rats, chronic intake of 25% D2O disrupts circadian rhythmicity by lengthening the circadian period of suprachiasmatic nucleus-dependent rhythms in the brain's hypothalamus. Experiments in hamsters also support the theory that deuterium acts directly on the suprachiasmatic nucleus to lengthen the free-running circadian period.
|
|
Another similarity is that many apicomplexan cells contain a single plastid, called the apicoplast, surrounded by either three or four membranes. Its functions are thought to include tasks such as lipid and heme biosynthesis, and it appears to be necessary for survival. In general, plastids are considered to have a common origin with the chloroplasts of dinoflagellates, and evidence points to an origin from red algae rather than green.
|
|
Alveopora viridis is a zooxanthellate species of coral. It obtains most of its nutritional needs from the symbiotic dinoflagellates that live inside its soft tissues. These photosynthetic organisms provide the coral with organic carbon and nitrogen, sometimes providing up to 90% of their host's energy needs for metabolism and growth. The remaining needs of the colony are met from the assimilation of planktonic organisms caught by the tentacles of the polyps.
|
|
Pseudopfiesteria shumwayae (formerly placed in the genus Pfiesteria; see 'Taxonomy' section below) is a species of heterotrophic dinoflagellates in the genus Pseudopfiesteria. It was first characterized in North Carolina in 2000. It can acquire the ability for photosynthesis through eating green algae and retaining their chloroplasts. It can also turn predatory and toxic strains of Pseudopfiesteria shumwayae have been implicated in fish kills around the US east coast.
|
|
Paralytic shellfish poisoning (PSP) is primarily caused by the consumption of bivalves that have accumulated toxins by feeding on toxic dinoflagellates, single-celled protists found naturally in the sea and inland waters. Saxitoxin is the most virulent of these. In mild cases, PSP causes tingling, numbness, sickness and diarrhoea. In more severe cases, the muscles of the chest wall may be affected leading to paralysis and even death.
|
|
It consists of a central, viscous granular proteinaceous core surrounded by tightly packed minute plates of starch. There is substantial diversity in pyrenoid morphology and ultrastructure between algal species. In the unicellular red alga Porphyridium purpureum and in the green alga Chlamydomonas reinhardtii, there is a single highly conspicuous pyrenoid in a single chloroplast, visible using light microscopy. By contrast, in diatoms and dinoflagellates, there can be multiple pyrenoids.
|
|
Long exposure image of bioluminescence of N. scintillans in the yacht port of Zeebrugge, Belgium N. scintillans is a heterotroph that engulfs, by phagocytosis, food which includes plankton, diatoms, other dinoflagellates, fish eggs, and bacteria. Diatoms are often found in the vacuoles within these single-celled creatures. These green nonfeeding symbioses can grow photoautotrophically for generations. Diatoms of Thalassiosira have been noted as a favored food source of these organisms.
|
|
Gambierdiscus polynesiensis is a species of toxic (ciguatoxin- and maitotoxin- like toxicity) dinoflagellates. It is 68–85 μm long and 64–75 μm wide dorsoventrally and its surface is smooth. It is identified by a large triangular apical pore plate, a narrow fish-hook opening surrounded by 38 round pores, and a large, broad posterior intercalary plate. Its first plate occupies 60% of the width of the hypotheca.
|
|
Cell division in eukaryote is much more complicated than procaryote. Depending upon chromosomal number reduced or not; Eukaryotic cell divisions can be classified as Mitosis (equational division) and Meiosis (reductional division). A premitive form of cell division is also found which is called amitosis. The amitotic or mitotic cell division is more atypical and diverse in the various groups of organisms such as protists (namely diatoms, dinoflagellates etc) and fungi.
|
|
Paramecium tetraurelia, a ciliate, with discharged trichocysts (artificially colored in blue). A trichocyst is an organelle found in certain ciliates and dinoflagellates. A trichocyst can be found in tetrahymena and along cila pathways of several metabolic systems. It is also a structure in the cortex of certain ciliate and flagellate protozoans consisting of a cavity and long, thin threads that can be ejected in response to certain stimuli.
|
|
Michael, Scott W. (November 2006), Aquascaping reef habitats, Aquarium Fish Magazine, pp. 66-73. Lighting plays a particularly significant role in the reef aquascape. Many corals, as well as tridacnid clams, contain symbiotic fluorescent algae-like dinoflagellates called zooxanthellae.. By providing intense lighting supplemented in the ultraviolet wavelengths, reef aquarists not only support the health of these invertebrates, but also elicit particularly bright colors emitted by the fluorescent microorganisms..
|
|
These symptoms have been shown to be the result of aerosols containing the dinoflagellates, which had been whipped off the surface of the water by winds, and carried ashore to the detriment of public health. In a separate incident, a mass mortality of the sea urchin Evechinus chloroticus occurred in New Zealand in 2004, associated with a bloom of O. siamensis, although in this instance there were no human casualties.
|
|
The peridinin-chlorophyll-protein complex (PCP or PerCP) is a soluble molecular complex consisting of the peridinin-chlorophyll a-protein bound to peridinin, chlorophyll, and lipids. The peridinin molecules absorb light in the blue-green wavelengths (470 to 550 nm) and transfer energy to the chlorophyll molecules with extremely high efficiency. PCP complexes are found in many photosynthetic dinoflagellates, in which they may be the primary light-harvesting complexes.
|
|
Seriatopora aculeata is a colonial species and can grow to a diameter of about . It is a zooxanthellate species containing symbiotic dinoflagellates in its tissues. It is similar in appearance to Seriatopora hystrix and Seriatopora stellata but the branches are stout and tend to be fused in small clumps. The corallites are scattered over the surface of the branches and the polyps are often expanded during the day.
|
|
Organisms that derive their nutrition in this manner include Oxyrrhis marina, which feeds phagocytically on phytoplankton, Polykrikos kofoidii, which feeds on several species of red- tide and/or toxic dinoflagellates, Ceratium furca, which is primarily photosynthetic but also capable of ingesting other protists such as ciliates, Cochlodinium polykrikoides, which feeds on phytoplankton, Gambierdiscus toxicus, which feeds on algae and produces a toxin that causes ciguatera fish poisoning when ingested, and Pfiesteria and related species such as Luciella masanensis, which feed on diverse prey including fish skin and human blood cells. Predatory dinoflagellates can kill their prey by releasing toxins or phagocytize small prey directly.Wiley Interscience Some predatory algae have evolved extreme survival strategies. For example, Oxyrrhis marina can turn cannibalistic on its own species when no suitable non-self prey is available, and Pfiesteria and related species have been discovered to kill and feed on fish, and since have been (mistakenly) referred to as carnivorous "algae" by the media.
|
|
What makes Haplozoon unique among dinoflagellates is their functional multicellularity. H. axiothellae cells are composed of a series of compartments, which give them the appearance of multicellularity. At minimum all Haplozoon species consist of a single row of compartments, with mature cells of some species containing two or more rows of compartments at the posterior of their cell. These compartments are specialized for different functions, such as host attachment, feeding and reproduction.
|
|
9:23–36 Many zoanthids (in particular the genera Epizoanthus and Parazoanthus) are often found growing on other marine invertebrates. Often in zooxanthellate genera such as Zoanthus and Palythoa there are a large number of different morphs of the same or similar species. Such zooxanthellate genera derive a large portion of their energy requirements from symbiotic dinoflagellates of the genus Symbiodinium (zooxanthellae), similar to many corals, anemones, and some other marine invertebrates.
|
|
While hypotheca of some Histioneis can be embedded in mucus, Ornithocercus species have not been observed with a hypotheca associated mucus layer. The elaborate morphology of the genus is thought to be a disadvantage during active swimming . The lists have been posited to function in stability and creating feeding currents. The typical flagellar propulsion of dinoflagellates would be resisted by their morphology and the differences in list development between sides could act as a keel.
|
|
Dinoflagellates are algae and according to recent phylogeny they are sister groups to ciliates and apicomplexans. Most phylogenetic studies are done with sequences of both large and small ribosomal subunits and do not always agree with morphological studies based on thecal plates. Sequencing of the small subunit of the ribosome of Dinophysis revealed very similar sequences in three species of Dinophysis (D. acuminata, D. norvegica and D. acuta), suggesting that photosynthetic Dinophysis have evolved recently.
|
|
It is thermostable, and treatment with boiling water does not remove its toxicity. It remains stable in aqueous solutions for prolonged periods but rapidly decomposes and loses its toxicity in acidic or alkaline solutions. It has multiple analogues with a similar structure like ostreocin-D, mascarenotoxin-A and -B. Palytoxin occurs at least in tropics and subtropics where it is made by Palythoa corals and Ostreopsis dinoflagellates, or possibly by bacteria occurring in these organisms.
|
|
Both iron fertilization and ocean nourishment are techniques that boost the primary production of algae in the ocean, which consumes massive amounts of nutrients and CO2. It is this same consumption of nutrients that algae perform in an aquarium or pond. Algae scrubbers are used in both saltwater and freshwater, and remove nuisance algae of multiple types: cyano or slime, bubble, hair, Chaetomorpha, Caulerpa, and film algae, as well as dinoflagellates and Aiptasia.
|
|
The Gymnodiniales are an order of dinoflagellates, of the class Dinophyceae. Members of the order are known as gymnodinioid or gymnodinoid (terms that can also refer to any organism of similar morphology). They are athecate, or lacking an armored exterior, and as a result are relatively difficult to study because specimens are easily damaged. Many species are part of the marine plankton and are of interest primarily due to being found in algal blooms.
|
|
Zooxanthellae is a colloquial term for single-celled dinoflagellates that are able to live in symbiosis with diverse marine invertebrates including demosponges, corals, jellyfish, and nudibranchs. Most known zooxanthellae are in the family Symbiodiniaceae, but some are known from the genus Amphidinium, and other taxa, as yet unidentified, may have similar endosymbiont affinities. The true Zooxanthella K.brandt is a mutualist of the radiolarian Collozoum inerme (Joh.Müll., 1856) and systematically placed in Peridiniales.
|
|
Alexandrium catenella is a species of dinoflagellates. It is among the group of Alexandrium species that produce toxins that cause paralytic shellfish poisoning, and is a cause of red tide. These organisms have been found in the west coast of North America, Japan, Australia, and parts of South Africa. Alexandrium catenella can occur in single cells (similar to A. fundyense), but more often they are seen in short chains of 2, 4, or 8 cells.
|
|
Wading or swimming among feeding bluefish schools can be dangerous.Lovko, Vincent J. (2008) Pathogenicity of the Purportedly Toxic Dinoflagellates Pfiesteria Piscicida and Pseudopfiesteria Shumwayae and Related Species ProQuest. . In July 2006, a seven-year-old girl was attacked on a beach, near the Spanish town of Alicante, allegedly by a bluefish. In New Jersey, the large beachfeeder schools are very common and lifeguards report never having seen bluefish bite bathers in their entire careers.
|
|
The striated surgeonfish, Ctenochaetus striatus, is a species of marine fish in the family Acanthuridae. The striated surgeonfish can reach a maximum size of 24 cm in length, but its common size is observed to be around 18 cm. The striated surgeonfish is one of the few herbivorous fishes which are occasionally toxic. Ciguatera poisoning is caused by the accumulation of a toxin produced by certain microscopic dinoflagellates which it ingests while feeding on algae.
|
|
Although previous endosymbiotic events resulted in the increase in the number of membranes, tertiary plastids can have 3-4 membranes. The most largely studied tertiary plastids are known as peridinin and found in dinoflagellates. Peridinin is believed to have been derived from a red algae secondary endosymbiosis. Consistent with our previous rules for reduction in genome size, and incorporation of genes into the host genome, peridinin genome consists of about 14 genes.
|
|
Gambierdiscus belizeanus is a species of dinoflagellates, first found in Belize. G. belizeanus cells are 53–67 pm long, 54–63 μm wide, and 92–98 μm in dorsoventral depth. Cells are deeply areolated, ellipsoid in apical view, and compressed anteroposteriorly. Its cells are identified by their long, narrow, pentagonal, posterior intercalary plate (1p) wedged between the wide postcingular plates 2″’and 4″; 1p occupies approximately 20% of the width of the hypotheca.
|
|
Transverse flagellum has the lateral projections, mastigonemes, and striated strand common to other dinoflagellates. Often Polykrikos have half the number of nuclei than zooids, and each pair of zooids shares a nucleus. Within the group there is some variation in which organelles are presented, but trichocysts, nematocysts, taeniocysts, mucocysts and plastids have been observed from different members within the taxon. Cytoplasm of Polykrikos is characterized by numerous rough endoplasmic reticulum nets, Golgi complexes and vacuoles.
|
|
When a eukaryote engulfs a red or a green alga and retains the algal plastid, that plastid is typically surrounded by more than two membranes. In some cases these plastids may be reduced in their metabolic and/or photosynthetic capacity. Algae with complex plastids derived by secondary endosymbiosis of a red alga include the heterokonts, haptophytes, cryptomonads, and most dinoflagellates (= rhodoplasts). Those that endosymbiosed a green alga include the euglenids and chlorarachniophytes (= chloroplasts).
|
|
Bacterial luciferase consists of two subunits, depicted by the red and blue regions.The chemical reaction that is responsible for bio-luminescence is catalyzed by the enzyme luciferase. In the presence of oxygen, luciferase catalyzes the oxidation of an organic molecule called luciferin. Though bio-luminescence across a diverse range of organisms such as bacteria, insects, and dinoflagellates function in this general manner (utilizing luciferase and luciferin), there are different types of luciferin-luciferase systems.
|
|
Estimated annual economic impacts from harmful algal blooms (HABs) in the United States. Woods Hole Oceanographic Institution Technical Report. WHOI-2000-11. p. 97. Enzyme electrophoretic dataHAYHOME, B.A., ANDERSON, D.M., KULIS, D.M. & WHITTEN, D.J. 1989 Variation among congeneric dinoflagellates from the northeastern United States and Canada. I. Enzyme electrophoresis; Marine Biology, 101: 427-435. and RNA genetic analysisSCHOLIN, C.A. & ANDERSON, D.M. 1994 Identification of group- and strain-specific genetic markers for globally distributed Alexandrium (Dinophyceae).
|
|
Turbinaria heronensis, commonly known as disc coral, is a species of colonial stony coral in the family Dendrophylliidae. It is native to the Indo-Pacific region where it occurs in shallow water in Indonesia, Malaysia, Papua New Guinea, Fiji, the Philippines and Australia. It is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues. It is an uncommon species and the International Union for Conservation of Nature (IUCN) has rated it as "vulnerable".
|
|
The growth and persistence of an algal bloom depends on wind direction and strength, temperature, nutrients, and salinity. Red tide species can be found in oceans, bays, and estuaries, but they cannot thrive in freshwater environments. Certain species of phytoplankton and dinoflagellates like 'Gonyaulax' found in red tides contain photosynthetic pigments that vary in color from brown to red. These organisms undergo such rapid multiplication that they make the sea appear red.
|
|
Feeding habits of Limacina are characterized by actively feeding on planktonic organisms such as bacteria, small crustaceans, gastropod larvae, dinoflagellates and diatoms. These prey items become entangled in a mucosal web (up to 5 cm wide) excreted by the animal that is, in turn, eaten along with the prey items. This net also provides positive buoyancy. Ciliated posterior footlobes and lateral footlobes move food collected by the mucosal web into the mouth.
|
|
Mixotrophs can grow in low nutrient (more stable) environments and become dominant members of planktonic communities. Harmful algal blooms (HABs) can be caused by increased stability or increases in nutrients due to acidification and climate change, as well. This can have large impacts on the food chain and pose harmful effects to humans and their food sources through harmful blooms of dinoflagellates and other taxa, and lead to paralytic shellfish poisoning, for example.
|
|
However, the importance of competition is also demonstrated by the production of phycotoxins that negatively impact other phytoplankton species. Flagellates (especially dinoflagellates) are the principle producers of phycotoxins; however, there are known toxigenic diatoms, cyanobacteria, prymnesiophytes, and raphidophytes. Because many of these allelochemicals are large and energetically expensive to produce, they are synthesized in small quantities. However, phycotoxins are known to accumulate in other organisms and can reach high concentrations during algal blooms.
|
|
A proposed classification of archeopyle types in calcareous dinoflagellate cysts. Journal of Paleontology, 78, 456–483. They are distributed in cold through tropical seas of the world (neritic and pelagic).Gottschling M, Keupp H, Plötner J, Knop R, Willems H, Kirsch M (2005a) Phylogeny of calcareous dinoflagellates as inferred from ITS and ribosomal sequence data. Mol Phylogenet Evol 36:444–455 Calcareous cysts are deposited in both marine sediments that are coastalMontresor, M., Zingone, A., Sarno, D., 1998.
|
|
Besides molluscs like Nematura (now Stenothyra) and Polymesoda there are also marine dinoflagellates and the ostracode Hemicyprideis. Within the basal shell layer traces of an eroded soil horizon (paleosoil) were found. The hiatus underneath is estimated to have lasted 350.000 years. The following mammal taxa were found in the Lower Hamstead Member: Amphidozotherium cayluxi, Amphiperaterium exile, Anoplotherium latipes, Bransatoglis planus, Butselia biveri, Cryptopithecus, Eotalpa anglica, Glamys fordi, Palaeotherium curtum, Palaeotherium muehlbergi, Paradoxonycteris tobieni, Pseudoltinomys cuvieri, Ronzotherium sp.
|
|
About half of living dinoflagellate species are autotrophs possessing chloroplasts and half are nonphotosynthesising heterotrophs. The peridinin dinoflagellates, named after their peridinin plastids, appears to be ancestral for the dinoflagellate lineage. Almost half of all known species have chloroplasts, which are either the original peridinin plastids or new plastids acquired from other lineages of unicellular algae through endosymbiosis. The remaining species have lost their photosynthetic abilities and have adapted to a heterotrophic, parasitic or kleptoplastic lifestyle.
|
|
In the deep water, hydrothermal vents may occur where chemosynthetic sulfur bacteria form the base of the food web. Classes of organisms found in marine ecosystems include brown algae, dinoflagellates, corals, cephalopods, echinoderms, and sharks. Fishes caught in marine ecosystems are the biggest source of commercial foods obtained from wild populations. Environmental problems concerning marine ecosystems include unsustainable exploitation of marine resources (for example overfishing of certain species), marine pollution, climate change, and building on coastal areas.
|
|
Large and formidably toothed, the pigeye shark is regarded as potentially dangerous to humans, though it has not been implicated in any attacks. This species is caught infrequently on longlines and in gillnets, and is used for meat and fins. As a predator, though, the shark can accumulate ciguatera toxins produced by dinoflagellates within its tissues. In November 1993, some 500 people in Manakara, Madagascar, were poisoned, 98 of them fatally, after eating meat from a pigeye shark.
|
|
The main predator of C. pagurus is the octopus, which even attacks them inside the crab pots that fishermen use to trap them. Compared to other commercially important crab species, relatively little is known about diseases of C. pagurus. Its parasites include viruses, such as the white spot syndrome virus, various bacteria that cause dark lesions on the exoskeleton, and Hematodinium-like dinoflagellates that cause "pink crab disease". Other microscopic pathogens include fungi, microsporidians, paramyxeans, and ciliates.
|
|
Spector is a pioneer in unraveling our understanding of the inner workings of the cell nucleus. His early investigations centered on the unusual chromosome structure of dinoflagellates. Recent studies in his laboratory are focused on examining the organization and regulation of gene expression in living mammalian cells. His laboratory has developed approaches to elucidate the spatial and temporal aspects of gene expression and in identifying and characterizing the function of nuclear retained long non-coding RNAs.
|
|
A petrified log in Petrified Forest National Park, Arizona Plant fossils include roots, wood, leaves, seeds, fruit, pollen, spores, phytoliths, and amber (the fossilized resin produced by some plants). Fossil land plants are recorded in terrestrial, lacustrine, fluvial and nearshore marine sediments. Pollen, spores and algae (dinoflagellates and acritarchs) are used for dating sedimentary rock sequences. The remains of fossil plants are not as common as fossil animals, although plant fossils are locally abundant in many regions worldwide.
|
|
Spheroidal spore-like bodies within the Gunflint Chert are found irregularly distributed throughout the Gunflint Iron Formation, and range from 1 to 16 μm in diameter. Despite their name, the spheroidal bodies range from spherical to ellipsoidal in morphology. They are typically encased in membrane, which can vary in wall thickness and morphology. The spheroidal bodies have been hypothesized to be various things, such as unicellular cyanobacteria, endogenously produced endospores of bacterial origin, free-swimming dinoflagellates, and fungus spores.
|
|
Photosynthetic algae, zoochlorellae, and the dinoflagellates, zooxanthellae, live in the epidermis and tissue of the gut of A. xanthogrammica. In this symbiotic relationship, the zoochlorellae and zooxanthellae provide nutrients to the anemone via photosynthesis and contribute to the bright green color of the anemone's oral disk and tentacles. The bright green color is also due to pigmentation. Anthopleura xanthogrammica anemones living in caves and shady zones have reduced or no natural symbionts and tend to be less colorful.
|
|
Thus, having higher NCR ratios is indicative of a younger age. It appears that 24-norcholestane is not present until the emergence of diatoms. A 2008 study found that 24-norcholestanes also correlated with dinoflagellates in lacustrine sediments in China. In a 2012 study, 24-norcholestanes were found in oils and Cambrian–Ordovician source rocks from the Tarim Basin in China at much higher levels than in the 1998 study (NCRs were equivalent to Cretaceous source rocks).
|
|
Dinophysis acuminata is a marine plankton species of dinoflagellates that is found in coastal waters of the north Atlantic and Pacific oceans. The genus Dinophysis includes both phototrophic and heterotrophic species. D. acuminata is one of several phototrophic species of Dinophysis classed as toxic, as they produce okadaic acid which can cause diarrhetic shellfish poisoning (DSP). Okadiac acid is taken up by shellfish and has been found in the soft tissue of mussels and the liver of flounder species.
|
|
For instance, diatom growth rate becomes limited when the supply of silicate is depleted.Kristiansen, S., Farbrot, T., and Naustvoll, L. (2001). "Spring bloom nutrient dynamics in the Oslofjord". Marine Ecology Progress Series 219: 41–49 Since silicate is not required by other phytoplankton, such as dinoflagellates, their growth rates continue to increase. For example, in oceanic environments, diatoms (cells diameter greater than 10 to 70 µm or larger) typically dominate first because they are capable of growing faster.
|
|
Cochlodinium polykrikoides (or, Margalefidinium polykrikoides) is a species of red tide producing marine dinoflagellates known for causing fish kills around the world, and well known for fish kills in marine waters of Southeast Asia. C. polykrikoides has a wide geographic range, including North America, Central America, Western India, Southwestern Europe and Eastern Asia. Single cells of this species are ovoidal in shape, 30-50μm in length and 25-30μm in width. Cochlodinium polykrikoides is a highly motile organism.
|
|
The Warnowiaceae are a family of athecate dinoflagellates (a diverse group of unicellular eukaryotes). Members of the family are known as warnowiids. The family is best known for a light-sensitive subcellular structure known as the ocelloid, a highly complex arrangement of organelles with a structure directly analogous to the eyes of multicellular organisms. The ocelloid has been shown to be composed of multiple types of endosymbionts, namely mitochondria and at least one type of plastid.
|
|
The tubule, embedded within nematocyst, discharges towards the prey and hypothesized to be used for prey puncturing. Furthermore, Gavelis et al. deeply examined NTC morphology and ballistic mechanism that were shown to be fundamentally different from cnidarians, demonstrating nematocysts have evolved independently in single- celled dinoflagellates. Encasing coiled tubule capsule, unlike in cnidarians, is sealed, which forces stylet upon firing first to puncture the capsule from within to free the filament, and only later to pierce the prey.
|
|
Where the female gamete is derived from the elkhorn coral, the resulting offspring is bushy and compact. Where the female gamete comes from staghorn coral, the offspring adopts a more palmately dividing form. Acropora prolifera is a zooxanthellate coral, the tissues containing dinoflagellates which live symbiotically within the cells. These are photosynthetic and use the carbon dioxide and waste products of the coral while at the same time supplying oxygen and organic compounds to their host.
|
|
Chlorophyll c is a form of chlorophyll found in certain marine algae, including the photosynthetic Chromista (e.g. diatoms and brown algae) and dinoflagellates. It has a blue-green color and is an accessory pigment, particularly significant in its absorption of light in the 447-52 nm wavelength region. Like chlorophyll a and chlorophyll b, it helps the organism gather light and passes a quanta of excitation energy through the light harvesting antennae to the photosynthetic reaction centre.
|
|
Sipunculid worm Aspidosiphon muelleri inside H. aequicostatus This coral sometimes harbours photosynthetic, single-celled dinoflagellates called Zooxanthellae in its tissues. The polyps extend their tentacles at night to feed, normally remaining retracted by day. The larvae are planktonic, and when fully developed they are attracted to settle on the shells of tiny gastropod molluscs, gradually enveloping the molluscs as they grow into juvenile corals. In Australia, this coral often lives in symbiosis with the sipunculid worm, Aspidosiphon muelleri.
|
|
Symbiodinium are colloquially called zooxanthellae, and animals symbiotic with algae in this genus are said to be "zooxanthellate". The term was loosely used to refer to any golden-brown endosymbionts, including diatoms and other dinoflagellates. Continued use of the term in the scientific literature is discouraged because of the confusion caused by overly generalizing taxonomically diverse symbiotic relationships. In 2018, the systematics of Symbiodiniaceae was revised, and the distinct clades have been reassigned into seven genera.
|
|
The successful culturing of swimming gymnodinioid cells from coral led to the discovery that "zooxanthellae" were actually dinoflagellates. Each Symbiodinium cell is coccoid in hospite (living in a host cell) and surrounded by a membrane that originates from the host cell plasmalemma during phagocytosis (Figures 2B and 3). This membrane probably undergoes some modification to its protein content, which functions to limit or prevent phago-lysosome fusion. The vacuole structure containing the symbiont is therefore termed the symbiosome.
|
|
In other dinoflagellates, an analogous structure has been implicated in heterotrophic feeding and sexual recombination. In Symbiodinium, it has been suggested that the peduncle may be involved in substrate attachment, explaining why certain cells seem to spin in place. Compared to other gymnodinioid genera, there is little or no displacement at the sulcus where the ends of the cigulum groove converge. The internal organelles of the mastigote are essentially the same as described in the coccoid cell (see below).
|
|
Goniastrea favulus is a zooxanthellate species of coral, containing in its tissues many microscopic symbiotic dinoflagellates which during the day provide the coral with the products of photosynthesis. During the night, the polyps expand and extend their tentacles to catch zooplankton. Colonies of Goniastrea favulus are simultaneous hermaphrodites and spawn once a year. Spawning is a synchronised event with all the colonies in a locality releasing their gametes into the sea at much the same time.
|
|
The family Aeolidiidae, as well as other Nudibranchia families, are often studied for their adaptable defense from the stinging nematocyst discharge of Cnidarian sea anemones in particular Actinia, Anemonia, Metridium, Sagartia and Urticina. Other food sources compose of zooxanthellae dinoflagellates which live in mutualistic relationship within the Nudibranch that provide nutrition in the tissues through photosynthesis. A. papillosa participate in "ingestive conditioning" in which they consume the nematocyst from their prey in response for predators in the same environment.
|
|
Pyrenoids are found in algal lineages, irrespective of whether the chloroplast was inherited from a single endosymbiotic event (e.g. green and red algae, but not in glaucophytes) or multiple endosymbiotic events (diatoms, dinoflagellates, coccolithophores, cryptophytes, chlorarachniophytes, and euglenozoa. Some algal groups, however, lack pyrenoids altogether: "higher" red algae and extremophile red algae, the green alga genus Chloromonas, and "golden algae". Pyrenoids are usually considered to be poor taxonomic markers and may have evolved independently many times.
|
|
Blooms are often red in coastal areas of the North Sea. Green tides result from N. scintillans populations having green-pigmented prasinophytes (green algae, subphylum Chlorophyta) living in their vacuoles. N. scintillans does not appear to be toxic, but it feeds voraciously on phytoplankton, and while doing so, it accumulates and excretes high levels of ammonia into the surrounding water. This may add to the neurotoxins produced by other dinoflagellates, such as Alexandrium or Gonyaulax (syn.
|
|
Turbinaria conspicua, commonly known as disc coral, is a species of colonial a stony coral in the family Dendrophylliidae. Found abundant in the eastern Indian Ocean and the western Pacific region, including Indonesia, Papua New Guinea and northern Australia. It is a zooxanthellaa coral that houses symbiont dinoflagellates in its tissues. It was studied by Bernard in 1896 and he rated it as a least concern species by the International Union for Conservation of Nature (IUCN).
|
|
Turbinaria radicalis, also known as disc coral, is a species of colonial stony coral in the family Dendrophylliidae. It is native to the central Indo- Pacific, tropical and sub-tropical Australia, the South China Sea, northern Australia and the West Pacific. It is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues. It is a rare coral throughout its range and the International Union for Conservation of Nature has rated its conservation status as being "near-threatened".
|
|
Turbinaria patula, commonly known as disc coral, is a species of colonial stony coral in the family Dendrophylliidae. It is native to the Indo-Pacific region, being found in the eastern Indian Ocean, northern Australia, the South China Sea and the western Pacific Ocean. It is a zooxanthellate coral that houses symbiont dinoflagellates in its tissues. It is an uncommon species and the International Union for Conservation of Nature (IUCN) has rated it as a "vulnerable" species.
|
|
Chonburi, Thailand, cutting the beards and removing barnacles from Asian green mussels P. viridis is harvested in the Indo-Pacific region as a food source due to its fast growth. However, it can harbor deadly Saxitoxin produced by the dinoflagellates that it feeds upon. It can also be used as a biomonitor to indicate pollution caused by heavy metals, organochlorides and petroleum products. Mussels that are in contaminated areas have labile lysosomal membranes due to metal-induced stress.
|
|
The polyps of Favites complanata expand and extend their tentacles to catch plankton, but much of the nutritional requirements of this coral are met by the zooxanthellae housed within its tissues. These symbiotic unicellular dinoflagellates use photosynthesis to create organic molecules. In adverse conditions, such as when the coral is stressed by high temperatures, the zooxanthellae may be expelled and the coral becomes bleached and white. Bleaching occurs in this species when the water temperature rises above .
|
|
Corculum cardissa and some other members of the family Cardiidae live in symbiosis with dinoflagellates in the genus Symbiodinium. These are found in the mantle, gills and the liver. It was originally thought that the photosynthetic algae were in the haemocoel, the fluid between the cells. It has since been found however that, in response to the presence of Symbiodinium, a tertiary series of tubules develop from the walls of the digestive system and ramify through the tissues.
|
|
Aiptasia mutabilis acts as a host to many different organisms. Algae, rich in fucoxanthin, contribute to its dark brown coloring, and when these algae are not present, the organisms becomes a lighter, white color. A mutabilis will often turn white after an extended period of time in darkness, which is a condition in which this algae cannot survive. Dinoflagellates have also been known to have a symbiotic relationship with many different cnidarians within the genus Aiptasia, including A. mutabilis.
|
|
This has led to two distinct systematics: paleontological (with four subordinate groups, primarily based on the cyst wall ultrastructure, of which the c-axes of the crystals are orientated irregularly oblique, regularly radial, regularly tangential, or regularly oblique) and neontological (with the motile taxa Bysmatrum Faust and Steidinger, Ensiculifera Balech, Pentapharsodinium Indelicato and Loeblich III, and ScrippsiellaFaust, M.A., Steidinger, K.A., 1998. Bysmastrum gen. nov. (Dinophyceae) and three new combinations for benthic scrippsielloid species. Phycologia 37, 47–52Steidinger, K.A., Tangen, K., 1996. 3. Dinoflagellates.
|
|
Huge numbers of bioluminescent dinoflagellates creating phosphorescence in breaking waves Bioluminescence occurs widely among animals, especially in the open sea, including fish, jellyfish, comb jellies, crustaceans, and cephalopod molluscs; in some fungi and bacteria; and in various terrestrial invertebrates including insects. About 76% of the main taxa of deep-sea animals produce light. Most marine light-emission is in the blue and green light spectrum. However, some loose- jawed fish emit red and infrared light, and the genus Tomopteris emits yellow light.
|
|
The most frequently encountered bioluminescent organisms may be the dinoflagellates in the surface layers of the sea, which are responsible for the sparkling phosphorescence sometimes seen at night in disturbed water. At least 18 genera exhibit luminosity. A different effect is the thousands of square miles of the ocean which shine with the light produced by bioluminescent bacteria, known as mareel or the milky seas effect. Non-marine bioluminescence is less widely distributed, the two best-known cases being in fireflies and glowworms.
|
|
If the amount is greater than the benthic detritivores can process, the phytodetritus forms a fluffy layer on the surface of the sediment. It accumulates in many shallow and deep water locations throughout the world. Phytodetritus varies in colour and appearance and may be greenish, brown or grey, flocculent or gelatinous. It includes the microscopic remains of diatoms, dinoflagellates, dictyochales, coccolithophores, foraminiferans, phaeodareans, tintinnids, crustacean eggs and moults, protozoan faecal pellets, picoplankton and other planktonic matter embedded in a membranous gelatinous matrix.
|
|
Despite its lack of thecal plates, a prominent feature helpful in identifying armored flagellates, A. sanguinea is relatively large and easily recognizable. Like most dinoflagellates, one flagellum is complex, wrapping around the equator of the cell in a groove. The other flagellum extends out from the cell to help aid its movement through the water. A. sanguinea’s most prominent features are the lack of a nuclear envelope chamber and the apical groove's large, clockwise path when viewed from the front of the cell.
|
|
However, in dinoflagellates, the nuclear envelope remains intact, the centrosomes are located in the cytoplasm, and the microtubules come in contact with chromosomes, whose centromeric regions are incorporated into the nuclear envelope (the so-called closed mitosis with extranuclear spindle). In many other protists (e.g., ciliates, sporozoans) and fungi, the centrosomes are intranuclear, and their nuclear envelope also does not disassemble during cell division. Apoptosis is a controlled process in which the cell's structural components are destroyed, resulting in death of the cell.
|
|
Other multinucleate cells in the human are osteoclasts a type of bone cell. Multinucleated and binucleated cells can also be abnormal in humans; for example, cells arising from the fusion of monocytes and macrophages, known as giant multinucleated cells, sometimes accompany inflammation and are also implicated in tumor formation. A number of dinoflagellates are known to have two nuclei. Unlike other multinucleated cells these nuclei contain two distinct lineages of DNA: one from the dinoflagellate and the other from a symbiotic diatom.
|
|
The Takatika Grit is a geologic formation in Chatham Islands, New Zealand. It preserves fossils dating back to the Paleocene period, although it also preserves disturbed and re-worked Maastrichtian and Campanian microfossils and theropod fossils. A 2017 study found that it dated to late Early to Mid Paleocene on the basis of dinoflagellates. It has been subdivided into two informal units, a lower phosphatic unit containing bones and nodular phosphatic layers, and an upper unit with abundant sponge remains and silliceous microfossils.
|
|
Species of Ceratium are mixotrophic, meaning they are both photosynthetic and heterotrophic, consuming other plankton. Ceratium dinoflagellates have a unique adaptation that allows them to store compounds in a vacuole that they can use for growth when nutrients become unavailable. They are also known to move actively in the water column to receive maximum sunlight and nutrients for growth. Another adaptation that helps growth includes the ability to extend appendages during the day which contain chloroplasts to absorb light for photosynthesis.
|
|
The Blastodinium taxonomy is entirely based on their morphology at the trophont stage with B. pruvoti being the type species of the group. In 1920, Chatton proposed 3 main groups which are consistent with today's molecular data; Spinoulsum, Contorum, and Mangini. Upon their discovery, it was recognized that Blastodinium organisms had features that distinguished them from the majority of dinoflagellates in the Dinophyceae class. These include their parasitic lifestyle and the lack of histones in their temporary dinokaryon (dinospore) stage.
|
|
Upon arrival at the Scripps Institution, Sweeney wanted to study photosynthesis of red and brown algae in different colors of light. However, she encountered delays in procuring the equipment, so on the suggestion of her colleague Marston Sargent, she attempted to culture dinoflagellates. An early success was the discovery that Akashiwo sanguinea (then known as Gymnodinium splendens) requires vitamin B12 in order to grow. She was also able to culture Lingulodinium polyedra (then known as Gonyaulax polyedra), and became interested in its bioluminescence.
|
|
One or more nucleoid-like regions of densely compact DNA is commonly observed in G. obscuriglobus cells. Complex internal structure resembling a liquid crystal has been reported, with some structural similarities to the chromatin of eukaryotes such as dinoflagellates. The structure of the nucleoid has been implicated in the unusual radiation tolerance of G. obscuriglobus. Transcription and translation of genes have been reported to occur in spatially segregated locations within the cell, which is otherwise characteristic of eukaryotic but not prokaryotic cells.
|
|
The majority of planktonic foraminifera are found in the globigerinina, a lineage within the rotaliida. However, at least one other extant rotaliid lineage, Neogallitellia, seems to have independently evolved a planktonic lifestyle. Further, it has been suggested that some Jurassic fossil foraminifera may have also independently evolved a planktonic lifestyle, and may be members of Robertinida. A number of forams have unicellular algae as endosymbionts, from diverse lineages such as the green algae, red algae, golden algae, diatoms, and dinoflagellates.
|
|
The tabulation of the Dinoflagellate is sometimes mirrored in the tabulation (previously called paratabulation) of the dinocyst, allowing species to be deduced from the cyst. It has previously been suggested that morphological characters from the cyst stage may be phylogenetically important in marine species and this may to an even greater extent be the case for freshwater dinoflagellates, confirmed by new observations and recently reviewed. Several books document general cyst taxonomy.Evitt, W.R., Lentin, J.K., Millioud, M.E., Stover, L.E. and Williams, G.L., 1977.
|
|
E. pallida is a zooxanthellate species and has a symbiotic relationship with dinoflagellates, single celled photosynthetic organisms which are incorporated into its tissues. E. pallida is a fast growing species that can quickly cover underwater surfaces. It is preyed on by several nudibranchs, including Berghia coerulescens, Berghia stephanieae and Spurilla neapolitana. The nudibranchs tend to acquire the brownish colour of the zooxanthellae found in the sea anemone's tissues; they also incorporate the anemone's nematocysts into their bodies, which may serve a defensive function.
|
|
The Jagüel Formation, aged Maastrichtian and Danian, constitutes the peak of the transgression within the Malargüe Group, reaching maximum depths of a mid–outer shelf environment. It has abundant marine microfossils, such as planktonic and benthic foraminifera, calcareous ostracods and nannofossils, as well as dinoflagellates. Generally, they are well preserved. The micropaleontological record of the Jagüel Formation is of paramount importance since this unit contains the Cretaceous–Paleogene boundary in different localities, which marks the Cretaceous–Paleogene (K–Pg) extinction event.
|
|
Fig 7. Simplified Sulfurimonas Food Web / Chain Photo Credits: Suman Rana Members of the bacterial genus Sulfurimonas are known to affect the relative abundance of species around them. In the case of S. gotlandica strain GD1, it was demonstrated that heterotrophic nanoflagellate (HNF) populations decreased while ciliate and dinoflagellate abundances remained relatively constant in oxygen / hydrogen sulphide rich conditions. Conversely, the opposite trend was observed in suboxic conditions, in that HNF and ciliates increased in abundance, whereas dinoflagellates remained constant.
|
|
P. muellerae is a non- zooxanthellate coral; it does not have a symbiotic relationship with microscopic dinoflagellates as do most corals, instead obtaining all its nutrition from the planktonic organisms caught by the polyps. Asexual reproduction by budding increases the size of the colony. Sexual reproduction has not been observed in this species, but the fact that the coral has a widespread distribution suggests that it is likely to occur. This coral is sometimes parasitized by the barnacle Megatrema anglicum.
|
|
In a series of classifications proposed by Thomas Cavalier-Smith and his collaborators since 1981, Protozoa has been ranked as a kingdom. The seven-kingdom scheme presented by Ruggiero et al. in 2015, places eight phyla under Kingdom Protozoa: Euglenozoa, Amoebozoa, Metamonada, Choanozoa sensu Cavalier-Smith, Loukozoa, Percolozoa, Microsporidia and Sulcozoa. Notably, this kingdom excludes several major groups of organisms traditionally placed among the protozoa, including the ciliates, dinoflagellates, foraminifera, and the parasitic apicomplexans, all of which are classified under Kingdom Chromista.
|
|
Genetic disparity between clades in the genus Symbiodinium compared to other dinoflagellates. Analysis of conserved mitochondrial sequences (CO1) and rDNA (SSU) suggest that a taxonomic revision of this group is required. The advent of DNA sequence comparison initiated a rebirth in the ordering and naming of all organisms. The application of this methodology helped overturn the long- held belief that Symbiodinium comprised a single species, a process which began in earnest with the morphological, physiological, and biochemical comparisons of cultured isolates.
|
|
In general, the nucleus is centrally located and the nucleolus is often associated with the inner nuclear membrane. The chromosomes, as in other dinoflagellates, are seen as ‘permanently super-coiled’ DNA in transmission electron micrographs (TEM). The described species of Symbiodinium possess distinct chromosome numbers (ranging from 26 to 97), which remain constant throughout all phases of the nuclear cycle. However, during M-phase, the volume of each chromosome is halved, as is the volume of each of the two resulting nuclei.
|
|
The polyps of Plexaurella nutans extend their tentacles to feed on zooplankton and other small invertebrates floating past. The food gathered is shared with neighbouring polyps via the gastrovascular cavity inside the coral's skeleton. After particles of liver marked with a radioactive tracer were fed experimentally to a single polyp, radioactivity was detected in tissues up to away. Plexaurella nutans is a zooxanthellate species of coral with large numbers of symbiotic dinoflagellates from the genus Symbiodinium living in its tissues.
|
|
The dinoflagellates then eat the blood and flakes of tissue while the affected fish die.Burkholder JM, Glasgow HB and Hobbs CW (1995) "Fish kills linked to a toxic ambush- predator dinoflagellate: distribution and environmental conditions" Marine Ecology Progress Series. Fish kills by this dinoflagellate are common, and they may also have been responsible for kills in the past which were thought to have had other causes. Kills like these can be viewed as natural mechanisms for regulating the population of exceptionally abundant fish.
|
|
The polyps of Eunicella singularis feed by spreading their tentacles to intercept zooplankton and organic particles floating past. This diet is supplemented by the energy provided, via photosynthesis, by the symbiotic dinoflagellates that are present in the tissues of the sea fan. Reproduction involves the release of planula larvae which spend somewhere between a few hours and several days in the open sea. Each larva then settles on the seabed and undergoes metamorphosis into a primary polyp within about four days.
|
|
Many species of Euduboscquella parasitize various members of the Tintinnids, which are bell-shaped ciliates. It is not certain if different species of Euduboscquella have preference for or reliance on a particular species of tintinnids as this is poorly studied. They are also parasites of other organisms such as other dinoflagellates. Euduboscquella enter their host by being phagocytized by the host cell, but subsequently resist digestion. Euduboscquella spend most of their life cycle within their host’s cytoplasm, where they grow and mature.
|
|
When synthesized, these two proteins aggregate together and migrate to the vacuole membrane where LBP binds luciferin and the scintillons acquires an ability to produce light upon stimulation. Scintillons are not identical in different species. Scintillons isolated from dinoflagellates belonging to the genus Pyrocystis such as P. lunula (previously Dissodinium lunula) or P. noctiluca are less dense than those of L. polyedra and do not contain LBP. Little is known about the structure or composition of scintillons in species other than L. polyedra.
|
|
Many nassellarians house dinoflagellate symbionts within their tests. The nassellarian provides ammonium and carbon dioxide for the dinoflagellate, while the dinoflagellate provides the nassellarian with a mucous membrane useful for hunting and protection against harmful invaders. There is evidence from small subunit ribosomal DNA analysis of these dinoflagellate symbionts that dinoflagellate symbiosis with radiolarians evolved independently of other dinoflagellate symbioses (e.g. foraminifera). Small subunit ribosomal DNA analysis also shows evidence that no coevolution of the dinoflagellates and radiolarians has occurred.
|
|
Core histones are found in the nuclei of eukaryotic cells, and in certain Archaea, namely Proteoarchaea and Euryarchaea, but not in bacteria. The unicellular algae known as dinoflagellates were previously thought to be the only eukaryotes that completely lack histones, however, later studies showed that their DNA still encodes histone genes. Unlike the core histones, lysine-rich linker histone (H1) proteins are found in bacteria, otherwise known as nucleoprotein HC1/HC2. Archaeal histones may well resemble the evolutionary precursors to eukaryotic histones.
|
|
Dinoflagellate anatomy Dinoflagellates are unicellular and possess two dissimilar flagella arising from the ventral cell side (dinokont flagellation). They have a ribbon-like transverse flagellum with multiple waves that beats to the cell's left, and a more conventional one, the longitudinal flagellum, that beats posteriorly. The transverse flagellum is a wavy ribbon in which only the outer edge undulates from base to tip, due to the action of the axoneme which runs along it. The axonemal edge has simple hairs that can be of varying lengths.
|
|
Like other salps, T. vagina feeds by consuming plankton nutrient water on one end of its body, filtering it via an internal net made of mucus, and spewing the water out the other end. Their internal net is very effective, catching particles spanning four magnitudes in size. This action also allows them to move through the water column, classifying them as nektonic. T. vagina feeds on marine plankton, including single-celled organisms such as dinoflagellates, silicoflagellates, diatoms, and tintinnids, as well as copepods and other small particles.
|
|
Acropora millepora is a zooxanthellate species of coral and harbours symbiotic dinoflagellates in its tissues. The larvae of Acropora millepora preferentially settle on vertical surfaces and on encrusting coralline algae. It has been found that at lower temperatures () the larvae were less specific as to their choice of settlement sites and that their survival rates were lower. Surprisingly, the choice of substrate for settlement was modified by the strain of symbiont present in the locality even though it had not yet infected the tissues.
|
|
The dolomite beds are associated with at least six different types of either stromatolites or microbially influenced carbonate precipitation. The gray and black mudrocks often contain an abundance of microfossils, including vase-shaped microfossils (VSMs), acritarchs, "Sphaerocongregus variabilis", and organic chemicals characteristic of dinoflagellates. Finally, the enigmatic circular fossils of Chuaria circularis are found at various levels within the Chuar Group. The types of fossils found and sedimentary strata comprising the Chuar Group are indicative of its deposition within a low-energy marine embayment.
|
|
P. bahamense displays bioluminescence when agitated, glowing blue. Pyrodinium bahamense is the phytoplankton primarily responsible for the bioluminescence in the bioluminescent bays, or "bio bays," of Puerto Rico and the Bahamas. The bright cobalt blue light produced by these dinoflagellates when they are mechanically disturbed creates a magical effect that draws many tourists to the bays. Most of the bays are in reserves, and no swimming is allowed, but guests are able to kayak in the bays at night with local guides to observe the bioluminescence.
|
|
When large numbers of fish, like shoaling forage fish, are in confined situations such as shallow bays, the excretions from the fish encourage this dinoflagellate, which is not normally toxic, to produce free-swimming zoospores. If the fish remain in the area, continuing to provide nourishment, then the zoospores start secreting a neurotoxin. This toxin results in the fish developing bleeding lesions, and their skin flakes off in the water. The dinoflagellates then eat the blood and flakes of tissue while the affected fish die.
|
|
In some freshwater environments of Australia, A. circinalis are known to produce paralytic shellfish toxins (PSTs), a neurotoxin also found in some marine dinoflagellates. Severe PST intoxication can result in a potentially fatal illness known as paralytic shellfish poisoning (PSP). PSTs are in a class of poisons known as the saxitoxins, which are among the most toxic naturally produced substances. Saxitoxin poisoning begins with the blockage of sodium and potassium channels, quickly leading to a decrease in neural action potentials, flaccid paralysis, respiratory arrest, and eventually death.
|
|
It is predicted that Roseobacter ancestor dates back to around 260 million years ago. They underwent a net genome reduction from a large common ancestral genome followed by two episodes of genome innovation and expansion through lateral gene transfer (LGT). The first predicted episode of genome expansion was predicted to be around 250 million years ago. It was suggested that the genome expansion was most likely due to new ecological habitats provided by the rise of eukaryotic phytoplankton groups like the dinoflagellates and coccolithophorids.
|
|
Hilsa kelee, called the kelee shad, fivespot herring and the razorbelly, is a species of shad native to the coasts and estuaries of the Indian Ocean and the western Pacific, generally in tropical waters. It feeds on diatoms and dinoflagellates, and any other small plankton that it can trap in its gillrakers. Some individuals can reach 35 cm, but most are around 16.5 cm. Hilsa kelee is currently considered the only species in the genus Hilsa, although other species have been included in the genus previously.
|
|
Durinskia is a genus of dinoflagellate that can be found in freshwater and marine environments. This genus was created to accommodate its type species, Durinskia baltica, after major classification discrepancies were found. While Durinskia species appear to be typical dinoflagellates that are armored with cellulose plates called theca, the presence of a pennate diatom-derived tertiary endosymbiont is their most defining characteristic. This genus is significant to the study of endosymbiotic events and organelle integration since structures and organelle genomes in the tertiary plastids are not reduced.
|
|
For example, slime molds have a vegetative, multinucleate life stage called a plasmodium. Although not normally viewed as a case of multinucleation, plant cells share a common cytoplasm by plasmodesmata, and most cells in animal tissues are in communication with their neighbors via gap junctions. Multinucleate cells, depending on the mechanism by which they are formed, can be divided into "syncytia" (formed by cell fusion) or "coenocytes" (formed by nuclear division not being followed by cytokinesis). A number of dinoflagellates are known to have two nuclei.
|
|
Dredged volcanic rocks are heavily altered; this has given rise to analcime, augite, calcite, clay, clinoptilolite, iddingsite, ilmenite, labradorite, magnetite iron oxides and talc. Carbonates are found as limestone and siltstone; some limestones were formed by living beings. At one point in the drill core, carbonates were found mixed with volcanic rocks; presumably this is a place where hyaloclastite accumulated and was reworked by sea currents. The limestone contains fossils of algae, bryozoans, echinoids, foraminiferans, molluscs and ostracods; dinoflagellates, pollen and scolecodonts are also found.
|
|
Although some phytoplankton cells, such as dinoflagellates, are able to migrate vertically, they are still incapable of actively moving against currents, so they slowly sink and ultimately fertilize the seafloor with dead cells and detritus.Käse L, Geuer JK. (2018) "Phytoplankton responses to marine climate change–an introduction". In Jungblut S., Liebich V., Bode M. (Eds) YOUMARES 8–Oceans Across Boundaries: Learning from each other, pages 55–72, Springer. . 50px Material was copied from this source, which is available under a Creative Commons Attribution 4.0 International License.
|
|
Many aspects of transcription are controlled by chemical modification on the histone proteins, known as the histone code. Chromosome scaffold has important role to hold the chromatin into compact chromosome. Chromosome scaffold is made of proteins including condensin, topoisomerase IIα and kinesin family member 4 (KIF4) Chromosome Scaffold is a Double-Stranded Assembly of Scaffold Proteins, by Poonperm et al, Nature scientific reports Dinoflagellates are very divergent eukaryotes in terms of how they package their DNA. Their chromosomes are packed in a liquid-crystalline state.
|
|
The earliest ribosomal gene sequence data indicated that Symbiodinium had lineages whose genetic divergence was similar to that seen in other dinoflagellates from different genera, families, and even orders. This large phylogenetic disparity among clades A, B, C, etc. was confirmed by analyses of the sequences of the mitochondrial gene coding for cytochrome c oxidase subunit I among Dinophyceae. Most of these clade groupings comprise numerous reproductively isolated, genetically distinct lineages (see ‘Species diversity’), exhibiting different ecological and biogeographic distributions (see ‘Geographic distributions and patterns of ‘diversity’).
|
|
Over the rest of the cell, except for a diminished mouth called the micropore, the membrane is supported by vesicles called alveoli, forming a semirigid pellicle. The presence of alveoli and other traits place the Apicomplexa among a group called the alveolates. Several related flagellates, such as Perkinsus and Colpodella, have structures similar to the polar ring and were formerly included here, but most appear to be closer relatives of the dinoflagellates. They are probably similar to the common ancestor of the two groups.
|
|
Takayama tasmanica is a species of dinoflagellates with sigmoid apical grooves first found in Tasmanian and South African waters. It contains fucoxanthin and its derivatives as its main accessory pigments. Takayama tasmanica is similar to Gymnodinium pulchellum in its external morphology, however it differs from them by having two ventral pores, a large horseshoe-shaped nucleus, and its characteristic central pyrenoid with radiating chloroplasts passing through its nucleus. It possesses gyroxanthin-diester and a gyroxanthin-like accessory pigment, which are missing in its sister species T. helix.
|
|
As seasonal successions of phytoplankton populations follow a consistent recurring pattern, bacterial dynamics and phytoplankton succession can be correlated. In general, seasonal changes in bacterial composition follow changes in temperature and chlorophyll a, while nutrient availability limits bacterioplankton growth rates. During water column mixing in late autumn/winter, nutrients brought to the surface kicks start a distinct diatom spring bloom followed by dinoflagellates. After the spring bloom, bacterial production and growth become elevated due to the release of Dissolved organic matter (DOM) from phytoplankton decay.
|
|
Turbinaria mesenterina is a zooxanthellate species of coral, housing symbiotic dinoflagellates in its tissues. It thrives in turbid water, and is tolerant of high levels of sedimentation. It can clear sediment off its surface within a few hours and may benefit from feeding on organic matter present in the sediment. It has been suggested that higher levels of sedimentation on the Great Barrier Reef of Australia may result in dominance of the reef community by a small number of tolerant species of coral such as T. mesenterina.
|
|
A single peridinin molecule. Photosynthetic dinoflagellates contain membrane-bound light- harvesting complexes similar to those found in green plants. They additionally contain water-soluble protein-pigment complexes that exploit carotenoids such as peridinin to extend their photosynthetic capacity. Peridinin absorbs light in the blue-green wavelengths (470 to 550 nm) which are inaccessible to chlorophyll by itself; instead the PCP complex uses the geometry of the relative pigment orientations to effect extremely high-efficiency energy transfer from the peridinin molecules to their neighboring chlorophyll molecule.
|
|
Brown coenosarc and green oral discs Favites pentagona is a zooxanthellate species of coral. This means that it harbours symbiotic unicellular dinoflagellates in its tissues, which use the energy from sunlight to synthesize nutrients, from which the host coral benefits. It is an aggressive species of coral. At night it extends its polyps to feed on plankton, and expands its elongated sweeper tentacles armed with stinging cells well beyond the limits of its base, so as to avoid being crowded or overgrown by other organisms.
|
|
The process of secondary endosymbiosis left its evolutionary signature within the unique topography of plastid membranes. Secondary plastids are surrounded by three (in euglenophytes and some dinoflagellates) or four membranes (in haptophytes, heterokonts, cryptophytes, and chlorarachniophytes). The two additional membranes are thought to correspond to the plasma membrane of the engulfed alga and the phagosomal membrane of the host cell. The endosymbiotic acquisition of a eukaryote cell is represented in the cryptophytes; where the remnant nucleus of the red algal symbiont (the nucleomorph) is present between the two inner and two outer plastid membranes.
|
|
'Core dinoflagellates' (dinokaryotes) have a peculiar form of nucleus, called a dinokaryon, in which the chromosomes are attached to the nuclear membrane. These carry reduced number of histones. In place of histones, dinoflagellate nuclei contain a novel, dominant family of nuclear proteins that appear to be of viral origin, thus are called dinoflagellate/ viral nucleoproteins (DVNPs) which are highly basic, bind DNA with similar affinity to histones, and occur in multiple posttranslationally modified forms. Dinoflagellate nuclei remain condensed throughout interphase rather than just during mitosis, which is closed and involves a uniquely extranuclear mitotic spindle.
|
|
Vertical migration, or movement of phytoplankton within the water column, contributes to the establishment of the DCM due to the diversity of resources required by the phytoplankton. Dependent on factors like nutrients and available light, some phytoplankton species will intentionally move to different depths to fulfill their physiological requirements. A mechanism employed by certain phytoplankton, such as certain species of diatoms and cyanobacteria, is to regulate their own buoyancy to move through the water column. Other species such as dinoflagellates use their flagella to swim to their desired depth.
|
|
The event brought about the extinction of the pliosaurs, and most ichthyosaurs. Coracoids of Maastrichtian age were once interpreted by some authors as belonging to ichthyosaurs, but these have since been interpreted as plesiosaur elements instead. Although the cause is still uncertain, the result starved the Earth's oceans of oxygen for nearly half a million years, causing the extinction of approximately 27 percent of marine invertebrates, including certain planktic and benthic foraminifera, mollusks, bivalves, dinoflagellates and calcareous nannofossils. The global environmental disturbance that resulted in these conditions increased atmospheric and oceanic temperatures.
|
|
Like other members of the microzooplankton (such as oligotrich ciliates, heterotrophic dinoflagellates, radiolarians, etc.), tintinnids are a vital link in aquatic food chains as they are the 'herbivores' of the plankton. They feed on phytoplankton (algae and cyanobacteria) and in turn act as food for larger organisms such as copepods (small crustaceans) and larval fish. The color image on the right is a specimen of Dictyocysta mitra from the Bay of Villefranche in the Mediterranean Sea. The hair-like projections pointing out of the top of the shell are the cilia of the cell.
|
|
Alternatively, the new individual may acquire the zooxanthellae direct from sea water in which the dinoflagellates freely live at some stages of their life cycle. Some stony corals use chemotaxis, with infection occurring as a result of the emission by the coral of a chemical attractant. Infection may also occur after ingestion of infected faecal matter by the host, or of prey that already houses the symbionts. Such indirect acquisition can result in the new host being infected by a species of zooxanthella different from that present in its parent.
|
|
Calanus finmarchicus is most commonly found in the North Sea and the Norwegian Sea. It is also found throughout the colder waters of the North Atlantic, especially off the coast of Canada, in the Gulf of Maine, and all the way up to western and northern Svalbard. Calanus finmarchicus is one of the most commonly found species of zooplankton in the subarctic waters of the North Atlantic. Sometimes confused with C. helgolandicus and C. glacialis, C. finmarchicus is a large planktonic copepod whose chief diet includes diatoms, dinoflagellates, and other microplanktonic organisms.
|
|
All species are zooxanthellate, that is, they contain symbiotic, single-celled photosynthetic dinoflagellates that live in the tissues and provide the coral with nutrients produced by photosynthesis during the day. At night, the tentacles of the polyps expand and capture zooplankton. Budding in mussids is always intracalicular, that is to say occurring inside the oral disc of the polyp, within the whorl of tentacles. The corallites are either separate, or arranged in series, and when the coenosteum is present, it extends beyond the wall of the septa ("costate").
|
|
The human illness associated with ingestion of harmful levels of saxitoxin is known as paralytic shellfish poisoning, or PSP, and saxitoxin and its derivatives are often referred to as "PSP toxins". The medical and environmental importance of saxitoxin derives from the consumption of contaminated shellfish and certain finfish which can concentrate the toxin from dinoflagellates or cyanobacteria. The blocking of neuronal sodium channels which occurs in PSP produces a flaccid paralysis that leaves its victim calm and conscious through the progression of symptoms. Death often occurs from respiratory failure.
|
|
Freshwater sponges often host green algae as endosymbionts within archaeocytes and other cells, and benefit from nutrients produced by the algae. Many marine species host other photosynthesizing organisms, most commonly cyanobacteria but in some cases dinoflagellates. Symbiotic cyanobacteria may form a third of the total mass of living tissue in some sponges, and some sponges gain 48% to 80% of their energy supply from these micro-organisms. In 2008 a University of Stuttgart team reported that spicules made of silica conduct light into the mesohyl, where the photosynthesizing endosymbionts live.
|
|
The endosymbiotic, photosynthetic algae which C. tuberculata hosts in its body are paramount to the jellyfish's prosperity. These mutualistic microorganisms are also known as zooxanthellae, originating from the dinoflagellate phylum, and they commonly engage in symbiotic relationships with many types of jellyfish. While the cnidarian hosts provide shelter for these symbionts, the dinoflagellates in return use their photosynthetic abilities to provide the C. tuberculata with energy for usage and storage. Fatty acids, for example, are the primary macromolecules for energy storage in cnidarians, and mainly are obtained from their carbon-fixing symbionts.
|
|
This theory is backed up by the fact that modern lineages of roseobacters are abundant components of the phycosphere of these two phytoplankton groups. Genes related to mobility and chemotaxis in the ancestor of the Roseobacter clade would have potentially allowed reseobacter to sense and swim towards these phytoplankton. Later on it was found that some lineages of Roseobacter are also associated with diatoms. All dinoflagellates, coccolithophorids and diatoms are red-plastid-lineage phytoplankton, and the coincidence of the red-plastid radiation and Roseobacter genome innovation is consistent with adaptive evolution.
|
|
John Woodland "Woody" Hastings, (March 24, 1927 – August 6, 2014) was a leader in the field of photobiology, especially bioluminescence, and was one of the founders of the field of circadian biology (the study of circadian rhythms, or the sleep-wake cycle). He was the Paul C. Mangelsdorf Professor of Natural Sciences and Professor of Molecular and Cellular Biology at Harvard University.Hastings Lab Home page He published over 400 papers and co-edited three books. Hastings research on bioluminescence principally focused on bacterial luminescence (over 150 papers) and dinoflagellates (over 80 papers).
|
|
Warnowiids are found in marine plankton but are very rare in most plankton samples. Little is known about their life histories because they cannot be cultured in the laboratory, and samples obtained from the natural environment do not survive well under laboratory conditions. Studies of wild samples have found evidence of distinctive structures called trichocysts in warnowiid cell vacuoles, suggesting that their prey might be other dinoflagellates. Despite the complexity of the ocelloid, the experimental difficulty of working with the cells has prevented experimental study of light-directed behavior such as phototaxis.
|
|
Individual colonies grow by asexual reproduction of polyps. Corals also breed sexually by spawning: polyps of the same species release gametes simultaneously overnight, often around a full moon. Fertilized eggs form planulae, a mobile early form of the coral polyp which when mature settles to form a new colony. Although some corals are able to catch plankton and small fish using stinging cells on their tentacles, most corals obtain the majority of their energy and nutrients from photosynthetic unicellular dinoflagellates of the genus Symbiodinium that live within their tissues.
|
|
Tomopteris, a holoplanktic polychaete worm with an unusual yellow bioluminescence that emanates from its parapodia Holoplankton are organisms that are planktic (they live in the water column and cannot swim against a current) for their entire life cycle. Holoplankton can be contrasted with meroplankton, which are planktic organisms that spend part of their life cycle in the benthic zone. Examples of holoplankton include some diatoms, radiolarians, some dinoflagellates, foraminifera, amphipods, krill, copepods, and salps, as well as some gastropod mollusk species. Holoplankton dwell in the pelagic zone as opposed to the benthic zone.
|
|
The most well studied symbiosis involving an animal host is that between the cnidaria and the dinoflagellates, most commonly the single-celled zooxanthellae. The symbiosis of the Chlorella–Hydra first described the symbiosome. The coral Zoanthus robustus has been used as a model organism to study the symbiosis with its microsymbiont algal species of Symbiodinium, with a focus on the symbiosome and its membranes. Methods for isolating the symbiosome membranes have been looked for – the symbiont in the animal host has a multilayered membrane complex which has proved resistant to disruption making their isolation difficult.
|
|
The coccoid cell of Symbiodinium is spherical and ranges in average diameter from 6 to 13 µm, depending on the species (Blank et al. 1989). This stage is often wrongly interpreted as a dinocyst; hence, in published literature, the alga in hospite is often referred to as a vegetative cyst. The term cyst usually refers to a dormant, metabolically quiescent stage in the life history of other dinoflagellates, initiated by several factors, including nutrient availability, temperature, and day length. Such cysts permit extended resistance to unfavourable environmental conditions.
|
|
Most species are filter feeders that sieve small particles, mainly phytoplankton (microscopic floating plants), out of the water. The freshwater species Plumatella emarginata feeds on diatoms, green algae, cyanobacteria, non-photosynthetic bacteria, dinoflagellates, rotifers, protozoa, small nematodes, and microscopic crustaceans. While the currents that bryozoans generate to draw food towards the mouth are well understood, the exact method of capture is still debated. All species also flick larger particles towards the mouth with a tentacle, and a few capture zooplankton (planktonic animals) by using their tentacles as cages.
|
|
Marine organisms like dinoflagellates, pelagic invertebrates, and fishes store low-density wax esters in their swim bladders or other tissues to provide buoyancy. Wax esters per se are a normal part of the diet of humans as a lipid component of certain foods, including unrefined whole grain cereals, seeds, and nuts. Wax esters are also consumed in considerable amounts by certain populations that regularly eat fish roe or certain fish species. That said, wax esters are not typically consumed in appreciable quantities in diets containing many processed foods.
|
|
Thus far, five species have been described in this taxon, which include: P.infectans, P.sinerae, P.corolla, P.rostrata, and P.prorocentri. The genus Parvilucifera is morphologically characterized by flagellated zoospore. The life cycle of the species in this genus consist of free-living zoospores, an intracellular stage called trophont, and asexual division to form resting sporangium inside host cell. This taxon has gained more interest in research due to its potential significance in terms of negative regulation for dinoflagellates blooms, that have proved harmful for algal species, humans, and the shellfish industry (Norén et al. 1999).
|
|
Size and distribution of phytoplankton are also related to fronts. Microphytoplankton (>20μm) are found at fronts and at sea ice boundaries, while nanophytoplankton (<20μm) are found between fronts. Studies of phytoplankton stocks in the southern sea have shown that the Antarctic Circumpolar Current is dominated by diatoms, while the Weddell Sea has abundant coccolithophorids and silicoflagellates. Surveys of the SW Indian Ocean have shown phytoplankton group variation based on their location relative to the Polar Front, with diatoms dominating South of the front, and dinoflagellates and flagellates in higher populations North of the front.
|
|
Algae on the coast of northern Germany HABs from cyanobacteria (blue-green algae) can appear as a foam, scum, or mat on or just below the surface of water and can take on various colors depending on their pigments. Cyanobacteria blooms in freshwater lakes or rivers may appear bright green, often with surface streaks which looks like floating paint. Similarly, red tides made up of dinoflagellates, also contain photosynthetic pigments that vary in color from green to brown to red. Most blooms occur in warm waters that have excessive nutrients.
|
|
Alexandrium tamarense is a species of dinoflagellates known to produce saxitoxin, a neurotoxin which causes the human illness clinically known as paralytic shellfish poisoning (PSP). Multiple species of phytoplankton are known to produce saxitoxin, including at least 10 other species from the genus Alexandrium. Recent molecular work shows that this species belongs to the Alexandrium tamarense complex (Atama complex, including A. tamarense, Alexandrium fundyense, Alexandrium catenella) and that none of the three original morphospecies designations forms monophyletic groups in the present SSU-based and previous LSU-based phylogenetic trees, i.e. these species designations are invalid.
|
|
Again, causality has not been concluded, but an association seems to exist between the distribution of especially the dinoflagellates and the occurrence of FP, and as they are found on weeds, they can be ingested by foraging green sea turtles. Turtles with FP are found to have a compromised immune system. They have higher phagocytic leucocyte counts (especially heterophils) compared to healthy individuals, which seems to be an effect of FP, as it is mostly evident in individuals with severe tumours. This further supports the hypothesis of the herpesvirus as a causative agent.
|
|
The term red tide is most often used in the US to refer to Karenia brevis blooms in the eastern Gulf of Mexico, also called the Florida red tide. K. brevis is one of many different species of the genus Karenia found in the world's oceans. Major advances have occurred in the study of dinoflagellates and their genomics. Some include identification of the toxin-producing genes (PKS genes), exploration of environmental changes (temperature, light/dark, etc.) have on gene expression, as well as an appreciation of the complexity of the Karenia genome.
|
|
Being polyketides, the okadaic acid family of molecules are synthesized by dinoflagellates via polyketide synthase (PKS). However unlike the majority of polyketides, the dinoflagellate group of polyketides undergo a variety of unusual modifications. Okadaic acid and its derivatives are some of the most well studied of these polyketides, and research on these molecules via isotopic labeling has helped to elucidate some of those modifications. Okadaic acid is formed from a starter unit of glycolate, found at carbons 37 and 38, and all subsequent carbons in the chain are derived from acetate.
|
|
Euduboscquella (juˌduːboʊˈskwɛlə) is a genus of early branching dinoflagellates found in coastal waters around the globe.. The members of this genus are all intracellular parasites that primarily infect Tintinnids. Euduboscquella are commonly found in marine environments, either infecting a host or in a resting stage in search of a new host, but there are a few freshwater and terrestrial species. Euduboscquella possess a multi-grooved shield separating their cytoplasm from the host’s cytoplasm, which is used by researchers to taxonomically identify them. The genus Euduboscquella contains nine species.
|
|
WHOI scientists at LJL installing a Video Plankton RecorderThis nutrient rich upwelling such as occurs in the Gulf of Panama, can stimulate Plankton production leading to blooms of centric, colonial, and penate diatoms and dinoflagellates. Zooplankton populations often respond to this by subsequently increasing growth and reproduction rates. Scientists are now able to quantify the abundance and diversity of these microscopic organisms in-situ with sensors such as the Video Plankton Recorder (a specialized underwater microscope and imaging system).Davis, CS, Hu, Q, SM Gallager, x Tang, C Ashjian.
|
|
An autospore is a non-motile (non-flagellated) spore that is produced within a parent cell, and has the same shape as the parent cell, before release. Autospores, in addition to zoospore and aplanospore, are one of the three types of spores that algae use to reproduce and spread asexually. Autospores occur in several groups of algae, including Eustigmatophyceae, Dinoflagellates and green algae. For example, the colonial alga Dichotomococcus produces two autospores per reproducing cell; the autospores escape through a slit in the cell wall and remain attached to the mother cell.
|
|
Oil spills, and runoff containing human sewage and chemical pollutants have a marked effect on microbial life in the vicinity, as well as harbouring pathogens and toxins affecting all forms of marine life. The protist dinoflagellates may at certain times undergo population explosions called blooms or red tides, often after human-caused pollution. The process may produce metabolites known as biotoxins, which move along the ocean food chain, tainting higher-order animal consumers. Pandoravirus salinus, a species of very large virus, with a genome much larger than that of any other virus species, was discovered in 2013.
|
|
Dinoflagellates may use bioluminescence for defence against predators. They shine when they detect a predator, possibly making the predator itself more vulnerable by attracting the attention of predators from higher trophic levels. Grazing copepods release any phytoplankton cells that flash, unharmed; if they were eaten they would make the copepods glow, attracting predators, so the phytoplankton's bioluminescence is defensive. The problem of shining stomach contents is solved (and the explanation corroborated) in predatory deep-sea fishes: their stomachs have a black lining able to keep the light from any bioluminescent fish prey which they have swallowed from attracting larger predators.
|
|
SEM Cryptophytes under light microscope The first mention of cryptomonads appears to have been made by Christian Gottfried Ehrenberg in 1831, while studying Infusoria. Later, botanists treated them as a separate algae group, class Cryptophyceae or division Cryptophyta, while zoologists treated them as the flagellate protozoa order Cryptomonadina. In some classifications, the cryptomonads were considered close relatives of the dinoflagellates because of their (seemingly) similar pigmentation, being grouped as the Pyrrhophyta. There is considerable evidence that cryptomonad chloroplasts are closely related to those of the heterokonts and haptophytes, and the three groups are sometimes united as the Chromista.
|
|
The media has applied the term carnivorous or predatory algae mainly to Pfiesteria piscicida, Pfiesteria shumwayae and other Pfiesteria-like dinoflagellates implicated in harmful algal blooms and fish kills. Pfiesteria as an "ambush predator" utilizes a "hit and run" feeding strategy by releasing a toxin that paralyzes the respiratory systems of susceptible fish, such as menhaden, thus causing death by suffocation. It then consumes the tissue sloughed off its dead prey. Pfiesteria piscicida () has been blamed for killing more than one billion fish in the Neuse and Pamlico river estuaries in North Carolina and causing skin lesions in humans in the 1990s.
|
|
Most cnidarians prey on organisms ranging in size from plankton to animals several times larger than themselves, but many obtain much of their nutrition from dinoflagellates, and a few are parasites. Many are preyed on by other animals including starfish, sea slugs, fish, turtles, and even other cnidarians. Many scleractinian corals—which form the structural foundation for coral reefs—possess polyps that are filled with symbiotic photo-synthetic zooxanthellae. While reef-forming corals are almost entirely restricted to warm and shallow marine waters, other cnidarians can be found at great depths, in polar regions, and in freshwater.
|
|
The dinoflagellete type of luciferen used in this reaction is one of the four common types of luciferin found in the marine environment, and the genome of P. fusiformis contains shared common origin with other dinoflagellates that contain the luciferase enzyme. In the laboratory, two different types bioluminescent flashes have been observed. One is bright and quick, while the other is dim but longer-lasting. The intensity and duration of these flashes are dependent on the time a cell has to recharge in between emitting light, with recovery periods varying between 15-60 minutes and 6 hours for fatigued cells.
|
|
Pfiesteria is a genus of heterotrophic dinoflagellates that has been associated with harmful algal blooms and fish kills. Pfiesteria complex organisms (PCOs) were claimed to be responsible for large fish kills in the 1980s and 1990s on the coast of North Carolina and in tributaries of the Chesapeake Bay. In reaction to the toxic outbreaks, six states along the US east coast have initiated a monitoring program to allow for rapid response in the case of new outbreaks and to better understand the factors involved in Pfiesteria toxicity and outbreaks. New molecular detection methods have revealed that Pfiesteria has a worldwide distribution.
|
|
Protozoans are protists which feed on organic matter such as other microorganisms or organic tissues and debris. Historically, the protozoa were regarded as "one-celled animals", because they often possess animal-like behaviours, such as motility and predation, and lack a cell wall, as found in plants and many algae. Although the traditional practice of grouping protozoa with animals is no longer considered valid, the term continues to be used in a loose way to identify single-celled organisms that can move independently and feed by heterotrophy. Marine protozoans include zooflagellates, foraminiferans, radiolarians and some dinoflagellates.
|
|
Thus, the genus was placed in a separate class, Blastodiniphyceae, which contained the single order, Blastodiniales. However, the Blastodinium’s dinospore's thecal plate pattern is still noticeably similar to the thecal patterning on dinophyceae dinoflagellates, highlighting the close relationship between the lineages. Blastodinium exhibit the two features that link all members of the Blastodiniale order; a parasitic life mode and the presence of a temporary dinokaryon at some life cycle stage. However, Blastodinium classification as a monophyletic group is only moderately supported, as small subunit rDNA sequences between some of the genus's species have a relatively large difference.
|
|
24-Norcholestane, a steroid derivative, is used as a biomarker to constrain the source age of sediments and petroleum through the ratio between 24-norcholestane and 27-norcholestane (24-norcholestane ratio, NCR), especially when used with other age diagnostic biomarkers, like oleanane. While the origins of this compound are still unknown, it is thought that they are derived from diatoms due to their identification in diatom rich sediments and environments. In addition, it was found that 24-norcholestane levels increased in correlation with diatom evolution. Another possible source of 24-norcholestane is from dinoflagellates, albeit to a much lower extent.
|
|
In terms of numbers, the most important groups of phytoplankton include the diatoms, cyanobacteria and dinoflagellates, although many other groups of algae are represented. One group, the coccolithophorids, is responsible (in part) for the release of significant amounts of dimethyl sulfide (DMS) into the atmosphere. DMS is oxidized to form sulfate which, in areas where ambient aerosol particle concentrations are low, can contribute to the population of cloud condensation nuclei, mostly leading to increased cloud cover and cloud albedo according to the so-called CLAW Hypothesis. Different types of phytoplankton support different trophic levels within varying ecosystems.
|
|
Recent studies indicate that there were no major shifts in dinoflagellates through the boundary layer. Radiolaria have left a geological record since at least the Ordovician times, and their mineral fossil skeletons can be tracked across the K–Pg boundary. There is no evidence of mass extinction of these organisms, and there is support for high productivity of these species in southern high latitudes as a result of cooling temperatures in the early Paleocene. Approximately 46% of diatom species survived the transition from the Cretaceous to the Upper Paleocene, a significant turnover in species but not a catastrophic extinction.
|
|
Initially, it was assumed that the observed zooids would grow into dinoflagellate cells, and there was much debate that sporangia did not arise from parasites. However, when very similar observations of the round bodies were made with plankton material also from the Swedish West Coast, led to further investigation (Norén et al. 1999). Through combined examination of light and electron microscopy alongside DNA sequencing of the emerging sporangia from the zooids displayed a relationship with Perkinsus. Differences of the ultrastructure of zooids arose in terms of the flagellum and were noted in contrast to dinoflagellates and apicomplexans.
|
|
They also possess multiple eIF4E isoforms with specialized roles in capping. Some other eukaryotes, notably among dinoflagellates, sponges, nematodes, cnidarians, ctenophores, flatworms, crustaceans, chaetognaths, rotifers, and tunicates also use more or less frequently the SL trans-splicing. In the tunicate Ciona intestinalis, the extent of SL trans-splicing is better described by a quantitative view recognising frequently and infrequently trans-spliced genes rather than a binary and conventional categorisation of trans-spliced versus non-trans-spliced genes. One function of the SL trans-splicing is the resolution of polycistronic transcripts of operons into individual 5'-capped mRNAs.
|
|
It is hypothesized that the acantharians provide the algae with nutrients (N & P) that they acquire by capturing and digesting prey in return for sugar that the algae produces during photosynthesis. It is not known, however, whether the algal symbionts benefit from the relationship or if they are simply being exploited and then digested by the acantharians. Symbiotic Holacanthida acantharians host diverse symbiont assemblages, including several genera of dinoflagellates (Pelagodinium, Heterocapsa, Scrippsiella, Azadinium) and a haptophyte (Chrysochromulina). Clade E & F acantharians have a more specific symbiosis and primarily host symbionts from the haptophyte genus Phaeocystis, although they sometimes also host Chrysochromulina symbionts.
|
|
Cyanobacteria remained principal primary producers throughout the Proterozoic Eon (2500–543 Ma), in part because the redox structure of the oceans favored photoautotrophs capable of nitrogen fixation. Green algae joined blue-greens as major primary producers on continental shelves near the end of the Proterozoic, but only with the Mesozoic (251–65 Ma) radiations of dinoflagellates, coccolithophorids, and diatoms did primary production in marine shelf waters take modern form. Cyanobacteria remain critical to marine ecosystems as primary producers in oceanic gyres, as agents of biological nitrogen fixation, and, in modified form, as the plastids of marine algae.
|
|
Some carnivorous fungi catch nematodes using either active traps in the form of constricting rings, or passive traps with adhesive structures. Many species of protozoa (eukaryotes) and bacteria (prokaryotes) prey on other microorganisms; the feeding mode is evidently ancient, and evolved many times in both groups. Among freshwater and marine zooplankton, whether single-celled or multi-cellular, predatory grazing on phytoplankton and smaller zooplankton is common, and found in many species of nanoflagellates, dinoflagellates, ciliates, rotifers, a diverse range of meroplankton animal larvae, and two groups of crustaceans, namely copepods and cladocerans. summarizes findings from many authors.
|
|
Okadaic acid, C44H68O13, is a toxin produced by several species of dinoflagellates, and is known to accumulate in both marine sponges and shellfish. One of the primary causes of diarrhetic shellfish poisoning, okadaic acid is a potent inhibitor of specific protein phosphatases and is known to have a variety of negative effects on cells. A polyketide, polyether derivative of a C38 fatty acid, okadaic acid and other members of its family have shined light upon many biological processes both with respect to dinoflagellete polyketide synthesis as well as the role of protein phosphatases in cell growth.
|
|
Many species live most of their lives as single cells, while other species form coenobia (colonies), long filaments, or highly differentiated macroscopic seaweeds. A few other organisms rely on green algae to conduct photosynthesis for them. The chloroplasts in dinoflagellates of the genus Lepidodinium, euglenids and chlorarachniophytes were acquired from ingested green algae,Plastid phylogenomics with broad taxon sampling further elucidates the distinct evolutionary origins and timing of secondary green plastids and in the latter retain a nucleomorph (vestigial nucleus). Green algae are also found symbiotically in the ciliate Paramecium, and in Hydra viridissima and in flatworms.
|
|
In dinoflagellates, the cingulum is a groove that encircles the cell, splitting it into two regions, the anterior episome and the posterior hyposome; the longitudinal flagellum typically lies within this furrow. Similarly, the sulcus is a groove that runs longitudinally and typically contains the transverse flagellum. In Torodinium, both these grooves are extended into the episome, a feature believed to be unique to this genus. Although other genera, including Gymnodinium, Cochlodinium, and Warnowia are already known to possess the anterior extension of the cingulum, the addition of a sulcal extension as well appears to be unique to Torodinium.
|
|
The outron is an intron-like sequence possessing similar characteristics such as the G+C content and a splice acceptor site that is the signal for trans-splicing. Such a trans-splice site is essentially defined as an acceptor (3') splice site without an upstream donor (5') splice site. In eukaryotes such as euglenozoans, dinoflagellates, sponges, nematodes, cnidarians, ctenophores, flatworms, crustaceans, chaetognaths, rotifers, and tunicates, the length of spliced leader (SL) outrons range from 30 to 102 nucleotides (nt), with the SL exon length ranging from 16 to 51 nt, and the full SL RNA length ranging from 46 to 141 nt.
|
|
The dinoflagellate Lingulodinium polyedra (previously called Gonyaulax polyedra) also contains a second protein called luciferin binding protein (LBP) that has been proposed to protect luciferin from non-luminescent oxidation. Luciferin is released from LBP by a decrease in pH, and the same decreased pH also activates the luciferase. Light production in the dinoflagellates occurs in bioluminescent organelles called scintillons and can be stimulated by agitation of the surrounding seawater. The name scintillon was first used to describe cytoplasmic particles isolated from a bioluminescent species of dinoflagellate that were able to produce a flash of light in response to a decrease in pH.
|
|
Infra red spectroscopy, flash pyrolysis, thermally assisted hydrolysis and methylation (THM) in the presence of tetramethylammonium hydroxide (TMAH) of cultured and sediment-derived Lingulodinium polyedrum (Dinoflagellata) cyst walls, Organic Geochemistry, 43, 92-102.Bogus, K., Versteegh, G.J.M., Harding, I.C., King, A., Charles, A.J., and Zonneveld, K., 2012. The composition and diversity of dinosporin in species of the Apectodinium complex (Dinoflagellata), Review of Palaeobotany and Palynology, 183, 21-31. which demonstrates that dinoflagellates are able to produce a completely different biomacromolecule for their resting cysts. Previous descriptions of dinosporin having similar properties to sporopollenin were based on both compounds’ resistance to hydrolysis and high preservation potential.
|
|
Fish species through the food chain are impacted, up to and including large predatory species such as sharks, as well as species typical in human consumption. Gabriel Vargo of the University of South Florida states that, "There is no single hypothesis that can account for blooms of K. brevis along the west coast of Florida". However, like most algae, their occurrence and survival depends on a variety of factors in their environment including water temperature, salinity, light, and nutrients/compounds present in the water. Under favorable conditions, toxin-producing dinoflagellates such as K. brevis flourish and grow to high concentrations, an event termed a "harmful algal bloom" or a "HAB".
|
|
He was particularly interested in a unicellular group of protists called diatoms, but he also studied, and named, many species of radiolaria, foraminifera and dinoflagellates. These researches had an important bearing on some of the infusorial earths used for polishing and other economic purposes; they added, moreover, largely to our knowledge of the microorganisms of certain geological formations, especially of the chalk, and of the marine and freshwater accumulations. Until Ehrenberg took up the study it was not known that considerable masses of rock were composed of minute forms of animals or plants. He also demonstrated that the phosphorescence of the sea was due to organisms.
|
|
Lancelets are inactive filter feeders, spending most of the time half-buried in sand with only their frontal part protruding. They eat a wide variety of small planktonic organisms, such as bacteria, fungi, diatoms, dinoflagellates and zooplankton, and they will also take detritus. Little is known about the diet of the lancelet larvae in the wild, but captive larvae of several species can be maintained on a diet of phytoplankton, although this apparently is not optimal for Asymmetron lucayanum. Lancelets have oral cirri, thin tentacle-like strands that hang in front of the mouth and act as sensory devices and as a filter for the water passing into the body.
|
|
One of their most striking features is the large amount of cellular DNA that dinoflagellates contain. Most eukaryotic algae contain on average about 0.54 pg DNA/cell, whereas estimates of dinoflagellate DNA content range from 3–250 pg/cell, corresponding to roughly 3000–215 000 Mb (in comparison, the haploid human genome is 3180 Mb and hexaploid Triticum wheat is 16 000 Mb). Polyploidy or polyteny may account for this large cellular DNA content, In but earlier studies of DNA reassociation kinetics and recent genome analyses do not support this hypothesis. Rather, this has been attributed, hypothetically, to the rampant retroposition found in dinoflagellate genomes.
|
|
One species, Amoebophrya ceratii, has lost its mitochondrial genome completely, yet still has functional mitochondria. The genes on the dinoflagellate genomes have undergone a number of reorganisations, including massive genome amplification and recombination which have resulted in multiple copies of each gene and gene fragments linked in numerous combinations. Loss of the standard stop codons, trans-splicing of mRNAs for the mRNA of cox3, and extensive RNA editing recoding of most genes has occurred. The reasons for this transformation are unknown. In a small group of dinoflagellates, called ‘dinotoms’ (Durinskia and Kryptoperidinium), the endosymbionts (diatoms) still have mitochondria, making them the only organisms with two evolutionarily distinct mitochondria.
|
|
She noticed that it luminesced in daily cycles, and presented this result at a conference. At that time, biological rhythms were known for a variety of assemblages of cells but Sweeney noted that when such rhythms shifted, it was impossible to tell if all cells shifted or if the population became unsynchronized. To address this question, she studied single cells in Cartesian divers and found that rhythms occurred in single cells that responded similarly to resetting stimuli. John Woodland Hastings (known as Woody Hastings) heard Sweeney present her work on rhythms at a conference in Asilomar in 1955 and became acquainted with her because he shared her interest in bioluminescent dinoflagellates.
|
|
Molecular identification can be applied as a second, confirmatory, diagnostic step in addition to clinical and microscopic identification. Recently developed molecular approaches (PCR and LAMP) have been proven to provide early detection of dinoflagellates in water and gill tissue samples, even when the parasite is present at lowest concentrations, such as in subclinical infections. Therefore, these methods potentially allow for highly sensitive monitoring of pathogen load in susceptible fish populations. Molecular diagnosis of A. ocellatum is based on primers AO18SF (5' GACCTTGCCCGAGAGGG 3') and AO18SR (5' GGTGTTAAGATTCACCACACTTTCC 3') for PCR amplification of a 248 bp segment of the 3’ end of the LSU rDNA gene.
|
|
Smithsonian National Museum of Natural History; Department of Botany. Algae lack the various structures that characterize land plants, such as the phyllids (leaf-like structures) of bryophytes, rhizoids in nonvascular plants, and the roots, leaves, and other organs found in tracheophytes (vascular plants). Most are phototrophic, although some are mixotrophic, deriving energy both from photosynthesis and uptake of organic carbon either by osmotrophy, myzotrophy, or phagotrophy. Some unicellular species of green algae, many golden algae, euglenids, dinoflagellates, and other algae have become heterotrophs (also called colorless or apochlorotic algae), sometimes parasitic, relying entirely on external energy sources and have limited or no photosynthetic apparatus.
|
|
Floridian coral reef Coral reefs are accumulated from the calcareous exoskeletons of marine invertebrates of the order Scleractinia (stony corals). These animals metabolize sugar and oxygen to obtain energy for their cell-building processes, including secretion of the exoskeleton, with water and carbon dioxide as byproducts. Dinoflagellates (algal protists) are often endosymbionts in the cells of the coral-forming marine invertebrates, where they accelerate host-cell metabolism by generating sugar and oxygen immediately available through photosynthesis using incident light and the carbon dioxide produced by the host. Reef-building stony corals (hermatypic corals) require endosymbiotic algae from the genus Symbiodinium to be in a healthy condition.
|
|
The different morphotypes show great resemblance to corals, algae and other objects in the environment and the sea anemone seems to use camouflage, mimicry and masquerade to blend itself into its surroundings, deceive potential prey and confuse potential predators. Phyllodiscus semoni is a zooxanthellate species of sea anemone, housing symbiotic photosynthetic dinoflagellates within its tissues. These are concentrated in the pseudotentacles which are spread out widely during the day to maximise their exposure to the light. At the same time the oral disc, mouth, and tentacles are retracted into the interior of the animal and it is not apparent that it is a sea anemone at all.
|
|
The K–Pg boundary represents one of the most dramatic turnovers in the fossil record for various calcareous nanoplankton that formed the calcium deposits for which the Cretaceous is named. The turnover in this group is clearly marked at the species level. Statistical analysis of marine losses at this time suggests that the decrease in diversity was caused more by a sharp increase in extinctions than by a decrease in speciation. The K–Pg boundary record of dinoflagellates is not so well understood, mainly because only microbial cysts provide a fossil record, and not all dinoflagellate species have cyst-forming stages, which likely causes diversity to be underestimated.
|
|
Pseudo-nitzschia is a marine planktonic diatom genus that accounts for 4.4% of pennate diatoms found worldwide. Some species are capable of producing the neurotoxin domoic acid (DA), which is responsible for the neurological disorder in humans known as amnesic shellfish poisoning (ASP). Currently, 57 species are known, 27 of which have been shown to produced DA. It was originally hypothesized that only dinoflagellates could produce harmful algal toxins, but a deadly bloom of Pseudo-nitzschia occurred in 1987 in the bays of Prince Edward Island, Canada, and led to an outbreak of ASP. Over 100 people were affected by this outbreak after consuming contaminated mussels; three people died.
|
|
As early as 1961, reports of gastrointestinal disorders following the consumption of cooked mussels appeared in both the Netherlands and Los Lagos. Attempts were made to determine the source of the symptoms, however they failed to elucidate the true culprit, instead implicating a species of microplanctonic dinoflagellates. In the summers of the late 1970s, a series of food poisoning outbreaks in Japan lead to the discovery of a new type of shellfish poisoning. Named for the most prominent symptoms, the new Diarrhetic Shellfish Poisoning (DSP) only affected the northern portion of Honshu during 1976, however by 1977 large cities such as Tokyo and Yokohama were affected.
|
|
Many settle within a few tens of metres of the parent colony, but others are probably swept along in warm currents and end up further afield. S. hystrix is a zooxanthellate species of coral, housing symbiotic dinoflagellates within its tissues. It has been found that these symbionts are transferred during the brooding of the larvae and that different species of Symbiodinium are associated with the coral in different parts of its range, a likely example of coevolution and specialization. Another means of reproduction is by asexual means; fragments of coral that become detached from branches can form new colonies if they are deposited in suitable locations.
|
|
Their close association with eukaryotic phytoplankton is supported by phylogenomic evidence suggesting that the Roseobacter lineage diverged from other Alphaproteobacteria at the same moment as the Mesozoic radiation of phytoplankton. Traits involved in symbioses of D. shibae include flagelar synthesis and type IV secretion system under the control of N-acyl homoserine lactone intercellular signal molecules (quorum sensing). D. shibae forms symbioses with Prorocentrum minimum, a toxic red tide-forming dinoflagellate, as well as other dinoflagellates associated with toxic algal blooms. In a mutualistic association, the P. minimum provides carbon sources and some vitamins essential for growth, and while D. shibae provides vitamins B_1 and B_{12}.
|
|
An example of impacts from nitrogen is a shift in the types of plankton that make up their community in Long Island Sound. Over the last several decades, excess nitrogen may have adversely affected diatoms—microscopic, single-celled algae at the base of the food chain, which make shells ('frustules') of opaline silica. When diatoms are less productive, they are replaced by other phytoplankton such as dinoflagellates or blue-green algae, which grow well in waters with high nitrogen levels, but do not need silica.; Such changes in the base of the food chain leads to consequences such as an increase in abundance of jellyfish and decline in shellfish and other fish.
|
|
Cyst of a dinoflagellate Peridinium ovatum Dinoflagellates occur in most aquatic environments and during their life cycle, some species produce highly resistant organic-walled cysts for a dormancy period when environmental conditions are not appropriate for growth. Their living depth is relatively shallow (dependent upon light penetration), and closely coupled to diatoms on which they feed. Their distribution patterns in surface waters are closely related to physical characteristics of the water bodies, and nearshore assemblages can also be distinguished from oceanic assemblages. The distribution of dinocysts in sediments has been relatively well documented and has contributed to understanding the average sea-surface conditions that determine the distribution pattern and abundances of the taxa ().
|
|
Pyrodinium have caused caused more human illnesses and fatalities than any other dinoflagellates that cause Paralytic Shellfish Toxin or PST. It was initially widely believed that the compressum variety was toxic and found in the Pacific while the bahamense variety was nontoxic and found in the Atlantic, but a 1972 toxic algal bloom of Pyrodinium bahamense in Papua New Guinea McLean, Dewey M., "Eocladopyxis peniculatum Morgenroth, 1966, Early Tertiary Ancestor of the Modern Dinoflagellate Pyrodinium bahamense Plate, 1906", "Micropaleontology", 1976 showed this was not the case. It is now known that P. bahamense is a major cause of seafood toxicity and paralytic shellfish poisoning, especially in Southeast Asia, and causes toxicity along Central American coasts.Gárate-Lizárraga, Ismael et al.
|
|
Forensic palynology is the study of pollen, spores and other acid-resistant microscopic plant bodies, including dinoflagellates, to prove or disprove a relationship among objects, people and places that pertain to both criminal and civil cases. Pollen can reveal where a person or object has been, because regions of the world, countries, and even different parts of a garden will have a distinctive pollen assemblage. Pollen evidence can also reveal the season in which a particular object picked up the pollen. Pollen has been used to trace activity at mass graves in Bosnia, catch a burglar who brushed against a Hypericum bush during a crime, and has been proposed as an additive for bullets to enable tracking them.
|
|
Examples include the HU protein in Escherichia coli, a dimer of closely related alpha and beta chains and in other bacteria can be a dimer of identical chains. HU-type proteins have been found in a variety of eubacteria (including cyanobacteria) and archaebacteria, and are also encoded in the chloroplast genome of some algae. The integration host factor (IHF), a dimer of closely related chains which is suggested to function in genetic recombination as well as in translational and transcriptional control is found in Enterobacteria and viral proteins including the African swine fever virus protein A104R (or LMW5-AR). This family is also found in a group of eukaryotes known as dinoflagellates.
|
|
Currently, cyanobionts have been found to form symbiosis with various organisms in marine environments such as diatoms, dinoflagellates, sponges, protozoans, Ascidians, Acadians, and Echiuroid worms, many of which have significance in maintaining the biogeochemistry of both open ocean and coastal waters. Specifically, symbioses involving cyanobacteria are mostly mutualistic, in which the cyanobionts are responsible for nutrient provision to the host in exchange for attaining high structural-functional specialization. Most cyanobacteria-host symbioses are found in oligotrophic areas where limited nutrient availability may limit the ability of the hosts to acquire carbon (DOC), in the case of heterotrophs and nitrogen in the case of phytoplankton, although a few occur in nutrient-rich areas such as mudflats.
|
|
In contrast, parts of the southern Delta have a higher residence time due to the low volume of water moving through the system; in fact the water on occasion runs backwards, due to the lack of inflow from the San Joaquin River, and export pumping. During summer, phytoplankton density may be an order of magnitude higher here than in other parts of the estuary.Ball and Arthur 1979 Harmful algal blooms (HAB's) of dinoflagellates or cyanobacteria produce toxic metabolic byproducts that render them noxious to many organisms. Fostered by a combination of high nutrient concentrations and temperatures, HAB's have a doubly negative effect on the food web by competitively excluding diatoms and microflagellates, further reducing bioavailable primary production.
|
|
While many taxonomists have abandoned Protozoa as a high-level group, Thomas Cavalier-Smith has retained it as a kingdom in the various classifications he has proposed. As of 2015, Cavalier-Smith's Protozoa excludes several major groups of organisms traditionally placed among the protozoa, including the ciliates, dinoflagellates and foraminifera (all members of the SAR supergroup). In its current form, his kingdom Protozoa is a paraphyletic group which includes a common ancestor and most of its descendants, but excludes two important clades that branch within it: the animals and fungi. Since the protozoa, as traditionally defined, can no longer be regarded as "primitive animals" the terms "protists", "Protista" or "Protoctista" are sometimes preferred.
|
|
In marine environments, HABs are mostly caused by dinoflagellates,Stewart I and Falconer IR (2008) "Cyanobacteria and cyanobacterial toxins" Pages 271–296 in Oceans and human health: risks and remedies from the seas, Eds: Walsh PJ, Smith SL and Fleming LE. Academic Press, . though species of other algae taxa can also cause HABs (diatoms, flagellates, haptophytes and raphidophytes).Moestrup Ø, Akselman R, Cronberg G, Elbraechter M, Fraga S, Halim Y, Hansen G, Hoppenrath M, Larsen J, Lundholm N, Nguyen LN and Zingone A. "IOC-UNESCO Taxonomic Reference List of Harmful Micro Algae (HABs)" Accessed 21 January 2011. Marine dinoflagellate species are often toxic, but freshwater species are not known to be toxic.
|
|
The preference of pathway is based upon whether the dinoflagellate host cell is thecate or athecate. To be thecate in dinoflagellates means to have an outer layer of cellulose plates that serves as an extra layer of protection, to be athecate means to not have this covering. If the dinoflagellate is thecate, then the pathway of infection will be nuclear; the process will follow with the de- attachment of dinoflagellate theca. If the host cell is athecate, then cytoplasmic infection will proceed which is indicated by the presence of vacuole-like structures in the cytoplasm, and because the nucleus is not infected first the dinoflagellate cell is resilient for longer than the thecate cell.
|
|
Limnologist Dr. David Schindler, whose research at the Experimental Lakes Area led to the banning of harmful phosphates in detergents, warned about algal blooms and dead zones, > "The fish-killing blooms that devastated the Great Lakes in the 1960s and > 1970s haven't gone away; they've moved west into an arid world in which > people, industry, and agriculture are increasingly taxing the quality of > what little freshwater there is to be had here....This isn't just a prairie > problem. Global expansion of dead zones caused by algal blooms is rising > rapidly." The major groups of algae are Cyanobacteria, green algae, Dinoflagellates, Coccolithophores and Diatom algae. An increase in the input of nitrogen and phosphorus generally causes Cyanobacteria to bloom.
|
|
The Apicomplexa, a phylum of obligate parasitic protozoa including the causative agents of malaria (Plasmodium spp.), toxoplasmosis (Toxoplasma gondii), and many other human or animal diseases also harbor a complex plastid (although this organelle has been lost in some apicomplexans, such as Cryptosporidium parvum, which causes cryptosporidiosis). The 'apicoplast' is no longer capable of photosynthesis, but is an essential organelle, and a promising target for antiparasitic drug development. Some dinoflagellates and sea slugs, in particular of the genus Elysia, take up algae as food and keep the plastid of the digested alga to profit from the photosynthesis; after a while, the plastids are also digested. This process is known as kleptoplasty, from the Greek, kleptes, thief.
|
|
According to this hypothesis, the rhodophytes and glaucophytes retained the ancestral eukaryote's cytosolic starch deposition. Starch synthesis and degradation in green algae and plants is much more complex – but significantly, many of the enzymes that perform these metabolic functions in the interior of modern plastids are identifiably of eukaryotic rather than bacterial origin. In a few cases, red algae have been found to use cytosolic glycogen rather than floridean starch as a storage polymer; examples such as Galdieria sulphuraria are found in the Cyanidiales, which are unicellular extremophiles. Other organisms whose evolutionary history suggests secondary endosymbiosis of a red alga also use storage polymers similar to floridean starch, for example, dinoflagellates and cryptophytes.
|
|
Although a complete genome is not available for Colpidium colpoda, partial sequences have been published for the small subunit 18S rRNA gene and the cytochrome oxidase subunit 1 (cox1) gene and complete sequences for the telomerase RNA gene and the 5.8S rRNA gene. Within the same taxonomic family as C. colpoda is the microbial model organism Tetrahymena thermophila. There is a large body of scientific literature on the T. thermophila genome as a representative of the Alveolates, a major evolutionary branch of eukaryotes that includes all ciliates, dinoflagellates and apicomplexans. Like many ciliates, T. thermophila has a surprisingly complex genome that consists of a germline micronucleus and a somatic macronucleus that function and replicate independently of one another.
|
|
In areas unaffected by the Templeton Delta, depositional rates were low, producing a condensed section composed of organic-rich, calcareous marls, limestones, and volcanic ash beds in both South Texas and West Texas. The microfossils found within the marls are predominantly coccoliths and planktonic foraminifera, whereas the limestones contain abundant radiolaria and calcispheres (calcareous cysts produced by some dinoflagellates). Inoceramus fragments and fish bones are also found in these deposits. During the Late Cenomanian the Sabine Uplift along the modern-day Texas/Louisiana border became active, causing erosion of Eagle Ford and Woodbine sedimentsHalbouty, M. T., and J. J. Halbouty (1982) Relationships between East Texas field region and Sabine uplift in Texas: AAPG Bulletin, v.
|
|
The worms are neutrally buoyant, and have been observed floating along with their mouth parts facing downward, and their hind parts towards the ocean surface. As these worms have shown no ability to swim or otherwise propel themselves through the water, and have no long, protruding appendages to catch prey with, they must rely on filter feeding to survive. Current theories suggest that they reside in the oxygen minimum zone because of its cornucopia of detritus and marine snow, and that the worms produce clouds of mucous to capture particles of food and "snow," which they later draw into their mouths and ingest. C. pugaporcinus has been found to feed mainly on pelagic phytoplankton, as well as pelagic foraminiferans, silicoflagellates, dinoflagellates, and marine protists.
|
|
It is likely that most acritarch species from the Paleozoic represent various stages of the life cycle of algae that were ancestral to the dinoflagellates. The nature of the organisms associated with older acritarchs is generally not well understood, though many are probably related to unicellular marine algae. In theory, when the biological source (taxon) of an acritarch does become known, that particular microfossil is removed from the acritarchs and classified with its proper group. While the classification of acritarchs into form genera is entirely artificial, it is not without merit, as the form taxa show traits similar to those of genuine taxa—for example an 'explosion' in the Cambrian and a mass extinction at the end of the Permian.
|
|
Jellyfish are like other cnidarians generally carnivorous (or parasitic), feeding on planktonic organisms, crustaceans, small fish, fish eggs and larvae, and other jellyfish, ingesting food and voiding undigested waste through the mouth. They hunt passively using their tentacles as drift lines, or sink through the water with their tentacles spread widely; the tentacles, which contain nematocysts to stun or kill the prey, may then flex to help bring it to the mouth. Their swimming technique also helps them to capture prey; when their bell expands it sucks in water which brings more potential prey within reach of the tentacles. A few species such as Aglaura hemistoma are omnivorous, feeding on microplankton which is a mixture of zooplankton and phytoplankton (microscopic plants) such as dinoflagellates.
|
|
A clear paleontological window on cyanobacterial evolution opened about 2000 Ma, revealing an already-diverse biota of Cyanobacteria. Cyanobacteria remained the principal primary producers of oxygen throughout the Proterozoic Eon (2500–543 Ma), in part because the redox structure of the oceans favored photoautotrophs capable of nitrogen fixation. Green algae joined cyanobacteria as the major primary producers of oxygen on continental shelves near the end of the Proterozoic, but it was only with the Mesozoic (251–66 Ma) radiations of dinoflagellates, coccolithophorids, and diatoms did the primary production of oxygen in marine shelf waters take modern form. Cyanobacteria remain critical to marine ecosystems as primary producers of oxygen in oceanic gyres, as agents of biological nitrogen fixation, and, in modified form, as the plastids of marine algae.
|
|
The port of Poti, Georgia The Black Sea supports an active and dynamic marine ecosystem, dominated by species suited to the brackish, nutrient-rich, conditions. As with all marine food webs, the Black Sea features a range of trophic groups, with autotrophic algae, including diatoms and dinoflagellates, acting as primary producers. The fluvial systems draining Eurasia and central Europe introduce large volumes of sediment and dissolved nutrients into the Black Sea, but the distribution of these nutrients is controlled by the degree of physiochemical stratification, which is, in turn, dictated by seasonal physiographic development. During winter, strong wind promotes convective overturning and upwelling of nutrients, while high summer temperatures result in a marked vertical stratification and a warm, shallow mixed layer.
|
|
Palytoxin was first isolated from the zoanthid Palythoa toxica and proved to be an unusually long chain polyether-type phytotoxin. It is now postulated that the substance is synthesized by the dinoflagellates and is subsequently incorporated into the zoanthid tissues; it may be a symbiotic arrangement, and it is possible that bacteria are involved in the transfer. Species of Ostreopsis have been implicated in outbreaks of ill health in countries to the immediate north of the Mediterranean Sea, particularly Spain, Italy and Greece. Along the Ligurian coast of Italy, large numbers of people were affected after visiting beaches in the summer of 2005, and about 200 people sought medical help; symptoms included rhinorrhoea, fever, cough and mild breathing problems, and sometimes conjunctivitis.
|
|
PSP is caused by a mixture of at least 21 different chemical species, some of which undergo chemical transformations within the dinoflagellates or within the animals that acquire the saxitoxins, and which are retained by different animals for different lengths of time. It is clear that PSP-causing toxin levels are typically much higher in the summer months though this does not mean the seafood is necessarily safe at other times. Risks also vary based on species but seafood available for retail sale is required to meet the FDA standards. In PSP poisonings that occurred in the summer of 1993 in Kodiak, Alaska, saxitoxin levels as high as 19,600 μg / 100 g were measured in the Alaska blue mussel Mytilus edulis - sufficient to provide a lethal dose in a single 2.5 g mussel.
|
|
Following the completion of her Ph.D., she followed her first husband to Rochester, MD. She was initially unable to find an academic job in botany, so she worked as a lab technician. She then worked as a postdoctoral fellow at the Mayo Clinic. She again followed her husband to San Diego, and she found employment at the Scripps Institution of Oceanography, where she first began working with dinoflagellates, and began her investigations in circadian rhythms. In 1961 she moved to Yale, where she was appointed a lecturer in algal physiology. However, at Yale she was never given a permanent position, so in 1967, she returned to the west coast, with an appointment at the University of California, Santa Barbara, where she was made professor in 1971, and professor emerita in 1982.
|
|
Chromera velia was first isolated by Dr Bob Moore (then at Carter Lab, University of Sydney) from the stony coral (Scleractinia, Cnidaria) Plesiastrea versipora (Faviidae) of Sydney Harbour, New South Wales, Australia (collectors Thomas Starke-Peterkovic and Les Edwards, December 2001). It was also cultured by Dr Moore from the stony coral Leptastrea purpurea (Faviidae) of One Tree Island Great Barrier Reef, Queensland, Australia (collectors Karen Miller and Craig Mundy, November 2001). With the use of DNA sequencing, a relationship between C. velia, dinoflagellates and apicomplexans was noted. Genomic DNA of C. velia was extracted to provide PCR templates, and when the sequences of the amplified genes were compared with those of other species, biostatistical methods resulted in placement of C. velia on a phylogenetic branch close to the apicomplexans.
|
|
Saxitoxins are a family of at least 21 neurotoxins produced by dinoflagellates that bioaccumulate in the clams and other bivalve mollusks as these algae are consumed and can cause paralytic shellfish poisoning (PSP) when the clams are eaten. According to a 1996 report from the Marine Advisory Program at the University of Alaska, the United States Food and Drug Administration (FDA) considers seafood unsafe if it contains more than 80 μg of PSP-causing toxins per 100 g of tissue of the seafood. It is clear that PSP-causing toxin levels are typically much higher in the summer months though this does not mean the seafood is necessarily safe at other times. Risks also vary based on species but seafood available for retail sale is required to meet the FDA standards.
|
|
Also, a comparison of three Polykrikos species feeding revealed that species differ in their prey preference, and some are more specialized than the other, such that P. hartmanii preying is less diverse (fed on 2 prey species) than of P. kofoidii and P. lebouriae, which fed on 14 different algal species. Predation by heterotrophic Polykrikos became a great topic of interest as some of the organisms graze on dinoflagellates that cause toxic blooms. High predation impact by Polykrikos schwartzii Butschili on toxic dinoflagellate Alexandrium tamarense (Lebour) Balech was reported in Argentina, while Polykrikos kofoidii Chatton was controlling Gymnodium catenatum Graham in Portuguese and Japanese coastal waters. G. catenatum is one of the species causing paralytic shellfish poisoning (PSP) and is found in waters of Australia, Japan, Mexico and Spain.
|
|
A nematocyst is a subcellular structure or organelle containing extrusive filaments found in two families of athecate dinoflagellates (a group of unicellular eukaryotes), the Warnowiaceae and Polykrikaceae. It is distinct from the similar subcellular structures found in the cnidocyte cells of cnidarians, a group of multicellular organisms including jellyfish and corals; such structures are also often called nematocysts (alternatively, cnidocysts or cnidae), and cnidocytes are sometimes referred to as nematocytes. It is unclear whether the relationship between dinoflagellate and cnidarian nematocysts is a case of convergent evolution or common descent, although molecular evidence has been interpreted as supporting an endosymbiotic origin for cnidarian nematocysts. In polykrikoids the nematocyst is found associated with another extrusive organelle called the taeniocyst, a complex that has been described as synapomorphic for the genus Polykrikos.
|
|
The most likely place of origin of the ticks is Northern Gondwana and most probably within the region that now constitutes Eastern Africa. A molecular Bayesian study of Babesia and Theileria species along with Plasmodium species suggests that Babesia and Theileria are sister clades and that they diverged from Plasmodium ~ (95% credible interval: - ) The dating in this study used a date of for the origin of the genus Plasmodium. The authors also estimated that Theileria evolved (95% credible interval – ) and that Babesia evolved (95% credible interval –) Another analysis suggests that Babesia and Theileria are more closely related to the adeleid species than to Plasmodium. An examination of sequences from Babesiidae, Cryptosporiidae, Eimeriidae, Plasmodiidae, Sarcocystiidae, Theileriidae, a Perkinsus species and 2 dinoflagellates suggests that Plasmodium and Cryptosporidium are sister taxa and that Hepatozoon is basal to them.
|
|
5, 2005 (retrieved June 6, 2015) In his Vermium Terrestrium et Fluviatilium, seu Animalium Infusoriorum, Helminthecorum, et Testaceorum non Marinorum, succincta Historia (2 vols. in 4to, Copenhagen and Leipzig, 1773–74), he arranged the Infusoria for the first time into genera and species. His Hydrachnæ in Aquis Daniæ Palustribus detectæ et descriptæ (Leipzig, 1781), and Entomostraca (1785), describe many species of microorganisms previously unknown, amongst other dinoflagellates. To these was added an illustrated work on the infusoria, published in 1786. These three works, according to the contemporary dean of naturalists Baron Cuvier, give the author “a place in the first rank of those naturalists who have enriched science with original observations.” His Zoologiae Danicae Prodromus (1776) was the first survey of the fauna of the combined kingdoms of Norway and Denmark, and classified over three thousand local species.
|
|
Comparison between the structures of the ocelloid (1) and the alt=Grayscale diagrams of the structures of the ocelloid and vertebrate eye, showing analogous positional relationships between the hyalosome/lens and retinal body/retina. Due to the strong structural resemblance between the ocelloid and metazoan eyes, it has long been speculated that the ocelloid functions as a photoreceptor; however, this is difficult to determine experimentally because warnowiids cannot be cultured in the laboratory, and isolates from natural habitats degrade quickly. It has been shown that the morphology of the ocelloid changes in response to environmental illumination, that the ocelloid structure can be disrupted by exposure to extremely bright light, and that it contains proteins with sequence similarity to known light-sensitive proteins. It has been speculated that the ocelloid aids in detecting prey, possibly other dinoflagellates.
|
|
Life That Glows is a 2016 British nature documentary programme made for BBC Television, first shown in the UK on BBC Two on 9 May 2016. The programme is presented and narrated by Sir David Attenborough. Life That Glows films the biology and ecology of bioluminescent organisms, that is, capable of creating light. The programme features fireflies, who use light as a means of sexual attraction, luminous fungi, luminous marine bacteria responsible for the Milky seas effect, the flashlight fish, the aposematism of the Sierra luminous millipede, earthworms, the bioluminescent tides created by blooms of dinoflagellates in Tasmania, as well as dolphins swimming in the bloom in the Sea of Cortez, the defensive flashes of brittle stars and ostracods, sexual attraction in ostracods, prey attraction by luminous click beetles in Cerrado,Brazil and the Arachnocampa gnats in New Zealand.
|
|
Micromonas species still share the same collection of photosynthetic pigments as the members of the class Mamiellophyceae, which includes the common pigments chlorophyll a and chlorophyll b, as well as prasinoxanthin (xanthophyll K), the first algal carotenoid being assigned with a structure that has a γ-end group. It has been discovered that most of its xanthophylls are in the oxidized state and show similarities to ones possessed by other important marine planktons like diatoms, golden and brown algae, and dinoflagellates. In addition, there is another pigment called Chl cCS-170 can be found in some strains of Micromonas and Ostreococcus living in deeper part of the ocean, which may indicate a potential adaptation for organisms that reside under low light intensity. The light-harvesting complexes of Micromonas are distinguishable from other green algae in terms of pigment composition and stability under unfavorable conditions.
|
|
Koji Nakanishi determined the structures of over 200 biologically active animal and plant natural products, many of which are endogenous and/or the first member of a new class. These include ginkgolides from the ancient ginkgo tree, first insect molting hormones from plants, new nucleic acid bases, insect antifeedants, antibiotics, first meiosis inducing substance from starfish, crustacean molt inhibitors, shark repellents from fish, tunicate blood pigments, brevetoxins from red-tide dinoflagellates, philanthotoxin (glutamate and nicotinic acetylcholine receptor antagonist) from a wasp, and the human eye pigment involved in macular degeneration. His studies with retinal analogs and retinal proteins made seminal contributions in understanding the structural and mechanistic basis of animal vision and phototaxis. In 2000, his research group succeeded in clarifying relative movements of the retinal and the opsin receptor throughout the visual transduction process; this was the first such study performed with G protein coupled receptors (GPCR) and contributed in clarifying the mode of action of numerous other GPCRs.
|
|
Bioluminescent Bay at night the Bioluminescent Bay, Vieques, Puerto Rico The Bioluminescent Bay (also known as Puerto Mosquito, Mosquito Bay, or "The Bio Bay"), is considered the best examples of a bioluminescent bay in the world and is listed as a national natural landmark, one of five in Puerto Rico. The luminescence in the bay is caused by a microorganism, the dinoflagellate Pyrodinium bahamense, which glows whenever the water is disturbed, leaving a trail of neon blue. A combination of factors creates the necessary conditions for bioluminescence: red mangrove trees surround the water (the organisms have been related to mangrove forests although mangrove is not necessarily associated with this species); a complete lack of modern development around the bay; the water is warm enough and deep enough; and a small channel to the ocean keeps the dinoflagellates in the bay. This small channel was created artificially, the result of attempts by the occupants of Spanish ships to choke off the bay from the ocean.
|
|
At pH 8, it can be seen that the unprotonated histidine residues are involved in a network of hydrogen bonds at the interface of the helices in the bundle that block substrate access to the active site and disruption of this interaction by protonation (at pH 6.3) or by replacement of the histidine residues by alanine causes a large molecular motion of the bundle, separating the helices by 11Å and opening the catalytic site. Logically, the histidine residues cannot be replaced by alanine in nature but this experimental replacement further confirms that the larger histidine residues block the active site. Additionally, three Gly-Gly sequences, one in the N-terminal helix and two in the helix-loop-helix motif, could serve as hinges about which the chains rotate in order to further open the pathway to the catalytic site and enlarge the active site. A dinoflagellate luciferase is capable of emitting light due to its interaction with its substrate (luciferin) and the luciferin-binding protein (LBP) in the scintillon organelle found in dinoflagellates.
|
|