Sentences Generator
And
Your saved sentences

No sentences have been saved yet

600 Sentences With "written down"

How to use written down in a sentence? Find typical usage patterns (collocations)/phrases/context for "written down" and check conjugation/comparative form for "written down". Mastering all the usages of "written down" from sentence examples published by news publications.

type: All Declarative Interrogative Exclamative

structure: All Simple Compound Complex Compound-Complex

length: All <=10 words 10-20 words 20-30 words 30-50 words

Pemi Paull: But even if you have every note written down, every rhythm written down, if I'm playing strings, how I move the bow, that's my choice.
Many more entered local dialects, which were rarely written down.
Campbell has written down its value by about $1 billion.
It has since written down its investment by 70 percent.
Do you think I've ever written down eating blood before?
It's only written down that "6Ses" gets kind of odd.
Yahoo has since written down most of the purchase price.
It had already written down the acquisition by $116 million.
Where is it written down that I can't do that?
These histories are mostly oral histories and not written down.
Patrick: I wish I'd written down some of the dialogue.
And, many of those expectations aren't always written down somewhere.
By 2016, its value had been written down by $230 million.
Your goals should be written down — short-term and long-term.
This is written down in Department of Homeland Security policy documents.
Major oil producers have written down about $200 billion since 2014.
Pretty sure that's written down in some unspoken internet constitution somewhere.
You'll sleep much better knowing that you've written down your idea.
There was a lot of paperwork; everything was methodically written down.
Most of us have one, even if it isn't written down.
Appointments are written down in a planner that I haul everywhere.
Weren't there rules written down somewhere, and didn't this break them?
In the past eleven years, I've written down the following: CCCONCEPPTCCCCCAAAAACCCCCCCCCCPPCCCCCCPCCCCCCCPCCCCCCC .
"I have jokes written down in my notes app," she said.
This tape would be read manually and its results written down manually.
In these ways we have acquired knowledge that isn't written down anywhere.
It can be written down practically only in mathematical notation: 274,207,281 – 1.
Three years on, its value has been written down by $700 million.
Manuscripts are words written down, but they impart far more than sentences.
It has written down the value of its investment by 70 percent.
Just make sure you have any important Wi-Fi passwords written down.
For example, "Bomb," that interlude, it was just some lyrics written down.
From the outside, what was your grand going-in written-down plan?
Also, in 2012, some 107 billion euros of debt were written down.
By the end of the day, I've written down a million things.
And be prepared: Have targeted, thoughtful questions in mind or written down.
"It's really just a political commitment that's been written down," Cullenward said.
The summary of economic projections is individual forecasts compiled and written down.
MCLEAN: Thank you, I had that one written down just in case. [Laughs].
They don&apost want their actions written down on paper as official record.
In November Disney disclosed it had written down its $603m investment by $157m.
"We were still written down in the file as for donation," Hughes said.
It has written down essentially the entire $9.5 billion it paid for Nokia.
If there isn't much written down then there are a lot of arguments.
They banned the spaces where those words were likely to be written down.
"I could see the name Christopher Lisi written down it," Ms. Lisi said.
The rules of the democratic process are written down in black and white.
If you're hoping to get something written down on paper — just do it.
Other questions the former FBI director answered were written down on paper beforehand.
Tokarczuk offers a clue by way of her narrator: what we have written down.
In my notes, I have written down specific numbers about St. Thomas' cooperative commonwealth.
If I have a particular idea or score written down the visuals come automatically.
But it was just so weird seeing 1.142 billion written down as 1142 million.
There is nothing written down about this, even for members of the royal family.
A few years after the acquisition, Yahoo had written down the site's value significantly.
Our phone was under surveillance and all of our phone conversations were written down.
This amenability to being written down makes rational numbers the ones we know best.
Student Opinion Have you ever written down a secret in a diary or letter?
Altria has already written down its investment in Juul by more than a third.
I've written down a lot of ideas but there's nothing even close to a script.
It's not written down anywhere, but some modicum of decorum is expected with that pass.
Accrued income of around 40 million pounds will also be written down as a charge.
But such demands are not enshrined in Chinese legislation; they are not even written down.
For example, if you have written down 150 names, 20 percent would be 30 names.
These Black jokes are Black joy, written down on the web and transmitted among us.
Do you have any sort of written down commandments for the Church of Infinite You?
Interviewer: Let me finish, because I really want ... Trump: Because I have it written down.
Some of the most memorable lines from history's most well-known speeches weren't written down.
None of the other places I'd written down were where they were supposed to be.
In fact, there's a fair amount of stuff that's already been written down to 1945.
It's a password that's been written down, and we all know that's a no-no.
Accrued income of around 13 million pounds will also be written down as a charge.
This immense number can only be practically written down in mathematical notation using exponents: 2⁷⁴,²⁰⁷,²⁸¹ − 1.
In our survey 51% of Americans over 65 had written down their end-of-life wishes.
" She continues: "It's written down, so it's there to look back at, time and time again.
"The past is what's written down," Jill Lepore writes in her new book Joe Gould's Teeth.
They may also have written down private notes about a person that they wouldn't want shared.
I'm going to have to get the facts because they have a whole thing written down.
Interviewer: Let me finish, because I really want ... Donald Trump: Because I have it written down.
But they had been written down in skeletal form, often with just vocal and bass lines.
If your music is not fixed in a tangible medium (recorded, written down, etc.), it's not protected.
Music is central to Yazidi religion and culture, but it has never been written down or recorded.
These are a bunch of principles that I had written down ... That you've gotten over the years.
Written down, these ingredients make RINA sound overtly nostalgic or kitsch, but it doesn't feel like that.
It's not written down in any federal statute, and it's not part of the rules of evidence.
However, people had been making the drink for quite a while even before it was written down.
"When people say Native American food was lost, it's because it was never written down," he added.
And because they are written down, emails are treated like formal memos rather than like informal conversations.
By the time he was investigating new cat foods, he had written down his prerequisites for romance.
By the time he was investigating new cat foods, he had written down his prerequisites for romance.
Common-law crimes are no harder to define with precision than crimes written down in a statute.
"I've literally have written down every single workout I've done for the past five years," he says.
"The evidence here is written down for you," prosecutor Michael Marando said in his closing argument Wednesday.
"If you're Netflix or Amazon or whatever, you don't actually need the matrix written down anywhere," Aaronson said.
All of them were walking textbooks of moves, counters and various other tricks not recorded, nor written down.
The bonds will be written down temporarily if the bank's Common Equity Tier 1 ratio drops below 5.125%.
The bonds can be written down temporarily if the bank's Common Equity Tier 1 ratio falls below 5.125%.
He can count from one to 10 but cannot identify certain numbers written down in front of him.
"Despite repeated and diligent searches, I have not been able to find them written down anywhere," she said.
This whole story was written down in the Book of Esther, otherwise knows as the Megillah of Esther.
"I had written down a lot of my recipes back then, and then I lost them," she says.
The bond will be permanently written down if the bank's Common Equity Tier 1 ratio drops below 7%.
But the yearbook reference is a reminder that not everything that happened that summer was necessarily written down.
The words all sound ridiculous written down here, but from the fiend Dafoe creates, they just feel true.
I want my phone to act like a paper calendar where an appointment written down for 11 a.m.
But not all such policies were explicitly written down and tracked, giving many female teachers little legal recourse.
That's why the court grants "unenumerated rights" — rights that aren't written down but are inferred from the constitution.
"My experience with China is when a numeric target gets written down, it gets implemented," Mr. Myllyvirta said.
After you have all the individual costs written down, add them together to find your minimum monthly expenses.
Honestly, I know you have it written down and you're going to tell me 'What do you think?
Perhaps surprisingly in a country notable for its strict rules, relatively little of Saudi law is written down.
Maybe next time at the Metropolitan Opera I wouldn't have to improvise — it would actually be written down.
Advertise on Hyperallergic with Nectar Ads "We think of language as either spoken or written down," Medrano said.
It's one of those stories that people retell around the campfire; it's written down in so many different scrolls.
"I make lists in my phone," Awesome said, reading off some of the things he's written down to accomplish.
It was the kind of stuff you always heard about happening but you never thought you'd see written down.
When presenting full-year results, several Italian banks said they had written down in full the investment in Carige.
In a digital exclusive for NBC, Goldsmith said that he had that particular lyric written down for a while.
What about knowing what a writer had never written down — wasn't that the real knowledge of who she was?
Quite literally all debts were written down, so you just wiped them clean when there was a new monarch.
The bond will be permanently written down if the bank's Common Equity Tier 1 ratio drops below 7 percent.
Ramsay offered his condolences and gave Lisa a business card with his personal phone number written down the side.
Banks must also issue debt that can be written down to help replenish capital burnt through in a crisis.
The euro-denominated bond will be temporarily written down if the bank's Common Equity Tier 1 ratio breaches 5.125%.
Petitioners seeking to see communications pertaining to the attack were told much of the analysis was not written down.
The document showed that UniCredit had written down its 686 million euro stake in Atlante by 547 million euros.
Around the same time, there was a push to document Aboriginal culture and language, which was rarely written down.
But don't worry, it's going to keep doing all of that according to a policy that's been written down.
Similarly, rapper Kanye West claims to have not written down any of the lyrics of his first several albums.
The equations can have an infinite number of solutions, and few of the solutions can be written down exactly.
He's stopped in spurts and has written down pro and con lists to see whether he can move on.
But with her health on the line, this exclusive recipe needed to be written down as soon as possible.
The rules are not written down, because they can be altered at a moment's notice, former students and employees said.
"Grover supports Trump's tax plan as written down on paper," a spokesperson for the organization said after Norquist's CNBC appearance.
In recent months UniCredit, Italy's largest lender, has written down bad debt by €250bn ($211.7bn) and tapped shareholders for €213.4bn.
Other oil firms including Exxon Mobil, Conoco Phillips and Statoil have written down or sold their Canadian oil sand assets.
The Toyota van lacked license plates, although the security guard had written down the number from a temporary registration sticker.
I'd written down some questions, but I also decided before sitting next to Sophia that I wouldn't look at them.
Those subordinated loans, the conditions of which do not envisage a conversion, will be written down according to the law.
In a way, some of the gravitas and just the buoyancy of what the characters were feeling was written down.
Those poems were cast in rhyming stanzas so they could be transmitted orally over generations before they were written down.
The Facebook executives said they had written down a list of 60 questions they pledged to answer, the aides said.
Little over a year later, after sacking Lynch, Whitman had written down the value of the acquisition by $8.8 billion.
The bonds will be written down on a temporary basis should the bank's Common Equity Tier 1 fall below 5.125%.
Moroccan Arabic is also not written down traditionally, hence the lack of support for teaching Moroccan children in the language.
The recipe for a Whiskey Sour was first written down in the 1862 book The Bartender's Guide by Jerry Thomas.
And even thinking about song, that we just know but have never written down, and it gets carried through generations.
The information was written down, stuffed in a hospital mailbag and sent by air to Kathmandu, around 90 miles away.
The gunman in Christchurch had names written down the side of his rifle evoking past crusades by Christians against Muslims.
"A deal that isn't written down isn't a real deal," Senator Ron Wyden, Democrat of Oregon, said in a statement.
But I'll bet you didn't actually have "worry about collapse of the government" written down on your schedule for February.
Hutchinson's lines listen to themselves, finding the next phrase, and then the next, implicit in what's already been written down.
The phone number for the concierge, which Sonder says you can call or text 24/7, was also written down.
Trump on Wednesday said the agreement is still being "papered" — meaning that the details have yet to be written down.
That way, if one of us gets inspired by a crossword idea or entry, it can easily be written down.
"It's where he made [the campaign promise] and when he made it — he's got it all written down," Meadows said.
During my five years in the Middle East, the rules changed almost every day, but they were rarely written down.
Lovaglio said the bank had already written down the loans to be sold, offsetting the hit with one-off capital gains.
No matter how much data you feed an algorithm, there are certain types of knowledge that can't easily be written down.
It's likely that singular "they" was used even earlier, given that words often exist in speech before they are written down.
A lot of people would have held onto that idol, knowing it wasn't their name being written down at tribal council.
In fact most of the constitution is written down, but not all in the same place or with the same standing.
"What he said from what they had written down is he was tired of being messed around," she tells the table.
It is likely that the world is just seeing more unfiltered thoughts written down than at any other time in history.
But the stories were never written down, and at this point most of the storytellers, like my dad, have passed away.
Banks must issue debt that can be bailed-in or written down to raise funds when core capital is burnt through.
I also know she usually wings public speaking gigs with no preparation, but in the video she has things written down.
The story, written down around 15533, is about St. James the Great, who chilled with Jesus more than 2,000 years ago.
Moreover, China would have to ensure that existing bad debts are written down and bankrupt SOEs shut—a tall order politically.
He recited talking points, read prepared answers written down in advance and ended the briefings as quickly as he possibly could.
It has since then laid off most of the employees it gained in that acquisition and written down its entire value.
So, in 1606, he endorsed the ideas Copernicus had written down a half-century earlier in the De revolutionibus orbium coelestium.
It's all written down and the way you change the Constitutions is so prescriptive and so prohibitive that it never changes.
"She had vague instructions to herself pinned in the kitchen, written down the side of chopped up cereal boxes," remembers Holland.
This debt can be "bailed in" or written down if the bank gets into trouble to avoid taxpayers footing the bill.
For security reasons the codes couldn't be written down; the Signal Corps operators had to memorize them each time they changed.
The informant's account was written down in an investigative report prepared by a Drug Enforcement Administration agent working on the case.
This is the body of laws that was written down after the death of the Prophet Muhammad, where it is codified.
Let's say you have a sequence of amino acids — the building blocks of proteins — written down on a piece of paper.
In the oil and gas division, three large competitors have emerged from bankruptcy protection with reduced debts and written-down assets.
"I got something written down, they asked me to kinda stay on course, or whatever the case may be," LeBron said.
Margins were also helped by fewer batches of products being written down and lower production costs due to changes in suppliers.
But it's worth treating the parts that are written down as, for now, roughly accurate quotations of both Trump and Zelensky.
That's written down as an equation: GDP = G + C + I + NX. But this is an accounting procedure, not a causal theory.
The value of the four banks was written down to 1.4 billion from 1.8 billion euros in April due to restructuring charges.
Do you have something like a vision board or a five-year plan written down somewhere where you think about your goals?
The coco bonds, a post-crisis creation, worked as they were supposed to: swapped for equity and written down if need be.
MREL requires that banks hold sufficient liabilities that can be written down to avoid taxpayers carrying the burden of future bank failures.
Whenever I encounter something, I have those principles written down, that's what the book is, but mostly a collection of those principles.
Top firms have since written down or sold off billions of dollars in Canadian production assets and decamped for U.S. shale fields.
Additionally, Samsung's revenues for the quarter have been written down too, from 49 trillion won to 47 trillion won (about $1.77 billion).
My father had every one carefully written down, as scrupulous with all of them as no one else ever was with him.
The value of the four lenders has already been written down by 400 million to 1.4 billion euros due to restructuring charges.
But people "definitely forget" that the debt can be written down, said Filippo Alloatti, a senior credit analyst at Hermes Investment Management.
BPH said it had written down 916 million zlotys ($242.2 million) goodwill, and created restructuring provision of 212 million zlotys last year.
Nearly every major oil and gas company has written down their reserves to better reflect the lower values when prices are down.
In fact, documents should be revisited periodically because laws change and people forget what they had written down years ago, he said.
It has written down virtually all of the acquisition price of the takeover, which cost former Kinross CEO Tye Burt his job.
Within weeks, Mr. Culp had sharply written down the value of G.E.'s power division with a $22 billion good-will charge.
For me, I guess that was DOOMSDAY CLOCK, which I had recently written down with intent to build a puzzle around it.
"Apparently my mother had written down the name of the hotel on a piece of paper then lost it," Ms. Hicks wrote.
This type of debt is written down to replenish core capital buffers during a crisis to avoid taxpayers having to step in.
"It was never written down, but it's not an accident you got states in pairs," says Louisiana State University historian Jonathan Earle.
Would it be right to compel someone to divulge the meaning of such private thoughts, simply because the thoughts were written down?
Lists of hard-to-remember and frequently changed passwords are typically written down and kept within easy reach of the person's computer.
The two groups were hit hard: all shares were annulled, while €2bn of bonds were bailed in then written down to zero.
Written down, it sounds like a troubled, frustrated request—but through it's breezy delivery, Us finds Rodriguez more at ease and, well, happier.
The Walt Disney Company disclosed in its second quarter earnings report that it had written down its $353 million stake in Vice Media.
People were describing my symptoms, like my sound sensitivity, or my loss of language, or things that are not written down the literature.
"I had written down three things I wanted to do with the rest of my life after 9/11," Ms. Agrawal told me.
"There's not a head coach's manual to go by, but especially nobody's written down how to deal with something like this," Walden says.
She'll call or email them first, then go speak with them in person, but nothing is recorded or written down until after that.
I had written down the address and code on a piece of paper knowing I wouldn't be able to access the Airbnb website.
Even if those were written down in full or swapped for shares, the bank would still need 700 million euros of new cash.
After these tragedies, the fairy-tale couple settled in a secluded estate in Italy, where they lived a life that wasn't written down.
She had it written down and this was exactly the kind of thing he'd been backing away from, as she moved toward him.
She scribbled on the edge of her newspaper and handed him the scrap of paper she tore off: she'd written down her address.
Overall, Vice has shed 2093% of its staff, raised $250 million in debt, and had its value written down this year by Disney.
Spiegel cited sources as saying that Volkswagen has already written down the value of its Gett holding to 16 million euros ($18.3 million).
Deutsche has issued about 5 billion euros' worth of bonds that can be written down if its equity falls below a minimum level.
Privately held, its mutual fund investors have in recent months written down the value of their shares, suggesting it's worth about $10 billion.
Every quarter since then, every Googler has written down her objectives and key results, and they posted them internally, and they've graded them.
All instruments issued by Yes Bank, which qualify as Additional Tier 1 capital will be written down permanently, according to the RBI's plan.
All instruments issued by Yes Bank, which qualify as Additional Tier 1 capital will be written down permanently, according to the RBI's plan.
Toshiba has already written down the value of NuGen's assets, but has been constantly injecting cash in order to keep the project running.
He was speaking — as he does in media interviews — with careful space between words, thinking about how they'll look when they're written down.
The questions have to be written down by hand on little cards directed at one side or the other and can't be anonymous.
We expect that Austria will continue to make payments on the notes in accordance with their original terms if their principal is written down.
Purchases of "necessary supplies" that are less than $2154 can be written down manually, and handed in to the local FEMA office for processing.
However, the sales are mostly of loans already written down heavily on bank balance sheets and unlikely to result in any substantial further losses.
"It's not been written down anywhere, but you have to assume," Ed Brookover, the campaign's liaison to the Republican National Committee, said of Manafort.
As an example, Yahoo has spent over $2.3 billion on acquisitions since 2012 and has already written down $1.2 billion relating to those acquisitions.
"I do want you to be informed — I want you to have written down the numbers and created a simple Excel model," he says.
This kind of prose is hard to process, especially for non-native speakers, even more so when it is spoken rather than written down.
Analysts have noted that any divestiture will come under the cloud of the company having just written down it biggest brands by $15 billion.
The fund said this week that independent auditor Deloitte had written down Atlante's 3.5 billion euro investment in the Veneto banks by a quarter.
To get regulatory approval, banks had to sell some bonds that could be written down or 'bailed in' to absorb losses during a crisis.
The French parent doesn't expect profitability for another two or three years and has already written down part of its investment on the factory.
Stew simply pointed at the sax and trumpet players to come in on a certain beat; no notes were named, let alone written down.
Since 2015, Australian traditional media companies have written down the value of their assets by $4 billion in total, according to Thomson Reuters data.
"I would take an hour and make up some opera that was never to be written down, or heard, by anyone else," he recalled.
But on Saturday his remarks had a distinct through line, anchored by the talking points his campaign had written down on pieces of paper.
The Latin phrase "gradatim ferociter" written down the side is Blue Origin's motto, and it symbolizes the company's approach to space flight, Bezos says.
As ever with Young Fathers, that looks bleak AF written down but is turned into a rich, pulsing slice of a three-minute song.
Written down alongside other personal belongings that included spoons, forks, hogs, cows, and a sofa were my great great grandparents, Thomas and Carrie Richardson.
This is the corpus of Islamic jurisprudence that was written down and shaped after the death of the Prophet Muhammad in the seventh century.
Rule of law depends not just on what is written down, but also on the behavior of those who interpret and enforce that rule.
Former staff members described questionable spending and sloppy bookkeeping, including a $160,000 loan to the executive director without interest that was never written down.
"The risk-reward in the subordinated part of the riskier Italian banks may be written down but the senior debt will perform," Gargour said.
No. 2, even if we end up having a 'phase one' written-down truce, it doesn't remove the uncertainty cloud going into the election.
If written down, the Tier 2 notes would rank pari passu with KTB's other Tier 2 loss-absorbing instruments that have write-down features.
Hedgeye said the company has written down its weak businesses, and will benefit from strong growth in movies, music, gaming consoles, and life insurance.
Mr. Pringle was eventually able to prove that an interrogating officer had written down his alleged confession before any interrogation had actually taken place.
Who thought "trots along like a sleepwalker" (try to picture that) or "a bullet is instant destiny" should be written down in any language?
Leadership also addressed two questions from the crowd, which had been written down and were read out by Robert Gibbs, the company's chief communications officer.
What you need to know is so straightforward, they argue, that it can be written down on a single card and posted on your fridge.
The value of assets held by private-equity firms with any public stub had to be written down, resulting in those poor first-quarter results.
It requires that from January 2022, banks hold sufficient liabilities that can be written down to avoid taxpayers carrying the burden of future bank failures.
In court documents Mr Cotten's widow says that "despite repeated and diligent searches, I have not been able to find [the passwords] written down anywhere".
This is an extraordinary moment in the life of America's constitution which, though written down, has meanings that the justices find to be ever-changing.
Instead, Nance came back to him with the show concept he had written down in graduate school that would evolve into Random Acts of Flyness.
"She had written down how she wanted to do it, the best way to do it," Police Chief Jay Parrish said, the Gainesville Times reported.
When the bill arrives—usually months later—compare your notes to what's written down and dispute any discrepancies in writing to create a paper trail.
Its provenance is unknown: It was probably written down in the tenth or eleventh centuries, but it's impossible to tell when it was actually composed.
And who's writing all these government-style reports that seem to recap events that are far too recent to have been analyzed and written down?
The Virgin is said to have confided three secrets to the children, which were not written down until 1941, when Lúcia started writing her memoirs.
Shirelyn showed me a notebook in which she had written down the promises Mr. Duterte made in his first address to the country as president.
If you ask me personally, I just want the truth and for this black period to be written down so this does not happen again.
The rules, negotiated by Republican Senate leadership, have yet to be written down, causing confusion among reporters and the Capitol Police expected to enforce them.
"Excluding the impact of accrued income written down, our guidance regarding trading performance for 2016 remains as last stated on 8 December 2016," it said.
Over the past year or so, ExxonMobil, ConocoPhillips, Royal Dutch Shell, BP, Chevron and Norway's Statoil have either sold or written down tar sands investments.
Ms. Robertson did not know the password or recovery key and could not find them written down anywhere "despite repeated and diligent searches," she wrote.
Nordstrom has written down more than half the value of Trunk Club, the online personal styling service it purchased in 2014, the company just announced.
It wasn't the only weird thing at the Kentucky Derby—there was also a horse in the race with "Free Murdoc" written down its leg.
"One thing that was written down on the piece of paper she was writing on said 'two weeks and I'll be back at it,'" Scott explained.
I have written down what I consider the points of no return—mainly around pain, lack of control of bodily functions, loss of mind and dignity.
It has a few formal terms: job title, working hours, initial pay, and so on, but many of the most important duties are not written down.
New York Attorney General Eric Schneiderman is investigating why Exxon Mobil (XON) hasn't written down the value of its assets, two years into the oil collapse.
In fact, the real point of the application may be to simply get a recognized standard for what is—and isn't—Neapolitan pizza written down somewhere.
"There are so many rules when dressing for work, especially in a male-dominated environment like finance, and none of them are written down," she explains.
Those words, now written down, all these years on, seem so tame, so lame, so unbearably meaningless, but that's what words are, that's what language is.
But — written down, devoid of intonation and context — it took on another meaning: that those teams are rather stronger in theory than they are in practice.
Chesapeake has suspended its dividend to preserve cash, cut about 15 percent of its workforce and written down the value of some oil and gas assets.
It's not the best place to get ideas, as they can't be written down immediately, but thankfully I was able to hold on to this one.
Net of writedowns bad debts stood at 32.46 billion euros up from 31.95 billion in July, indicating banks had shed loans that were heavily written down.
Although that crucial nuance was written down on what is known as a grand jury synopsis sheet, the document was never given to Mr. Washington's lawyer.
Those seated, as asked, whispered the written-down words as the musician approached and then spoke the word clearly when he or she was in earshot.
The full name of the car is the 1962 Ferrari 400 Superamerica LWB Coupe Aerodinamico, which, when written down, is about as long as the car itself.
In all cases of music copyright, the song/melody/lyrics/composition have to exist in a "fixed medium"—that means written down, recorded, even carved into stone.
Now, again people are beginning to do this, and sometimes it's not even written down, it's described in different ways, but not using notation that we use.
At the end of the book, you've got him up in Canada drinking and listing all his movies, written down on paper and through the box office.
Choose taking the people of our nations to the polls on one of the most important issues of a generation with nothing written down and no plan.
On top of that, a lot of the billing is written down on actual paper and then faxed to various parties, making it prone to human error.
By applying these methods more broadly, we might be able to hone in on when, where, and by whom history's most enduring book was first written down.
A group of integrated oil companies had written down assets worth $103 billion since the start of 2014, Jefferies analysts wrote in a note earlier this month.
"When we close the envelopes, that's the only place that the winner is written down," Cullinan said, explaining that he and Ruiz personally stuff all the envelopes.
Schneiderman's office has also inquired why the oil major had not written down the value of its assets in the wake of a slump in oil prices.
Tsai also hired a full-time researcher and translator, who discovered a book of Japanese beauty rituals written down in 1813, on which her beauty line draws.
However, the Windows Phone platform never took off, and the company has since written down the value of the Nokia purchase and essentially exited the phone business.
More than two-thirds of Africa's land is still under customary tenure, with rights to land rooted in communities and typically neither written down nor legally recognised.
A gross 116 billion pounds of existing bank debt will have to be rebadged so that investors are fully aware it can be written down, it said.
When these securities lost value and had to be written down, the Reserve Fund's cash turned out to be worth less than 100 cents on the dollar.
Because much early music was not written down, and because performance styles and expectations have changed over the centuries, devotees spend a lot of time debating authenticity.
The issues are notched down twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
"If a written down policy exists, or you take a stand on a nuclear aspect, I think you are truly giving away your strength in nuclear," Parrikar said.
Many do not know that the Bible was once a "living document," passed orally from person to person, and from generation to generation, before finally being written down.
The first is that, because there's no standardized format for metadata, information often gets discarded or entered incorrectly as it's written down or moved between people and databases.
Living, burning poetry already seemed traduced when it was plucked from the air and written down, forced into rhymes and sonnet forms; his was demotic and free-flowing.
Mr. Castor said that while it was not a formal agreement, his decision to not prosecute had been written down in the form of a signed news release.
It has a few formal terms: job title, work hours, initial pay and so on, but many of the most important duties and obligations are not written down.
But Nokia's interim report showed on Thursday it had written down 141 million euros ($164 million) of goodwill on the business for which it paid 170 million euros.
You don't need to hear Jacobson reading Trump's list of pocket mantras out loud to make the joke land: Seeing them written down does the work for you.
Before Patricio joined Kraft Heinz in April, the company had written down the value of its two of its biggest brands, Kraft and Oscar Mayer, by $20203 billion.
"I figure whatever I can remember from what I've written down is what I really have to do, and everything else is kind of b------t," Lewis says.
Unfortunately, that critical information — that network intelligence — isn't written down in a book somewhere or on an online forum, but generally is uncovered by extensive networking and gossip.
Intesa Sanpaolo, which together with UniCredit is Atlante's biggest investor, on Friday said it had written down the value of its stake in the fund by 22015 percent.
The rules add a layer of debt that can be written down to cover losses or converted into equity to restore own funds, ahead of existing senior notes.
Steinhoff has already written down the value of its assets by more than $12 billion following the initial findings of an investigation into the company's past bookkeeping practices.
Twenty-First Century Fox, which invested $160M in DraftKings over the summer, has written down the investment by about 60 percent, according to its 10-Q filed today.
I asked Bembibre if she could envisage some kind of public access smell library in the future, or whether aroma descriptions will just be written down and stored.
Also, we bet Fernández-Feo had a good reason for pulling out his phone: It might have been where he had his questions for the actress written down.
TLAC debt, intended to avoid a repeat of the taxpayer bailouts after the 2008 financial crisis, can be written down if regulators deem a bank to be failing.
These are much more challenging legitimacy critiques to raise, because they imply a set of standards that, unlike election rules, have generally never been codified or written down.
I try to help my students see fairy tales as living narratives that underwent countless changes as they were told, written down and eventually adapted for the screen.
I've written down rules of how the brand talks — the stuff coming from the account has to sound like it's coming from a perfumery rather than Bernie supporters.
Vice investor Disney has already written written down its entire $400 million investment in the company, signaling that it doesn't expect to see any return for its money.
By that point, the new religion, called Islam — "submission, surrender" — had found its footing and attracted followers, though the words Muhammad heard had been only partly written down.
The stock market reacted positively to the news on Friday, although the verbal agreement has yet to be officially written down or signed by leaders of both countries.
He developed the taste profile for The Classic after finding the first hot sauce recipe ever written down anywhere: a classic recipe that was just peppers, vinegar, and turmeric.
In light of declining global energy prices, the company recently said that 20 percent of its assets, which are key indicators of its financial health, could be written down.
Maria learned quickly that unless my routine for the day was written down, there was a high chance some or all of the things weren't going to get done.
You should also know what your rights are if you get arrested, bring first aid supplies in case things get violent, and make sure you've written down emergency numbers.
Steinhoff has already written down the value of its assets by more than $12 billion following the initial findings of an independent investigation into the company's past bookkeeping practices.
Some experts say the device helps reduce the anxiety students might feel while taking notes in class and making sure that the information they are learning is written down.
But the downside is that once the pattern for recall becomes "look at your list" versus "rack your brains," remembering things is more contingent on having them written down.
It said that had Rio Tinto properly written down the assets, its net earnings for the first half of 2012 would have been reduced by more than 50 percent.
The SEC said Iconix had maintained relationships with Carter related to the Rocawear brand, which it had written down by close to $203 million over the past two years.
The bond, expected to be BB+/BB+/BBB- by S&P/Fitch/Scope, will be permanently written down if the bank's Common Equity Tier 1 ratio drops below 7%.
The company also said it had written down the value of its 18.8 percent stake in Beingmate after the Shanghai-based business this year forecast losses earlier this year.
In words, written down on a page like this one, it's hard to really specify what the feeling you get when playing this game, that I felt, actually is.
A year before — or months before — I went to AOL, I had written down basically either at Google or someplace else, find the most challenging thing I could find.
Write a word and EssayBot does its best to think up a sensible follow-up clause, based on the contours and language of what you've already got written down.
Countries in such straits usually go through ad hoc bankruptcies known as sovereign debt crises, in which the currency is devalued and debts defaulted upon and/or written down.
I just have an idea, a few lines I've written down and sort of talk myself through it on stage and then keep refining it and figuring it out.
At some point a story might emerge from an anecdote or a memory, or a page from a book, and eventually we realize it has to be written down.
People voted; their votes were counted and written down on paper "preference cards," and those cards were collected for safekeeping in the event of the need for a recount.
The arcane rules governing a Senate impeachment trial have been revised several times since they were first written down in 1868, during the impeachment trial of President Andrew Johnson.
The deal may unravel before it is written down, let alone signed by the two countries' leaders next month at the Asia-Pacific Economic Co-operation forum in Santiago.
By the fourth day I'd written down all these lives and I went to meet Shirley [MacLaine] in her house and I was excited to tell her what happened.
Fashion words are notoriously difficult to pronounce, and unless you hear the names of certain luxury labels spoken, rather than just written down, it's easy to slip up in conversation.
"The proof has now been completely written down, but it's a mess," said Gross, who said that he and Siebert hope to complete it by the end of the year.
Prior to the sale, the preferred stock and perpetual Tier 1 convertible notes issued by Popular were fully written down and subordinated debt (lower tier 2) was converted into equity.
So, for most of my adolescent and adult life, I've always written down everything bothering me—essentially everything I felt I needed to do in life—before going to sleep.
Of course, the bigger breakthrough is Trenton finding the password written down on a post-it on the fridge, letting the crew uncover Jacobs presumably torrid affair with a judge.
The BoE has set a 2022 target for major banks to be resolvable, such as forcing them to hold special debt that can be written down to replenish capital buffers.
He would get out the notebook in which he had written down the lyrics of movie songs, because he liked to sing and hoped that somebody would ask him to.
"But we want that written down in law, we want that in a treaty so that we know that the UK will not be undercutting the EU with lower standards."
"It's important that these losses are chronicled and written down," said Justin Levinson, the East Village resident who created the map last September and said the similar name was intentional.
Carlsberg has written-down its Russia brand following a drop in sales, but Cees 't Hart, chief executive of the world's third-largest brewer, has sought to allay investor fears.
But the format also reflects how we consume information ("Instagram exists, Vine exists"), how most of us work, even how an inner monologue might look if it were written down.
The Electronic Frontier Foundation (EFF) has stated that the warrant was unconstitutional, and others have pointed out the homepage of Playpen didn't match what was written down in the warrant.
Much of recorded history has been the story of fathers and sons, with women written down merely as the familial covalent bonds that connected them when they were recorded at all.
While informal "watercooler" talk is nothing new at work, the fact that it's all written down is, said Anne Curzan, professor of English at the University of Michigan and linguistic researcher.
Book swaps occurred via a complex (and never written down) system, and everyone held a mental tally of which stories they'd already read, and what they were happy to read again.
That no longer seems to be the case; markets have not only written down Mr. Bush's odds, but they've also largely written off the chances of Chris Christie and John Kasich.
Preferred stock is rated five notches below the VR, twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
"Worst case would be if a compliance lawyer has just written down some sort of standard risk assessment, altogether detached from the business, just to comply with the law," he added.
Coca Cola, for example, has written down about $132 million since the beginning of 2015 and has warned that future write-downs are also possible if the situation continues to worsen.
After the financial crisis, regulators have forced banks to bolster their capital with these special bonds that buyers agree can be written down in a crisis to avoid a taxpayer bailout.
This is the fourth time Camden, New Jersey-based Campbell has written down the value of its fresh unit since September 2016, knocking about $1.35 billion off its value in total.
The backup words, meanwhile — which should be written down on paper and stored carefully — are the key to getting access to your wallet in the event that you lose your phone.
"They want to have the key code written down for them because it provides a sense of confidence and security in case they need it at a future date," she said.
She wants to make it easier for journalists and researchers to track these cases and what happens in the courtroom is often as important as what's written down in case logs.
The company has already written down the acquisition by $185 million, but on Monday Perrigo said it had identified additional "indicators of impairment" among certain intangible assets acquired in the deal.
Il Messaggero said the loans, which Monte dei Paschi has written down by 63.3 percent, would be sold at a 70 percent discount, leading to a 4 billion euro capital shortfall.
It appears in the oral Torah that was written down around A.D. 200, a time when much of the world was unaware of the existence of a Jewish community in Ethiopia.
"I have already written down two names, in descending order, and put them in sealed envelopes in two different regions," Qaboos said in a 1997 interview when asked about the succession.
He replied that a major change was the invention of the telephone, explaining that things that had been previously written down were no long committed to paper, a loss to historians.
She had written down the name and address of a rink where Kerrigan was practicing in Cape Cod, MA. That's reportedly where they initially planned to attack her before relocating to Detroit.
Members of the list of 30 lenders will also have to begin holding bonds from 2019 that can be written down to help replenish capital that is burnt through in a crisis.
Koenig also called for banks to be given time to issue debt that can be written down to replenish capital that has been burnt out in a crisis, and thus shield taxpayers.
And then magic happened, wonderful things happened, because when that was written down, first of all, I could, when the next one of those situations came up, I can refer to it.
He recently began looking at why Exxon, unlike many of its peers, had not written down the value of its oil assets after a more than 60 percent fall in crude prices.
Officials also want to know why Exxon has not written down the values of its oil and gas reserves amid the precipitous price drop over the last two years, the Journal said.
"This cycle is similar to other cycles, in that previous loose policies encouraged new debt that will eventually prove not to be serviceable and will have to be written down," he said.
The BoE was setting out more detailed proposals on the location within banking groups of mandatory "bail-in" debt that can be written down to replenish burnt-out capital in a crisis.
Several other foreign energy companies have written down the value of their Venezuela assets by hundreds of millions of dollars or halted most operations, keeping only a skeletal staff in the country.
Is it because of something that was written down more than 200 years ago, when it was difficult to enforce the rule of law and outlaw militias could do whatever they want?
One outlying theory connects this arithmetic fear to Joyce's decision to publish Ulysses on his birthday the following year, which had a sublime smoothness when written down on paper: 290/21990/2160.
Some rights, like freedom of religion, are written down, which doesn't always make them easier to secure; and some, like the right to marry, aren't, which doesn't mean that they're less fundamental.
After opening arguments, senators will be able to ask questions of both legal teams — but they have to be written down, as the senators must stay silent as jurors during the trial.
That investment has been a major flop, as Kraft Heinz has posted weak sales for many of its core brands in recent years and written down the value of several of them.
The bank says it was already considering changes to the valuation of some of the assets in question, and that some ABS CDOs were written down within a month of Hong's departure.
Collier said he had reviewed DMGT's business-to-business units, and had written down the assets by 206 million pounds, reflecting challenges in the trading environment for its energy and property information businesses.
While European Council members who represent the U.K. can't take part in negotiations, it's not written down that the same restrictions are true for those who represent the U.K. in the European Parliament.
And he mined folklore, assembling "The Erotic Muse: A Completely Uncensored Collection of the Songs Everyone Knows and No One Has Written Down Before" and "Bawdy Ballads" (both in 21985) and several sequels.
Using wired internet at home where possible is another good one (harder to tap into) and don't keep passwords or login info written down anywhere (you're making it too easy for potential hackers).
This man told [the same story that I'd written] down, not as Bill's son, but as a rookie firefighter watching in awe as he witnessed him on the roof of that old factory.
It is the third consecutive reporting period in which the group has written down the value of its 20 percent holding in the bank, which it valued at 140 million pounds in September.
The Saga of Hrafin Sveinbjarnarson, written down sometime in the late 1100s, tells the story of a chieftain who killed a walrus and brought its tusks and skull to Canterbury Cathedral in England.
For the full year, Lenovo swung to a profit of $597 million, from a loss of $189 million a year earlier, when it had written down $400 million due to U.S. tax reform.
Of course, there was no internet and I had no cookbooks, I just had my grandmother's Bolognese recipe written down and a few recipes from my dad that I was trying to master.
Consider the fact that, at one point, Wayne recorded, in a single session, every line he had written down in his lyric notebook and released all "10,000 Bars" of it as a mixtape.
Redcentric's 2016 statements were extensively restated, with net assets written down by 15.8 million pounds, and a profit after tax of 5.3 million pounds was restated to a loss of 4.2 million pounds.
Written down by a visiting missionary in about 1550, the Popol Vuh is one of the only remaining traces of what was once a vibrant oral tradition of storytelling in pre-Columbian America.
Funds see opportunities in bonds too, although Louis Gargour, chief investment officer of LNG Capital advises avoiding subordinated or "junior", bonds which are often written down in event of default or debt restructuring.
"It was difficult because very little is written down," Chang said, noting that with Cantonese cuisine — the food of southern China and Hong Kong — shelves are filled with books of recipes and ingredients.
If you do not want to use a separate app or keep your passwords written down on paper in a secure location, Google's browser has one of the better-protected integrated password managers.
You know, for example, whether you find it more helpful to have things written down rather than hearing them (or vice versa), and whether you're a big-picture person or more detailed-oriented.
It has already written down its share of Samarco from $1.2 billion to zero, and its only other significant asset in Brazil is a minority stake in the Alumar alumina smelter and refinery.
I also wasn't aware of this concept as a teen, but there's legitimate, studied power in simply… writing something down; science continually shows a written-down goal is more likely to be achieved.
The notes would be written down in part or in full should the Reserve Bank of New Zealand appoint a statutory manager or deem that without the write down, Coop was non-viable.
In the books the agents found, Mr. Lee had written down details about meetings between C.I.A. informants and undercover agents, as well as their real names and phone numbers, according to court papers.
LONDON, June 2 (Reuters) - Banks must spell out the risks to investors from buying bonds that can be written down to shore up an ailing bank, the European Union's markets watchdog said on Thursday.
UniCredit is Italy's only globally systemically important bank and as such is subject to rules that require lenders to issue securities that can be written down or converted into equity to cover potential losses.
"The carrying value of the business's goodwill and intangible assets in DMGT's balance sheet has been written down completely, resulting in an impairment charge of £25 million," the company wrote in the earnings release.
The notes would be written down in part or in full should the Reserve Bank of New Zealand appoint a statutory manager or deem that Co-op was non-viable without the write down.
The provider of pest control, cleaning, security and healthcare services had already written down the value of its business after issuing three profit warnings in a year, blaming uncertainty surrounding Brexit and rising costs.
For lenders, sales and write-downs mean a painful blow: potential buyers rate the sofferenze at below 20% of face value on average, less than half of the written-down figure on banks' books.
Banks will have to issue billions of dollars in known as total loss absorbing capacity debt or TLAC debt which can be written down to avoid burning through all their capital in a crisis.
We also have all of our employees carry notebooks and encourage them to make note of anything, from emotions to fleeting ideas, because once it is written down it is much harder to forget.
Comey is known for taking exhaustive notes on his work, a trait thrust into the spotlight when he revealed he'd written down detailed (and sometimes entertaining) briefs about all of his meetings with Trump.
If everything is written down and it is absolutely black and white and you have a decision that you can follow really easily, it should be simple - even if the rules themselves are complex.
"It evokes Homer to us," adds Stocker, referring to his epic works "Iliad" and "Odyssey," which scholars believe were written down in the 8th century B.C. -- hundreds of years after the sealstone was crafted.
The overall consideration would be some 160 million euros below Vivendi's average purchase price of 3.7 euros, bearable for 30 billion euro Vivendi, which has in any case already written down its Mediaset stake.
Both his press secretary and his speechwriter drafted some notes for him to use, but he had written down his own words on the plane ride there, and those were the words he spoke.
I realize it's a little bit of both, but you know, you guys have raised a lot of money ... I had it written down somewhere, $130 million, I believe, a valuation of $1.65 billion.
Steam doesn't list full phone numbers in profiles, so Brian couldn't have written down his father's number if he wanted to, but I wondered if that were different, if he'd have grabbed a pen.
Stories of his meeting with Jerusalem's high priest circulated and were later written down by the Roman-era Jewish historian Josephus in the first century CE, and are preserved in rabbinic literature and other sources.
Italian banks are estimated to have written down the gross value of their bad loans by 56 percent on average, implying a residual book value for these assets of 44 percent, central bank data show.
Popolare di Bari said it had booked written down assets for 382 million euros last year, pushing its core capital ratio down to 7.86% compared with an 8.83% requirement set by the Bank of Italy.
The question may come down to just how much weight the committee does put on conference championships, and how committed it is to choosing teams from different conferences, even if that requirement isn't written down.
Still, there have been much bigger paper losses involving major corporations investing in high-growth start-ups, including SoftBank's WeWork investment, and Altria's investment in Juul, which last month was written down by $4 billion.
In hindsight, I wish I'd written down something else, like maybe my impressive ability to avoid offsides during soccer practice, or my fierce commitment to finishing the entire Harry Potter series before the sixth grade.
The sale is part of a planned 800 million-euro disposal of bad loans and has no impact on the bank's profit as it has already written down the asset to be sold, Lovaglio said.
You'll be able to point your phone's camera at text in the real world — say, a written down Wi-Fi password — grab that text, and then paste it into a text field on your smartphone.
Under the proposal, White House and congressional leaders would appoint a board of financial experts to arbitrate politically-charged questions like whether bonds issued by utilities or even the island's government should be written down.
"The problem is the valuation of the vessels could be written down, especially for companies with more specialised or purpose-built assets that are unable to find new orders to support cash flows," she added.
No notching is applied for incremental non-performance risk because there is no coupon flexibility prior to non-viability and the notes would only be written down once the point of non-viability is reached.
Tobacco giant Altria said Thursday it has written down its $22022 billion investment in troubled e-cigarette maker Juul by more than a third, recording a $4.5 billion pretax charge against its third-quarter earnings.
He described wanting to recruit young people and people of color into the party, and some of his policy initiatives he had written down at the beginning of his term include issues like climate change.
Whether it's a matter of the data not existing in the proper form — or at all — or a project that isn't worth pursuing, everything needs to be written down so the same mistakes aren't repeated.
Since those transactions were executed in the fiscal year ended in June, the endowment may have taken some losses and written down other assets that would potentially let its future returns look better in comparison.
Thus far we've only noted the regulations that are written down, but below the water line, examiners now are ever more aggressive in telling banks what loans to make – and too often not to make.
But even if it was not written down, there likely are other ways to establish the existence of Trump's order, from call logs to notes taken by others of various officials' interactions with the president.
But now, well-funded creditor lobbyists are trying to disrupt the Promesa process in hopes that their debt will not be written down, blaming the oversight board and continuing bankruptcy litigation for Puerto Rico's problems.
Sometimes I can't sleep for trying to place the right word in the right place and again I will wake with a perfectly turned phrase in my mind, to be remembered and written down next day . . .
And if the Court is engaged in law, then I think it's okay for them to have a fair amount of power because the law was written down and often it only has one clear meaning.
Scholars of the Sagas point to the impact of Gaelic writings and believe it is not coincidental that Ireland and Iceland were the only places in western Europe where oral traditions were written down this way.
"It's absolutely better to have a bunch of unique passwords written down somewhere in your house than it is to have a single complex password that you've memorized and use across 10 different accounts," said LaCour.
They don't all seem to consider how their words taken at face value might impact their relationship with their faves if they were ever to meet or interact—tone notoriously doesn't always translate when written down.
Deutsche Telekom received its 12 percent stake in BT in exchange for its stake in British mobile operator EE last year, and has already written down 3 billion euros of its initial value of 7.4 billion.
Though the recipe for Long Island Iced Tea was written down in the 60s, Robert Butt claims he invented the drink in 1972 during a cocktail creating contest at the Oak Beach Inn on Long Island.
Welcome to a flight from Los Angeles to, um, to, um, I have it written down here somewhere, it's the mountains and then there's some more mountains and then we're on the other side of that.
Welcome to a flight from Los Angeles to, um, to, um, I have it written down here somewhere, it's the mountains and then there's some more mountains and then we're on the other side of that.
Imagine we have a public square that has written down everyone's bank balance, and if I want to send you some money, I basically write a check to you and post it in the town square.
"If we assume a loss in the €1bn area, we think the T1 instruments would be written down to 40-cent area under GAAP and in the low 70s under IFRS," wrote credit analysts at BNP Paribas.
Under new banking rules meant to reduce taxpayers' costs in banking crisis, EU lenders are required to issue a sufficient amount of debt that would be written down, or bailed-in, to absorb losses if they fail.
WA, has written down 916 million zlotys ($243 million) of goodwill at a group level on the slim chance it will be sold to a investor at a price above BPH's book value, it said on Monday.
Poland's third biggest power firm Enea and its coal unit Bogdanka said they had written down the value of their assets due to a slump in electricity and coal prices, saying this would hit their 2015 results.
Companies are reluctant to take writedowns because they reduce income and assets on the balance sheet, and once assets are written down, they cannot be written up, said Larry Crumbley, accounting professor emeritus at Louisiana State University.
The thing about Norwegian fairy tales and folklore traditions is that they were word-of-mouth stories that are written down in the 1800s, when Norway was very Protestant and virtuous and in the cities, very bourgeois.
I have "Donald blows out a cloud of vape smoke and slaps Hillary Clinton's bare ass while she rides a hoverboard" written down in an idea notepad, but we'll have to see where the alcohol leads me!
During the third quarter, The Wall Street Journal reported the Securities and Exchange Commission and New York Attorney General Eric Schneiderman's office launched probes to determine if Exxon should have written down the value of its reserves.
But the company, which invests in mid-market companies operating across Europe, Asia and the Americas, had written down its investment in lingerie chain Agent Provocateur to nil after accounting irregularities had concealed its true financial position.
After watching the livestream, I was left with a terrible feeling of emptiness as I looked down at my notes from the event and realized I hadn't written down a single thing: there was nothing to record.
Veterans of the DCCC and other Dem strategists say it's an unwritten rule that finally got written down — potentially boxing out challengers at the cost of angering the liberal grassroots, which funds the committee and its candidates.
"When people say he sounds stupid, I'm sort of like 'Well, I don't know, lack of polish is how most of us talk if you actually saw it written down,' " Mr. Ellickson said, then paused a moment.
Whether it's a matter of the data not existing in the proper form — or at all — or a project not being worth pursuing at all, everything needs to be written down so the same mistakes aren't repeated.
"It is historic, it is written down, it was agreed to by the Chinese who were here two weeks ago, but it has to pass through the political filter of President Xi and the politburo," Kudlow said.
Ronnie Even though Andrew had written down Ronnie's room number on his pawnshop form, subjecting his friend to a terrifying encounter with a SWAT team, Ronnie covered for Andrew, claiming not to recognize him in a photo.
The only actual written-down Trump tax plan is a one-pager that includes what Ron Wyden, the top Democrat on the Senate Finance Committee, calls a new "lunar-crater-size loophole" on income for the wealthy.
Taylor provided an intensely detailed account of his time in Ukraine since he arrived at this spring, and he was more than happy to provide Congress with direct quotes that he'd written down as they were said.
Over the past year, Kraft Heinz has withdrawn its full-year outlook, written down the value of several key brands and assets by more than $15 billion and struggled to overcome competition from retailers' private-label brands.
But not only that, you also have the responsibility of guiding a population and you realize through that work that often, where you earn your paycheck is in functions that are not described or written down anywhere.
A severe recession added to the problems by making many companies default on loans, saddling banks with soured debts that - if they are written down at their market value - would blow a capital hole in their accounts.
The value of GE's contract assets are being written down, but that does not change the value of the long-term contracts GE has, nor does it affect GE's cash flow or earnings estimates for 2018, GE said.
"Somewhere out there this child is there for me and that phrase, 'I've loved you since forever,' was something that I had written down because that's what it felt like," she says about the title of her book.
Italian banks' efforts to tackle the legacy of a deep recession have so far focused on the worst-performing loans, which had been more heavily written down so as to minimize losses in the event of a sale.
Imagining opening the door to your apartment, and following your nose straight into the kitchen where your mother is making a slow-simmering ragu Bolognese from the kind of traditional recipe that has probably never been written down.
And secondly, that we understand as consumers, audience, players, that gaming's rule set for plot-driving discourse, persuasive prose, and affecting interactions is a very different beast to that written down in books or enunciated from a stage.
Italian banks' efforts to tackle the legacy of a deep recession have so far focused on the worst-performing loans, which had been more heavily written down so as to minimise losses in the event of a sale.
It turns out that Freddie Green's reminiscences about a romance between his friends Evert Dax and David Sparsholt were just that—an old document written down years later for The Cranley Gardens Memoir Club, aka the Memo Club.
Fundamental constitutional rules on matters such as the succession to the crown, the powers of the House of Lords, the relationship between England and Scotland, and accession to the European Union itself, are written down as parliamentary statutes.
DAVID CORBETTExeter, New Hampshire Thinking about people's tendency neither to read nor understand contracts ("Critical conditions", July 27th) they should always be aware of what's written down, because while The Large Print Giveth, The Small Print Taketh Away.
Once everything you owe is written down and organized in one place, you can begin to prioritize how and where your money will go in 2020, rather than haphazardly pay back debt without a strategy to guide you.
Chinese medicine as a system of diet, acupuncture, and the interplay of physical and mental health was written down some 2,200 years ago, and before and since, has been interpreted by trained specialists and well-meaning parents alike.
In October, Exxon Mobil conceded that 3.6 billion barrels of it Canadian oil sands reserves and 1 billion barrels of other North American reserves may have to be written down because they are currently not profitable to produce.
He has a couple of bit parts in the early 1990s listed on IMDB, as does another person named Dan Charles, which second second assistant director Geoffrey Hansen said he had written down as the guy's professional name.
Salzgitter had originally reported pretax profit of 24 million euros for the first nine months of 2015, but said on Thursday it had now written down that figure by 8 million euros due to a retrospective adjustment of inventories.
NBG's non-performing exposure, a measure that includes NPLs and loans likely to sour, stood at 45 percent of total loans at end-June, the executive said, adding that the bank has written down 55.7 percent of these loans.
All seven lenders passed even when the full impact of a new accounting rule on provisioning for souring loans was factored in, the FPC said, though so-called contingent capital had to be written down at Barclays and Lloyds.
But it can't touch the things that are actually written down in the Affordable Care Act, which brings us to... Prong 433: Pass additional health care bills that don't have to relate to the federal budget through normal rules.
A promise to that end, he said, should be written down in the treaty that will regulate relations between London and the 27 countries that will remain in the EU after Britain leaves at the end of March 2019.
She defined it as "that moment when the sun starts peeking through the darkest storm clouds, creating the most beautiful rainbow"—which might sound cheesy or obvious written down, but it's that exact imagery which immediately springs to mind.
How it works (or doesn't) For a competition that thumbs its nose at conventional rules, this anti-race race does have a number of parameters in which it operates (not written down, of course), all to maximize the challenge.
Under new rules meant to reduce taxpayers' costs in a banking crisis, euro zone banks have been advised since last year to issue a sufficient amount of debt that would be written down to absorb losses if they fail.
The bank will need to win over fixed income investors, some of whom are still smarting from the decision in late 2015 to transfer several securities back from Novo Banco to BES, resulting in their value being written down.
The true story of the 1968 election is slotted in beside false stories of the supernatural, even as Stella and her friends try to research Sarah's true history, which is eventually written down, then received as a fictional story.
But I think that's a really good aspect of a diary — your life is just written down and on paper, and sometimes you read it, and you're just appalled by your judgment or by your jealousy or your pettiness.
Waldrop's poems aren't "visual" in the sense that paintings are visual, but they feel as though they had been applied to paper, not simply written down, and they reward the kind of scrutiny we give to discrete visual surfaces.
The group, which includes BlackRock and Pimco, said the central bank acted improperly when it moved five bonds from Novo Banco to Banco Espirito Santo in late 2015, which resulted in the value of the bonds being written down.
He later changed tactics and under questioning from Johnson confirmed Mueller's finding that the President had asked him to tell Sessions he was unhappy with the appointment of a special counsel and that he had written down the message.
Hansen also had written down the actor's mom's home phone number (I called it; disconnected), the actor's phone number (also disconnected), and a number for a manager named Wayne at the Chicago-based agency Neuvelle (defunct; phone number disconnected).
The 18-month agreement — written down as a 12-month cap with a possible 6-month extension — bridged most differences over the maximum period allowed for sending workers abroad under posting rules before they fall under the host country's labor laws.
According to the affidavit, Gogoi reiterated to her how hard it had been to find a job for her brother-in-law, and the woman said she had written down how grateful she and her family were for his support.
WARSAW, Feb 25 (Reuters) - Raiffeisen Bank Polska, the Polish unit of Austrian lender Raiffeisen Bank International (RBI), has written down the value of its local brand Polbank, which will weigh on the bank's 2016 financial results, it said late on Friday.
Also rumbling in the background is a legal dispute between the two surrounding Ukraine's $3 billion Eurobond, which Moscow wants repaid in full but which Kiev argues should have been written down along with most of its other debt in 2015.
IBM's CEO Ginni Rometty is on Donald Trump's advisory council, but I'm still astonished at how they were able to squeeze so many meaningless platitudes into a statement in order to make it the least controversial thing ever written down.
It can identify text, for when you want to save information from business cards, save a URL from a poster or flier, call a phone number written down on paper, or open Google Maps with directions to a written address.
Last week, the Journal citing people familiar with the matter reported that New York Attorney General Eric Schneiderman has been inquiring into why the company has not written down the value of its assets despite a decline in oil prices.
ExxonMobil — The New York attorney general said he is investigating the oil giant's accounting practices and questions why the company hasn't written down the value of its assets despite a steep drop in oil prices, according to The Wall Street Journal.
MILAN (Reuters) - UniCredit has heavily written down the value of its 217.7 million euro ($213 million) investment in Italy's bank rescue fund and other investors are likely to follow suit, sources told Reuters, complicating efforts to stabilize the nation's banking sector.
But despite the fact that those statements were made on live television before Congress, and were also written down and entered into the congressional record, Trump is now claiming that none of that happened and that the media is lying.
Veneto Banca said it had written down doubtful loans for 1.3 billion euros last year following a recently concluded on-site audit by European Central Bank supervisors which forced it to class more loans as bad and raise coverage levels.
The Basel III Tier 2 instruments issued by SMFG, MHFG and MHFG's subsidiary are notched twice from their IDRs because they may be fully and permanently written down upon reaching the point of non-viability, resulting in additional loss severity.
This epic poem was found on a series of ancient tablets from Mesopotamia written down over 4,000 years ago, and involves the central character Gilgamesh, an excessive and oppressive leader, and his arduous journey in pursuit of the secrets of immortality.
Uber was valued at $68 billion at its most recent investment last year, but recently some mutual funds have written down the value of their Uber investment by as much as 15 percent, a sign of wavering confidence in the company.
Mr. Woodbury added that if current price levels persist, other oil and gas operations in North America may have to be written down, although he indicated that they could also be put back on the books if prices recovered sufficiently.
And despite its being released in a different era, this memoir parallels those vanity projects of yore in a couple of ways: It comes in the midst of a new American comedy boom, and it resembles its author's act written down.
Employing 43,000 people around the world, including 20,000 in Britain, Carillion has been fighting for survival since July, when it revealed it was losing cash on projects and had written down the value of its contract book by 845 million pounds.
The agency is also interested in why Exxon hasn't written down the value of its oil and natural gas reserves, like most other major oil and gas companies have over the last two years of low prices, the Journal said.
JOHANNESBURG, Sept 19 (Reuters) - Payments company Net1 UEPS Technologies said on Thursday it had written down to zero the value of its stake in South Africa's third-largest mobile network, Cell C, alongside the carrier's largest shareholder, Blue Label Telecoms.
High trigger contingent capital Tier 2 notes are rated four notches below the VR. The notes are notched down twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
Private equity investors have written down the value of enterprise darlings like Zenefits, and the stock price of cloud storage provider Box has dropped from over $23 a share to just under $10 since it went public a year ago.
The play involves the audience at every turn, either to play characters in the story or to call out the brilliant things on the list: Items are written down on pieces of paper and handed to playgoers as they go in.
It's no exaggeration to say that is a historical grouping of names, particularly for those well versed in the wild strands of queer culture, made up of ideas that can feel arbitrary to an outsider written down, but make perfect sense in action.
It describes Bitcoin as a way to pay for "secure email anonymously" — though Bitcoin is not necessarily anonymous, given that every transaction is written down in the blockchain (and includes a from and to address) so there remain the potential to trace payments.
The provider of pest control, cleaning, security and healthcare services had already written down the value of its business after a new management team found the company had been too aggressive in the way it booked revenue and costs on long-term contracts.
This information is written down in the genome as a sequence of DNA bases—A, C, T and G, the letters on the ticker-tape—in the same way data in a computer are stored as a string of 1s and 0s.
High and low trigger-contingent capital Tier 1 instruments are rated five notches below the VR. The issues are notched down twice for loss severity, reflecting poor recoveries, as the instruments can be converted to equity or written down well ahead of resolution.
There's reason to suspect that Katerra is yet another SoftBank investment that will be written down—by comparison, Aecom, one of the world's largest architecture, engineering, and construction firms is profitable, worth about $5 billion, but brings in $20 billion in revenues.
The Monetary Authority of Singapore (MAS) has sole discretion in determining if UOB is non-viable, and if it does so, the securities may be written down in full or in part to the extent necessary to restore the viability of the bank.
Troubles of Polish meat producer Henryk Kania may have a negative impact on its biggest debt holders - Alior Bank and Bank Handlowy, which have probably not yet written down loans provided for Kania, Parkiet daily said quoting analysts and the companies' statements.
The address I'd written down for the 160-year-old Ma Xiang Xing Halal Restaurant (inventors of a classic Jiangsu dish called "sweet and sour Mandarin squirrel fish") brought me not to a restaurant, but to a hotel with no restaurant inside.
If you told me some longtime employees at Valve have quietly written down ways to scare players— really scare them—for more than 20 years and decided Alyx was their chance to finally put them all into action, I would believe you.
JOHANNESBURG, Aug 29 (Reuters) - South African retailer Woolworths Holdings Ltd posted a 2.1% drop in annual earnings and said it had written down the value of its Australian upmarket department store chain David Jones on subdued consumer spending in a slowing economy.
At the time, a lot of people thought that listing rights was a bad idea because, in a republic, the people retain all the rights not specifically granted to the government and because anything written down is both limited and open to interpretation.
A federal judge in Texas has dismissed a proposed class action accusing managers of Exxon Mobil's employee retirement savings plan of breaching their fiduciary duties by not pushing the company to promptly disclose that its oil assets would need to be written down.
He emerges every 27 years to terrorize the town of Derry, Maine and while you think this kind of murder-spree would get written down in a datebook, for some reason the adult Losers can't remember what Pennywise did to them as kids.
The total written down value of property, plant and equipment across the two sites is about A$85 million ($57.68 million), the company said, stating that it does not expect the cessation of operations to have a material effect on its 2020 earnings.
On February 22011th, the head of the National Security Bureau, in Damascus, signed a directive "to investigate, search for, and arrest" whoever had written "Down with Bashar" on a ten-inch water pipe along a remote stretch of highway near Deir Ezzor.
High and low trigger contingent capital Tier 1 instruments are rated five notches below the VR. The issues are notched down twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
High and low trigger contingent capital Tier 103 instruments are rated five notches below the VR. The issues are notched down twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
"All I wanted to do I've been dreaming since I was seven years old—I have it written down in a third-grade essay—that I wanted to be a Pipeline Master [the winner of the renowned Hawaiian surfing contest]," she tells Broadly.
The book has to stretch hard to fit its format, though, leading to more than one scene where people who are standing next to each other in the same room converse via text so that we can see their conversations written down.
High and low trigger contingent additional capital Tier 1 (AT1) instruments are rated five notches below the VR. The issues are notched down twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
JOHANNESBURG, Aug 7 (Reuters) - South African drinks maker Distell Group said on Wednesday it expects full-year headline earnings to fall as much as 6% and has written down the value of its investment in Angola and took a credit loss provision in Zimbabwe.
Written down, it looks like the output of a neural network trained on TED Talks — "Invention at such incredible speed"; "If we imagine it, we can build it"; "We are literally in a golden age of computer science" — which is, at least, thematically relevant.
Though some of the women headed back up to their rooms to get some shuteye ahead of another packed day, the rest of us — including Brooke — headed outside to a fire pit to burn intentions we had written down on little slips of paper.
"He hasn't written down many requests, so I think one request is probably OK." William is on an official trip to Finland to celebrate the country's 100th anniversary came just days after the engagement of his younger brother, Prince Harry, to American actress Meghan Markle.
Several sources said up to two thirds of a further 112 billion euros in 'unlikely to pay' UTP loans valued by banks at around 66 percent of their face value would have to be classed as insolvent and heavily written down to facilitate disposals.
This approach will shape legislative proposals later this year for implementing global rules requiring the world's biggest banks, like HSBC and BNP Paribas, to issue bonds, known as TLAC, that could be written down to raise funds if the banks were ever in difficulties.
Genoa-based Carige said on Thursday the ECB had told it to halve its problem loan stock over the next three years and raise its coverage ratio - which measures the extent to which bad loans have been written down - to 42 percent by end-2019.
Along with European rivals ALD faces some uncertainties over fleet values, as tighter emissions regulations and some bans on diesel cars could in turn lead to losses for companies with large diesel fleets, as the vehicles are written down to reflect falling re-sale values.
And when that doesn't work — when intel from his top spies is televised and written down in the official record as it was this week — Trump will find a way to claim their words were misquoted or taken out of context by the media.
"Although you don't see it written down, there is almost a social consensus that 'OK, you did your crime, but you did it for the company,'" said Seijiro Takeshita, dean and professor at the School of Management and Information at the University of Shizuoka.
What makes it unlike any other is its language — a version of English as it might be spoken by people who had never seen words or place names written down, an idiom among the ruins of half-remembered scientific jargon, folklore and garbled history.
High and low trigger contingent additional Tier 0003 (AT1) capital instruments are rated five notches below the VR. The issues are notched down twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
In 2012, Permira, which acquired Hugo Boss and Valentino as part of a 5003 billion-euro deal, sold the Valentino unit for €710 million, having effectively written down its investment in the Italian luxury house by more than half by the end of 2009.
"Our history's never been written down," said Mr. Fierstein, who plays a character whose lover dies in the UpStairs Lounge fire in "Gently Down the Stream," Martin Sherman's new play about three generations of gay men that starts this month at the Public Theater.
"It has become clear that the whole system of regulation, covering what is written down and the way in which it is enacted in practice, is not fit for purpose, leaving room for those who want to take shortcuts to do so," the review said.
The stories we've been told about who great artists are and what geniuses look like, these are going to influence the stories we tell unless we go out of our way to question why this version of the story has been written down in the history books.
A 425 million euro bond - originally pitched in late 2013 as a bridge to an initial public offering - was written down last year in a distressed exchange offer that reduced the company's debt pile by 4.5 billion rand and its interest payments by 1 billion rand.
Japan-headquartered e-commerce firm Rakuten has written down $4.93 million from a range of businesses, including its Kobo e-reader division and France-based e-commerce site PriceMinister, and announced plans to close a number of global operations as part of a new strategic focus.
If you use very casual language, if you use slang in a letter or a formal message written down, then it isn't seen as proper, and we're taught that in schools — in elementary school, and many of us have been learning this for years and years.
Not only the conciseness and the clearness of it, but also the fact that you have things that were written down contemporaneously when they happened, and you actually have them in quotes, so we know exactly what happened, and we're not getting some rendition of it.
That includes opinions, attitudes, beliefs and moods that aren't written down anywhere, but can be inferred from your online behavior — the posts you like on Facebook, the photos you share, the videos you watch, the items you buy on Amazon, your search queries, your location, etc.
Literature is a game with language, and hoaxing alerts us to the fact that the rules are not written down anywhere—in the same way that someone who goes barefoot to a wedding alerts us to the fact that there are actually no regulations governing these things.
They have all of this stuff written down but then we go and talk to our nurses in these facilities and absolutely none of it is being implemented, said Jane Thomason, the lead industrial hygienist with the Health and Safety Division of the National Nurses United.
There is no pass or fail threshold in the latest round of stress tests, but analysts said a core capital ratio of less than 7 percent could cause alarm as this is the level where many bonds or contingent capital issues by banks gets written down.
To remedy this, Abt argued that far more of our expectations for police should be clearly written down in police training manuals, guidelines, and other tools used to train police — so supervisors and prosecutors have something clear to point to when an officer does something wrong.
"Given [the drug's] relatively limited shelf life, the company takes substantial carrying cost risk and has written down at its own expense approximately half of purchased quantities in the past few years," he wrote, adding that list price does not reflect any rebates or discounts that Valeant pays.
"Once, I almost got stranded in the SeaTac airport because the phone number I'd written down was wrong, and I had no way of looking up the right one, no way of calling a cab or Uber, and no one in the state who could help me," Mugdan said.
"The funny part is we had champagne in the helicopter and the [ring] box was in his pocket and he had written down everything he wanted to say on a note," she revealed, explaining that the note was meant to divert her attention while he pulled out the ring.
Italian households hold about 29 billion euros ($53 billion) worth of bank-issued bonds that are subject to being written down or converted into equity in case those banks need to rescue themselves through a so-called "bail-in," according to an April report from the Bank of Italy.
First, she failed to avoid her industry's tendency to overspend on big, splashy deals, and the firms she bought failed to deliver the expected growth: Yahoo spent $1.1 billion in 2013 to acquire Tumblr, a social network, for example, but has since written down most of its value.
A write-down of the Tier 72 notes will occur only after any Additional Tier 1 securities with loss-absorption features have been fully written off, after which the Tier 2 notes would be written down pro rata with other parity Tier 2 instruments that contain loss-absorption features.
A 425 million euro ($478 million) bond - originally pitched in late 2013 as a bridge to an initial public offering - was written down last year in a distressed exchange offer that reduced the company's debt pile by 4.5 billion rand and its interest payments by 1 billion rand.
"  Since then, Raisman has been a staunch advocate for women wearing what they want â€" in February, she posed for the Sports Illustrated Swimsuit Edition with the words "women do not have to be modest to be respected" written down her body, and "survivor" written across her chest.
"You can't tell whether there's something problematic, but it's pretty striking that this one was written down so much," said David Skeel, a professor at the University of Pennsylvania Law School who specializes in bankruptcy law and reviewed the case at the request of The New York Times.
The crisis in Cyprus was a combination of fiscal slippage and a banking system which virtually imploded from heavy exposure to Greek sovereign debt - written down by Athens's international lenders to make that country's debt mountain more sustainable, but subsequently rolling over to smother the Cypriot banking system.
Your master password for your laptop or your password manager needs to be long, complicated, completely unguessable and not written down anywhere—otherwise someone else could get straight into all your account credentials at once (see Settings then Passwords in Chrome for a full list of your login details, for example).
In a court filing late Monday night, Rio Tinto, former Chief Executive Officer Tom Albanese and former Chief Financial Officer Guy Elliott rejected SEC claims they should have written down Mozambique coal assets no more than 11 months after buying them in 2011 for $3.7 billion, rather than waiting 17 months.
Barclays' high-trigger contingent capital Tier 1 instruments and preference shares with no constraints on coupon omission are rated five notches below the VR. The issues are notched down twice for loss severity, reflecting poor recoveries as the instruments can be converted to equity or written down well ahead of resolution.
During the third quarter, The Wall Street Journal reported that the Securities and Exchange Commission and New York Attorney General Eric Schneiderman's office launched probes to determine if Exxon should have written down the value of its reserves based on drop in global oil prices that began about two years ago.
This "will give you a mental win to keep moving forward and paying off your debt," Ryan Marshall, a New Jersey-based certified financial planner, tells CNBC Make It. Once you have all of these key details written down, it's time to think of a repayment strategy that will motivate you.
The percussionist Mustafa Ahmed told Mr. Marble that Russell used a mantric alphabet to come up with sung melodies; that could be a key to the flexible construction of the "World of Echo" lyrics, which were often written down with three possibilities for a single word, and mumbled all the same.
Those kinds of instructions should be written down somewhere or posted on the website, because apparently certain Pokémon like being petted (which you can do by stroking the side of the ball), or rolled around on a table, which aren't motions I would have ever suspected, and they don't get mentioned anywhere.
And it's only when you're willing to basically cheat—using the codes you've written down from previous playthroughs, the knowledge you have about the routines the AI characters follow—that you can see and hear everything and, importantly, get the time to process it and think about how it fits into the story.
Fans range from Barry McCarthy, the understated chief financial officer of Spotify (she "raises the level of political discourse," he says) to outspoken former Facebook executive Chamath Palihapitiya ("I don't agree with many of her proposals but I donated to Elizabeth Warren because SHE IS THE ONLY MAJOR CANDIDATE WITH STUFF WRITTEN DOWN," he tweeted).
The auditor, in the letter, didn't say whether the amount it assessed the assets should have been written down by was greater than the 2.1 million-pound impairment that was recorded in the tube makers 2018 accounts, which were filed with Companies House last month after being audited by another firm, London-based King & King.
The auditor, in the letter, didn't say whether the amount it assessed the assets should have been written down by was greater than the 2.1 million-pound impairment that was recorded in the tube maker's 2018 accounts, which were filed with Companies House last month after being audited by another firm, London-based King & King.
"It is simply unfathomable to us the board could consider it in the best interest of shareholders to sell businesses representing 46 per cent of AMP's recurring earnings before interest at such a low multiple and large discount to already written-down embedded values," Merlon Capital said in the letter to AMP, seen by Reuters.
Later archaeologists were more doubtful, but allowed that the destruction of Troy in 1200 B.C. could have been remembered in oral poetry for 500 years until the Homeric poems were first written down, around 700 B.C. The Griffin Warrior was buried around 1450 B.C., distancing him even further from the first written version of Homer.
Similarly, when asked about why there isn't any paperwork pertaining to the cases of the women who came forward with allegations against Maskell, May nonchalantly says that her office didn't have computers back in the '90s, and that the victims' allegations and testimony were probably written down on paper, and that's why they don't exist today.
I said 'Do something for the old man and read through this and tell me if I've made any big mistakes,' and he did, and he said to me 'A lot of these stories I know, because growing up with you I've heard a lot of this stuff, but to have it written down helped him put everything into perspective.
And — and I really appreciate that — not only — not only the conciseness and the clearness of it, but also the fact that you have things that were written down contemporaneously when they happened, and you actually put them in quotes, so we know exactly what happened and we're — and we're not getting some rendition of it that — that's in your mind.
Speaking to a roomful of Goldman Sachs bankers in June 2013, Clinton said that Goldman CEO Lloyd Blankfein could leave the Wall Street firm that's made him a billionaire to start a soup kitchen: This exchange was written down by Clinton's aides as they gathered information on what parts of her paid Wall Street speeches could prove damaging should they leak to the press.
The ways in which Trump's insecurities have trickled down to how Russia is dealt with by his administration include, according to sources cited in the Post story: He hasn't convened a single Cabinet-level meeting to discuss RussiaHis Presidential Daily Briefing -- a sort of "where are we now" look at the US and the world -- often has Russia news written down but not delivered orally, for fear of angering him.

No results under this filter, show 600 sentences.

Copyright © 2024 RandomSentenceGen.com All rights reserved.