Doepler's horned helmets were the result of some fascinating historical transposition.
|
|
A second encryption method called transposition consists in the rearrangement of letters.
|
|
Chris' description of her memories, Jesus—this grotesque major-key transposition of everything.
|
|
Rooney's transposition of Internet voice to the page brings a certain tension to her narration.
|
|
Even after two decades of growing fame and esteem, her art's values retard transposition into prices.
|
|
Not surprisingly, this process often resulted in "an extreme transposition of data," a 2016 study found.
|
|
If Smiley's "A Thousand Acres" was an act of transposition, "We That Are Young" is an embodiment.
|
|
They sought out structural changes in the genes, like deletions or transposition of DNA to another location.
|
|
Visconti originally planned to set it in independent Algeria, a transposition vetoed by Camus's widow, Francine Camus.
|
|
" Mr. Wyeth was also unperturbed by the racial transposition of "Barracoon" and added, "Why not mix them?
|
|
In a statement, Dr. Wansink admitted to making "typos, transposition errors and some statistical mistakes" in his papers.
|
|
While the first three Kryptos paragraphs either use only substitution or transposition, Hanson suspects that the fourth paragraph uses both.
|
|
The researchers focused on two major congenital heart defects: hypoplastic left heart syndrome (HLHS) and transposition of the great arteries (TGA).
|
|
The donation was made on behalf of Leo Thames Newman, who suffers from a condition known as Transposition of the Great Arteries.
|
|
The European Council, which represents the 28 member states, said that Friday's extension was a transposition of the UN vote on Wednesday.
|
|
The highest notes of his solo in an opera overture were, in fact, a transposition of the opening motif of the piece.
|
|
"It's calculation errors or transposition errors," said Cari Weston, CPA and director of tax practice and ethics at the American Institute of CPAs.
|
|
To make an uncomfortable transposition into actual life, it was like dealing off your Phi Beta Kappa freshman child for someone else's spry grandmother.
|
|
The new piece, titled "Transposition #4," is slowly contorting work made up of geometrical synths, simultaneously evoking a sense of dread and introverted comfort.
|
|
In one particularly deft transposition, Lopez reimagines the wife of Henry Wilcox, a spiritual mentor to Margaret Schlegel, as Walter Poole, Henry Wilcox's partner.
|
|
More complicated was the entire transposition of this pastiche number, originally sung by a trio of Bobby's girlfriends, for a trio of Bobbie's boyfriends.
|
|
This was followed in 2011 by Eve Annenberg's quite different "Romeo and Juliet in Yiddish," a clever transposition of Shakespeare featuring a cast of young apostate Hasidim.
|
|
Typically the party platform is a mere transposition of the victorious campaign's existing promises, set in bland enough language to not pin them down on any particular issue.
|
|
Labour has also announced that it would oppose the government's bill next week to enable the transposition of European law onto the British statute book in preparation for Brexit.
|
|
"It turns out if you use substitution and transposition, one after another in either order, especially on a short message, it makes it really wickedly hard to break," Hanson said.
|
|
She first came to attention with her 1997 TV movie "Macbeth on the Estate," an audacious transposition of the Scottish play to a tough high-rise housing project in Birmingham, England.
|
|
But after this relatively subdued opening scene (which is a near-direct transposition from the novel), we are transported back to the Naples of Elena's childhood, where death and destruction are everywhere.
|
|
"It is another indication that Amazon is going to, in time, have a complete capability to handle all the transposition and distribution needs of its business and of its customers," Jindel said.
|
|
I tried to press the topic with Salahi, but it was as if his transfer from Guantánamo had carried with it a kind of transposition of restraint, from shackles to self-policing.
|
|
Keegan, for example, was diagnosed in utero with transposition of the great arteries, a severe CHD that required open heart surgery at Golisano Children's Hospital in Rochester, N.Y. a week after his birth.
|
|
Francine Prose New York City Do we really need to have a conversation about whether pastiche, parody, reframing, transposition, and creative rearrangement—basic concepts in twentieth- and twenty-first-century aesthetics—are acceptable in literature?
|
|
Crown's most prominent piece is the recently-closed "Transposition: Over Many Miles" in the Miami Design District, an interactive drawing in wood made in collaboration with Theaster Gates's studio, based on aerial imagery of South Africa.
|
|
Forgiving the transposition of numbers in Trump's memo, those regulations were re-issued over five years ago with completely different numbering, so that the current regulation to which Trump presumably meant to cite is 212 CFR § 218.
|
|
But on the other hand, that inclusivity is complicated by the objects' transposition into luxurious materials and exclusive art-world settings (the opening at LSC was monitored by an imposing-looking bouncer, stationed just next to the wall of boomboxes).
|
|
Indeed, there are ways in which the surviving evidence of his actual childhood—as an orphan in Switzerland—seems to align with details in the memoir, as if his "shards of memory" were the result of a confused and unintentional transposition.
|
|
Anyway, the record generates plenty of beauty, and the transposition of living, breathing, three-dimensional music into an antiquated form of synthesizer (or more likely a modern, digital approximation thereof) entails artfully unpredictable choices for pitch, texture, and counterpoint strategy.
|
|
In regards to the aforementioned "problematic statistical techniques," for instance, he said that he has at times made "some typos, transposition errors, and some statistical mistakes," but that "with only one debatable exception," none have changed the "substantive conclusions" of the studies.
|
|
It's a lesson 2-year-old Billy Hopkin learned the hard way because his heart condition —transposition of the great arteries, which occurs when the two main blood vessels leaving the heart are swapped — prevents him from traveling around his hometown of London.
|
|
As much as the modern world has grown to resemble Dick's worst nightmares, adapting one of his 60-year-old short stories requires some careful interpretation and transposition of modern problems of personal privacy and the power of cryptography onto an old tale.
|
|
By the third room, my notepad was full of failed solutions to transposition puzzles and my browser tabs were open to binary code translators, theories on how to crack the Zodiac Killer ciphers, and a detailed history of Nazi Germany's Enigma machine.
|
|
However, the EC's proposal could trigger a downgrade of the ratings of issues with ISIN numbers XS0355551291, XS0347741455, XS0371238469 and XS0315425701 if its transposition into German law reduces the buffer of junior and non-preferred senior debt or modifies the ranking of senior instruments.
|
|
Children with critical congenital heart defects, such as hypoplastic left heart syndrome or transposition of the great arteries, who require surgery in infancy, are known to be at high risk for poor neurocognitive outcomes in childhood, Oster and his colleagues write in Circulation Cardiovascular Quality Outcomes.
|
|
This is why interaction designer and creative coder Andreas Refsgaard has created Eye Conductor, a music production app that uses facial tracking to translate the human eye's gaze into musical notes or beats in a drum sequencer, while specific facial movements can trigger effects and octave transposition.
|
|
Mr. Bean, a playwright of wide-ranging satirical scope, is best known on these shores for "One Man, Two Guvnors," his knockabout transposition of an 18th-century Goldoni comedy to the British seaside of the 1960s (seen on Broadway in 2012), which made a star of its leading man, James Corden.
|
|
He had a ventricular septal defect (or VSD), which is a small hole in his heart, his aorta was narrow, his coronary artery would have to be moved, and he had a transposition of his great arteries, which meant the two arteries that go into his heart were going into the wrong chambers.
|
|
"The issue of transposition is one of the issues being discussed, in a situation where a number of member states have amended or are in the process of amending the insolvency ranking of unsecured senior debt under their national insolvency laws to allow their banking institutions to comply with the subordination requirement," he said.
|
|
He rattled off various milestones in the history of image manipulation: the transposition, in a famous photograph from the eighteen-sixties, of Abraham Lincoln's head onto the body of the slavery advocate John C. Calhoun; the mass alteration of photographs in Stalin's Russia, designed to purge his enemies from the history books; the convenient realignment of the pyramids on the cover of National Geographic , in 1982; the composite photograph of John Kerry and Jane Fonda standing together at an anti-Vietnam demonstration, which incensed many voters after the Times credulously reprinted it, in 2004, above a story about Kerry's antiwar activities.
|
|
The double transposition cipher can be treated as a single transposition with a key as long as the product of the lengths of the two keys. In late 2013, a double transposition challenge, regarded by its author as undecipherable, was solved by George Lasry using a divide-and-conquer approach where each transposition was attacked individually.
|
|
Transposition is often combined with other techniques such as evaluation methods. For example, a simple substitution cipher combined with a columnar transposition avoids the weakness of both. Replacing high frequency ciphertext symbols with high frequency plaintext letters does not reveal chunks of plaintext because of the transposition. Anagramming the transposition does not work because of the substitution.
|
|
Forming a prime word by switching the position of nonadjacent letters in the base word is a distant transposition. There is significantly less priming effect in a distant transposition than a close transposition, no matter how distant the two letters are from each other.
|
|
Several other genetic operators exist and in gene expression programming, with its different genes and gene domains, the possibilities are endless. For example, genetic operators such as one-point recombination, two-point recombination, gene recombination, uniform recombination, gene transposition, root transposition, domain-specific mutation, domain-specific inversion, domain-specific transposition, and so on, are easily implemented and widely used.
|
|
The longest P elements encode transposase needed for transposition. P element also encodes a suppressor of transposition, which accumulates in the cytoplasm during the development of cells. Thus, in a cross of a P or M male with a P female, the female cytoplasm contains the suppressor, which binds to any P elements and prevents their transposition.
|
|
Dextro-transposition of the Great Arteries There are two different types of transposition of the great arteries, Dextro-transposition of the great arteries and Levo-transposition of the great arteries, depending on where the chambers and vessels connect. Dextro-transposition happens in about 1 in 4,000 newborns and is when the right ventricle pumps blood into the aorta and deoxygenated blood enters the blood stream. The temporary procedure is to create an atrial septal defect (ASD). A permanent fix is more complicated and involves redirecting the pulmonary return to the right atrium and the systemic return to the left atrium, which is known as the Senning procedure.
|
|
Classical ciphers are often divided into transposition ciphers and substitution ciphers.
|
|
Since transposition does not affect the frequency of individual symbols, simple transposition can be easily detected by the cryptanalyst by doing a frequency count. If the ciphertext exhibits a frequency distribution very similar to plaintext, it is most likely a transposition. This can then often be attacked by anagramming—sliding pieces of ciphertext around, then looking for sections that look like anagrams of English words, and solving the anagrams. Once such anagrams have been found, they reveal information about the transposition pattern, and can consequently be extended.
|
|
All are thought to be necessary for this complex process of transposition.
|
|
The following tables give the transposition scheme used in the Mulabhadra code.
|
|
A Cochrane Systematic Review compared several surgical treatments (myectomy, recession, anterior transposition, disinsertion) in people with fourth nerve palsy. While there was not enough high-quality evidence to recommend the best surgical treatment, all four types of surgery did result in a reduction of hypertropia. One study comparing inferior oblique anterior transposition with disinsertion found that participants who underwent anterior transposition had a greater proportion of participants who had resolved head tilt, and a lesser proportion of participants requiring a second surgery, compared to disinsertion. However, all participants who underwent anterior transposition developed elevation deficiency.
|
|
This is equivalent to a columnar transposition where the read-out is by rows instead of columns. Columnar transposition continued to be used for serious purposes as a component of more complex ciphers at least into the 1950s.
|
|
Switching the position of adjacent letters in the base word is a close transposition. This type of transposition creates the greatest priming effect. For example, an effective prime for the word "computer" would be the TL non-word "".
|
|
The sequential model differs in that a circular intermediate is a required step of transposition and because, until very recently, circular intermediates were not known for Helitrons, the concerted model was adapted to explain transposition. In either case, using reconstituted Helraiser transposons to study Helitron transposition, it was shown that the donor site must be double-stranded and that single-stranded donors will not suffice.
|
|
Despite this hypothesis, further experiments are necessary to verify the mechanism of transposition.
|
|
Yet, grilles provided seed ideas for transposition ciphers that are reflected in modern cryptography.
|
|
Studies in A. majus have also been used to suggest that, at high temperatures, DNA methylation is not vital in suppressing the Tam3 transposon. Previously, it was suggested that DNA methylation was important in this process, this theory coming from comparisons of the degrees of methylation when transposition is active and inactive. However, A. majus's Tam3 transposon process did not completely support this. Its permission of transposition at 15 °C and strong suppression of transposition at temperatures around 25 °C showed that suppression of the transposition state was unlikely to be caused by the methylation state.
|
|
Every use of modus tollens can be converted to a use of modus ponens and one use of transposition to the premise which is a material implication. For example: :If P, then Q. (premise – material implication) :If not Q, then not P. (derived by transposition) :Not Q . (premise) :Therefore, not P. (derived by modus ponens) Likewise, every use of modus ponens can be converted to a use of modus tollens and transposition.
|
|
Replicative transposition is a mechanism of transposition in molecular biology, proposed by James A. Shapiro in 1979,. in which the transposable element is duplicated during the reaction, so that the transposing entity is a copy of the original element. In this mechanism, the donor and receptor DNA sequences form a characteristic intermediate "theta" configuration, sometimes called a "Shapiro intermediate".. Replicative transposition is characteristic to retrotransposons and occurs from time to time in class II transposons..
|
|
Simple, or conservative transposition, is a non-replicative mode of transposition. That is, in conservative transposition the transposon is completely removed from the genome and reintegrated into a new, non-homologous locus, the same genetic sequence is conserved throughout the entire process. The site in which the transposon is reintegrated into the genome is called the target site. A target site can be in the same chromosome as the transposon or within a different chromosome.
|
|
Fritz Nebel (1891–1977)Friedrich L. Bauer: Decrypted Secrets, Methods and Maxims of Cryptology. Springer, Berlin 2007 (4. Aufl.), S. 53, . and introduced in March 1918, the cipher was a fractionating transposition cipher which combined a modified Polybius square with a single columnar transposition.
|
|
Chromatic transposition is scalar transposition within the chromatic scale, implying that every pitch in a collection of notes is shifted by the same number of semitones. For instance, transposing the pitches C4–E4–G4 upward by four semitones, one obtains the pitches E4–G4–B4.
|
|
Nc3 (Pirc Defence by transposition) 5... a6 6. a4 0-0 7. 0-0 b6 8.
|
|
The first duplicative transposition occurred about 1.2mya with a second larger genomic sequence invert occurring 880,000ya.
|
|
Transposition is a group of congenital defects involving an abnormal spatial arrangement of tissue or organ.
|
|
In European Union law, transposition is a process by which the European Union's member states give force to a directive by passing appropriate implementation measures. Transposition is typically done by either primary legislation or secondary legislation. The European Commission closely monitors that transposition is timely, correctly done and implemented, so as to attain the results intended. Incorrect transposition may be the result of non acting (leaving aside certain provisions), diverging (other scope, definition or requirement), "gold-plating" (exceeding the requirements of the directive), "double-banking" (overlapping between existing national laws and the transposed directive), or "regulatory creep" (overzealous enforcement or a state of uncertainty in the status of the regulation).
|
|
For example, if the message needed to be enciphered was THE DOG RAN FAR, the Chinese cipher would look like this: R R G T A A O H F N D E The cipher text then reads: RRGT AAOH FNDE Many transposition ciphers are similar to these two examples, usually involving rearranging the letters into rows or columns and then taking them in a systematic way to transpose the letters. Other examples include the Vertical Parallel and the Double Transposition Cipher. More complex algorithms can be formed by mixing substitution and transposition in a product cipher; modern block ciphers such as DES iterate through several stages of substitution and transposition.
|
|
The message is transposed via standard columnar transposition keyed by [Line-Q] above. (Note: if the message encoded length is not a multiple of 5 at this stage, an additional digit is added) The message is then transposed via Diagonal Transposition keyed by [Line-R] above.
|
|
The repositioning of these transposons (which coded for color) allowed other genes for pigment to be expressed. Transposition in maize causes changes in color; however, in other organisms, such as bacteria, it can cause antibiotic resistance. Transposition is also important in creating genetic diversity within species and adaptability to changing living conditions. During the course of human evolution, as much as 40% of the human genome has moved around via methods such as transposition of transposons.
|
|
Image- cleanup features include rotation, straightening, color adjustment, transposition, zoom, aligning, page separation, annotations and noise reduction.
|
|
Operations on ordered sequences of pitch classes also include transposition and inversion, as well as retrograde and rotation. Retrograding an ordered sequence reverses the order of its elements. Rotation of an ordered sequence is equivalent to cyclic permutation. Transposition and inversion can be represented as elementary arithmetic operations.
|
|
Verhoeff 1969, p. 95 The strengths of the algorithm are that it detects all transliteration and transposition errors, and additionally most twin, twin jump, jump transposition and phonetic errors. The main weakness of the Verhoeff algorithm is its complexity. The calculations required cannot easily be expressed as a formula.
|
|
The concert pitch of that note is what determines how we refer to the transposition of that instrument.
|
|
Her artwork examines the relationship between her inner world and the transposition of human perception in profane concepts.
|
|
Penoscrotal transposition (PST) is a group of congenital defects involving an abnormal spatial arrangement of penis and scrotum.
|
|
Transposition Tables, Gamedev.net, Francois-Dominic Laramee. In chess, for example, the sequence of moves 1. d4 Nf6 2.
|
|
A transposition table to a complex Hash Table which stores information about each section that has been searched.
|
|
Retrieved 26 October 2015 . addition and expansion of musical numbers, and transposition of the soprano role down a semitone.
|
|
Pitch class inversion: 234te reflected around 0 to become t9821 The basic operations that may be performed on a set are transposition and inversion. Sets related by transposition or inversion are said to be transpositionally related or inversionally related, and to belong to the same set class. Since transposition and inversion are isometries of pitch-class space, they preserve the intervallic structure of a set, even if they do not preserve the musical character (i.e. the physical reality) of the elements of the set.
|
|
The other transposition of the whole tone scale, avoided in the outer sections, is used and provides further harmonic contrast.
|
|
Acts which require transposition are published with a list of links to information about the national implementing measures (sector 7).
|
|
The families differ in their developmental timing and transposition frequency, as well other types of genetic rearrangements. Ac or Ds element insertion near a locus causes unstable mutations. Ds elements are considered non-autonomous because they cannot transpose without the presence of the Ac element, since they themselves cannot produce the enzyme transposase needed for transposition. However, since Ds elements can utilize the transposase enzyme produced by the Ac elements, it shows that they have the structural information needed for transposition and only lack the information needed to produce the enzyme.
|
|
The Acme code consists of one hundred thousand five letter codes each intended to stand in for a phrase. It was designed to be tolerant of transposition errors; the author claims that "no transposition of any two adjoining letters will make another word in the book". However, as later discovered by J. Reeds, the code did not provide this level of error correction, containing at least eleven pairs of words differing only by the transposition of two letters. Despite these errors, this code is a precursor to more modern error correction codes.
|
|
Straus created the concept of fuzzy transposition, and fuzzy inversion, to express transposition as a voice-leading event, "the 'sending' of each element of a given PC [pitch- class] set to its Tn-correspondent...[enabling] him to relate PC sets of two adjacent chords in terms of a transposition, even when not all of the 'voices' participated fully in the transpositional move.".Straus, Joseph N. (April 11, 2003). "Voice Leading in Atonal Music", unpublished lecture for the Dutch Society of Music Theory. Royal Flemish Conservatory of Music, Ghent, Belgium.
|
|
One study estimated the rate of transposition of a particular retrotransposon, the Ty1 element in Saccharomyces cerevisiae. Using several assumptions, the rate of successful transposition event per single Ty1 element came out to be about once every few months to once every few years. Some TEs contain heat-shock like promoters and their rate of transposition increases if the cell is subjected to stress, thus increasing the mutation rate under these conditions, which might be beneficial to the cell. Cells defend against the proliferation of TEs in a number of ways.
|
|
A transposition table is a cache whose maximum size is limited by available system memory, and it may overflow at any time. In fact, it is expected to overflow, and the number of positions cacheable at any time may be only a small fraction (even orders of magnitude smaller) than the number of nodes in the game tree. The vast majority of nodes are not transposition nodes, i.e. positions that will recur, so effective replacement strategies that retain potential transposition nodes and replace other nodes can result in significantly reduced tree size.
|
|
EMBO J, 2008.Ding, S., et al., Efficient transposition of the piggyBac (PB) transposon in mammalian cells and mice. Cell, 2005.
|
|
In a regular columnar transposition cipher, any spare spaces are filled with nulls; in an irregular columnar transposition cipher, the spaces are left blank. Finally, the message is read off in columns, in the order specified by the keyword. For example, suppose we use the keyword `ZEBRAS` and the message `WE ARE DISCOVERED. FLEE AT ONCE`.
|
|
Within this space the nerve may be compressed leading to supracondylar process syndrome. The ligament may also affect the ulnar nerve after an anterior transposition surgery, which is a commonly performed to manage patients with a cubital tunnel syndrome, a form of ulnar nerve entrapment. It is unlikely that the ulnar nerves are affected in patients without transposition surgeries.
|
|
Also known as "read-through" model 2 (RTM2). In this model, transposition initiates at the 5′ end of a Helitron and if the 3′ end of that Helitron is missing, so transposition is terminated at the next 3′ end of a Helitron in the correct orientation, gene capture would occur. The result is that all intervening sequence is captured.
|
|
The current standard involves transposition of the internal obturator muscle. This technique has a lower recurrence and complication rate than traditional hernia repair. A new technique uses porcine small intestinal submucosa as a biomaterial to help repair the defect. This is can also be done in combination with internal obturator muscle transposition, especially when that muscle is weak.
|
|
Nf3 Nf6 4.Nc3 Bb4 (or by transposition) offering Black active play from the start, has enjoyed a resurgence in recent times.
|
|
The rods in this section could be used to encrypt and decrypt text using a cyclic transposition cypher, based on a keyword.
|
|
IS605 transposases undergo a single-stranded intermediate stage during transposition, and it is possible that the motifs are functional during this stage.
|
|
Love Maps: Clinical Concepts of Sexual/Erotic Health and Pathology, Paraphilia, and Gender Transposition in Childhood, Adolescence, and Maturity. New York: Prometheus Books.
|
|
Cited in Schuijer (2008), pp. 61–62. A transformation within voice-leading space rather than pitch-class space as in pitch class transposition.
|
|
Others include atrial septal defect, cardiac diverticulum, pulmonic stenosis, double outlet right ventricle, tetralogy of Fallot, dextrocardia, and transposition of the great vessels.
|
|
It therefore checks for incorrectly entered digits and for digit transposition (digits in the wrong order will alter the sum due to weightings).
|
|
Transposase is an enzyme that binds to the end of a transposon and catalyses its movement to another part of the genome by a cut and paste mechanism or a replicative transposition mechanism. The word "transposase" was first coined by the individuals who cloned the enzyme required for transposition of the Tn3 transposon. The existence of transposons was postulated in the late 1940s by Barbara McClintock, who was studying the inheritance of maize, but the actual molecular basis for transposition was described by later groups. McClintock discovered that pieces of the chromosomes changed their position, jumping from one chromosome to another.
|
|
Transposon mutagenesis, or transposition mutagenesis, is a biological process that allows genes to be transferred to a host organism's chromosome, interrupting or modifying the function of an extant gene on the chromosome and causing mutation. Transposon mutagenesis is much more effective than chemical mutagenesis, with a higher mutation frequency and a lower chance of killing the organism. Other advantages include being able to induce single hit mutations, being able to incorporate selectable markers in strain construction, and being able to recover genes after mutagenesis. Disadvantages include the low frequency of transposition in living systems, and the inaccuracy of most transposition systems.
|
|
A transposition table is a cache of previously seen positions, and associated evaluations, in a game tree generated by a computer game playing program. If a position recurs via a different sequence of moves, the value of the position is retrieved from the table, avoiding re-searching the game tree below that position. Transposition tables are primarily useful in perfect-information games (where the entire state of the game is known to all players at all times). The usage of transposition tables is essentially memoization applied to the tree search and is a form of dynamic programming.
|
|
Trauma, oncological treatments or pressure ulcers can result in severe tissue defects. Those defects can be covered and closed by using autologe tissue transposition. The fact that each tissue defect is different makes it necessary for each tissue defect to be assessed individually. The choice of the type of tissue transposition depends on the location, nature, extent and status of the deformity.
|
|
Transposition involves the introduction of an insertion sequence somewhere in a chromosome. In gene expression programming insertion sequences might appear anywhere in the chromosome, but they are only inserted in the heads of genes. This method guarantees that even insertion sequences from the tails result in error-free programs. For transposition to work properly, it must preserve chromosome length and gene structure.
|
|
Another form of transposition cipher uses grilles, or physical masks with cut-outs. This can produce a highly irregular transposition over the period specified by the size of the grille, but requires the correspondents to keep a physical key secret. Grilles were first proposed in 1550, and were still in military use for the first few months of World War One.
|
|
PubMed . 3) Çelik A, Ugale S, Ofluoğlu H. Laparoscopic diverted resleeve with ileal transposition for failed laparoscopic sleeve gastrectomy: a case report. Surg Obes Relat Dis. 2015; 11(1): e5-7. 4) Celik A, Ugale S, Ofluoglu H, Asci M, Celik BO, Vural E, Aydin M. Technical feasibility and safety profile of laparoscopic diverted sleeve gastrectomy with ileal transposition (DSIT).
|
|
Therefore this move is tried first. For storing the best child of a node, the entry corresponding to that node in the transposition table is used. Use of a transposition table can lead to incorrect results if the graph-history interaction problem is not studiously avoided. This problem arises in certain games because the history of a position may be important.
|
|
The remaining island group was named Anagram Islands by the United Kingdom Antarctic Place- Names Committee in 1959, anagram meaning a transposition of parts.
|
|
From this came the intermediate form Bāxli, Sanskrit Bahlīka (also Balhika) for "Bactrian", and by transposition the modern Persian Balx, i.e. Balkh, and Armenian Bahl.
|
|
Various authors may prefer to talk about Hermite normal form in either row-style or column-style. They are essentially the same up to transposition.
|
|
The images in this clip are mirror-image flipped (with a left-right transposition), probably for the continuity of walking direction with the previous clips.
|
|
Historical pen and paper ciphers used in the past are sometimes known as classical ciphers. They include simple substitution ciphers (such as ROT13) and transposition ciphers (such as a Rail Fence Cipher). For example, "GOOD DOG" can be encrypted as "PLLX XLP" where "L" substitutes for "O", "P" for "G", and "X" for "D" in the message. Transposition of the letters "GOOD DOG" can result in "DGOGDOO".
|
|
Diatonic transposition is scalar transposition within a diatonic scale (the most common kind of scale, indicated by one of a few standard key signatures). For example, transposing the pitches C4–E4–G4 up two steps in the familiar C major scale gives the pitches E4–G4–B4. Transposing the same pitches up by two steps in the F major scale instead gives E4–G4–B4.
|
|
The presence of contiguous exons and introns within the host DNA carried by Helitrons suggested a DNA based mechanism of acquisition. Helitron gene capture was proposed to occur in a stepwise or sequential manner, i.e., gene capture occurs during one transposition and capture of a second gene occurs during a subsequent transposition event. Stepwise capture would result in Helitrons that contain gene fragments from different locations.
|
|
The RTS indicates to the Rep-Hel protein the end of the helitron and thus the end of transposition. The whole of this information lies in the hairpin structure formed by the palindromic sequence of DNA in the 3' end. Such a small structure is likely to be modified over time, enabling to by-pass the helitron's end during its transposition and to capture neighbouring gene sequence.
|
|
But all is not lost if a grille copy can't be obtained. The later variants of the Cardano grille present problems which are common to all transposition ciphers. Frequency analysis will show a normal distribution of letters, and will suggest the language in which the plaintext was written. The problem, easily stated though less easily accomplished, is to identify the transposition pattern and so decrypt the ciphertext.
|
|
For example, one could move the pitch of every note up by a perfect fifth, keeping the tempo the same. One can view this transposition as "pitch shifting", "shifting" each note up 7 keys on a piano keyboard, or adding a fixed amount on the Mel scale, or adding a fixed amount in linear pitch space. One can view the same transposition as "frequency scaling", "scaling" (multiplying) the frequency of every note by 3/2. Musical transposition preserves the ratios of the harmonic frequencies that determine the sound's timbre, unlike the frequency shift performed by amplitude modulation, which adds a fixed frequency offset to the frequency of every note.
|
|
Steps in "cut-and-paste" mechanism of transposition. The mechanism by which conservative transposition occurs is called the "cut-and-paste" method, which involves five main steps: # The transposase enzyme is bound to the inverted repeated sequences flanking the ends of the transposonInverted repeats define the ends of transposons and provide recognition sites for transposase to bind. # The formation of the transposition complex In this step the DNA bends and folds into a pre-excision synaptic complex so the two transposases enzymes can interact. # The interaction of these transponases activates the complex; transposase makes double stranded breaks in the DNA and the transposon is fully excised.
|
|
For example, transposition from the key of C major to D major raises all pitches of the scale of C major equally by a whole tone. Since the interval relationships remain unchanged, transposition may be unnoticed by a listener, however other qualities may change noticeably because transposition changes the relationship of the overall pitch range compared to the range of the instruments or voices that perform the music. This often affects the music's overall sound, as well as having technical implications for the performers. The interrelationship of the keys most commonly used in Western tonal music is conveniently shown by the circle of fifths.
|
|
Baffes was known for his surgical procedure, transposition of the great vessels of the heart, to correct one of the heart defects causing "blue baby" deaths.
|
|
There are a number of basic operations that can be applied to modify matrices, called matrix addition, scalar multiplication, transposition, matrix multiplication, row operations, and submatrix.
|
|
Horie, K., et al., Characterization of Sleeping Beauty transposition and its application to genetic screening in mice. Mol Cell Biol, 2003. 23(24): p. 9189-207.
|
|
1972–1975: Ahmad Bukhari shows that Mu can insert randomly and prolifically throughout an entire bacterial genome, creating stable insertions. He also demonstrates that the reversion of the gene to its original and undamaged form is possible with the excision Mu. 1979: Jim Shapiro develops a Mu inspired model for transposition involving the ‘Shapiro Intermediate,’ in which both the donor and the target undergo two cleavages and then the donor is ligated into the target, creating two replication forks and allowing for both transposition and replication. 1983: Kiyoshi Mizuuchi develops a protocol for observing transposition in vitro using mini-Mu plasmids, allowing for a greatly increased understanding of the chemical components of transposition. 1994–2012: Because of shared mechanisms of insertion, Mu acts as a useful organism to elucidate the process of HIV integration, eventually leading to HIV integrase inhibitors such as raltegravir in 2008.
|
|
Transposition tables are an essential part of a computer chess program. Transpositions exist in other abstract strategy games such as shogi, go, tic-tac-toe and hex.
|
|
Freeling M. (2009). Bias in plant gene content following different sorts of duplication: tandem, whole-genome, segmental, or by transposition. Annu Rev Plant Biol 60: 433–453.
|
|
The rail fence cipher (also called a zigzag cipher) is a form of transposition cipher. It derives its name from the way in which it is encoded.
|
|
Matthew Baillie (27 October 1761 – 23 September 1823) was a British physician and pathologist, credited with first identifying transposition of the great vessels (TGV) and situs inversus.
|
|
Late outcome of Senning and Mustard procedures for correction of transposition of the great arteries. Dosl L, Teruell L, Ferreiral IJ.Heart 2005;91:652-656 Before the utilization of surgical repair, Kirklin reports that the mortality associated with unrepaired TGA was 55%, 85%, and 90% mortality rates at 1 month, 6 months, and 1 year, respectively. This numbers correspond to all types of TGA.Complete transposition of the great arteries.
|
|
SINEs exploit LINE transposition components despite LINE-binding proteins prefer binding to LINE RNA. SINEs cannot transpose by themselves because they cannot encode SINE transcripts. They usually consist of parts derived from tRNA and LINEs. The tRNA portion contains an RNA polymerase III promoter which the same kind of enzyme as RNA polymerase II. This makes sure the LINE copies would be transcribed into RNA for further transposition.
|
|
1) Celik A, Asci M, Celik BO, Ugale S. The impact of laparoscopic diverted sleeve gastrectomy with ileal transposition (DSIT) on short term diabetic medication costs. SpringerPlus. 2015; 14(4): 417-422. 2) Celik A, Ugale S, Ofluoglu H, Vural E, Cagiltay E, Cat H, Asci M, Celik BO. Metabolic Outcomes of Laparoscopic Diverted Sleeve Gastrectomy with Ileal Transposition (DSIT) in Obese Type 2 Diabetic Patients. Obes Surg. 2015 Apr 19.
|
|
By applying simple operations such as transposition and inversion, one can discover deep structures in the music. Operations such as transposition and inversion are called isometries because they preserve the intervals between tones in a set. Expanding on the methods of musical set theory, some theorists have used abstract algebra to analyze music. For example, the pitch classes in an equally tempered octave form an abelian group with 12 elements.
|
|
Fi24 is one of the 26 sporadic groups and is the largest of the three Fischer groups introduced by while investigating 3-transposition groups. It is the 3rd largest of the sporadic groups (after the Monster group and Baby Monster group). The outer automorphism group has order 2, and the Schur multiplier has order 3. The automorphism group is a 3-transposition group Fi24, containing the simple group with index 2.
|
|
It was a transposition cypher, not a super-enciphered code like JN-25. They also broke JN-152 a simple transposition and substitution cypher for navigation warnings and the previously impenetrable JN-167, another merchant shipping cypher.Smith (2000) page 195 & (2001) pp140-143 These successes enabled Allied forces e.g. submarines to attack Japanese supply ships, and resulted in the Japanese merchant marine suffering 90 per cent losses by August 1945.
|
|
Transposition tables are typically implemented as hash tables encoding the current board position as the hash index. The number of possible positions that may occur in a game tree is an exponential function of depth of search, and can be thousands to millions or even much greater. Transposition tables may therefore consume most of available system memory and are usually most of the memory footprint of game playing programs.
|
|
Through her work with these different transposons, Baker started to look at unfoldases, which are a type of protein chaperone. Unfoldases serve to unfold or degrade proteins found in cells. Unfoldases are related to transposons because some of them release proteins that aid in transposition. When the proteins are released, transposition of the DNA sequence is stopped, and Baker wanted to know what caused the proteins to release from DNA.
|
|
Filmmaking company Transposition Films, composed of legendary members itself, avoided questions regarding their involvement in filming a documentary about the process.Hokus Pick's Comeback (Video uploaded November 7, 2008).
|
|
In the latest approved plan for reforming the EMU, this recommendation was adopted with a target for its transposition to take place at the latest in June 2017.
|
|
Therefore, efficient in-place matrix transposition has been the subject of numerous research publications in computer science, starting in the late 1950s, and several algorithms have been developed.
|
|
In classical rhetoric, figures of speech are classified as one of the four fundamental rhetorical operations or quadripartita ratio: addition (adiectio), omission (detractio), permutation (immutatio) and transposition (transmutatio).
|
|
Assistant's Revenge performed by Christian Farla The Assistant's Revenge is a transposition illusion in which two performers change places. It was created by magician and inventor Robert Harbin.
|
|
All cryptanalytic work on the double transposition systems was carried out entirely by hand by Marquart, and no attempt was made to develop any statistical machine methods for solution.
|
|
Dupuy, A.J., S. Fritz, and D.A. Largaespada, Transposition and gene disruption in the male germline of the mouse. Genesis, 2001. 30(2): p. 82-8.Dupuy, A.J., et al.
|
|
Genomic DNA from a single cell is randomly fragmented and tagged by LIANTI transposome insertion during transposition reaction. 4\. Gap filling. After Tn5 transposition, both ends of each DNA fragment are gap filled and extended by DNA polymerase extension, converting single-stranded loops into double- stranded T7 promoters on both ends of each fragment. The residue Tn5 transposase and DNA polymerase are subsequently removed by protease digestion, followed by heat inactivation of the protease. 5\.
|
|
In the "babysitter" procedure, the hypoglossal nerve or masseteric nerve on the affected side is identified. This donor nerve is then attached to the distal end of the paralysed facial nerve. Techniques for donor nerve transfers are transposition of the entire donor nerve, partial transposition by splitting the donor nerve longitudinally or indirect hypoglossal- or masseteric-facial anatomosis using a 'jump' interposition graft. This usually is the great auricular nerve or sural nerve.
|
|
A simple transposon also called "conservative transposon" is an insertion sequence (IS element) that contains its own coding transposase between the short, inverted, repeated sequences that flank (present) its gene coding region. Transposase is responsible for excision and transfer while resolvase is responsible for resolution of the transfer. Simple transposition is also called cut-and-paste transposition because the element is cut out of its original site and pasted into a new one.
|
|
Within a few years, the growing use of electricity again brought an increase of interference, so engineers devised a method called wire transposition, to cancel out the interference. In wire transposition, the wires exchange position once every several poles. In this way, the two wires would receive similar EMI from power lines. This represented an early implementation of twisting, with a twist rate of about four twists per kilometre, or six per mile.
|
|
Insertion of a SINE upstream of a coding region may result in exon shuffling or changes to the regulatory region of the gene. Insertion of a SINE into the coding sequence of a gene can have deleterious effects and unregulated transposition can cause genetic disease. The transposition and recombination of SINEs and other active nuclear elements is thought to be one of the major contributions of genetic diversity between lineages during speciation.
|
|
The "cut-and-paste" method is used in conservative transposition. The enzyme transposase acts like DNA scissors, cutting through the double stranded DNA to remove a transposon from one genomic site. A new cut is made in the target site where the transposon is integrated back into the DNA. Transposition is the process by which a specific genetic sequence, known as a transposon, is moved from one location of the genome to another.
|
|
Mutation of these regions results in an inability of transposase genes to bind to the sequences. The binding interactions between transposase and these sequences is very complicated, and is affected by DNA methylation and other epigenetic marks. In addition, other proteins seem to be able to bind with and affect the transposition of the IS50 elements, such as DnaA. The most likely pathway of Tn 5 transposition is the common pathway for all transposon systems.
|
|
A train identifies that it has entered a new zone by either detecting the cable transposition point in the cable or when it has traveled . A train can miss detecting up to 3 transposition points and still remain under LZB control. The procedure for entering LZB controlled track is repeated when a train transitions from one controlled section to another. The train receives a new "change of section identification" telegram and gets a new address.
|
|
The cipher used was often double transposition. To indicate to the receiver which words had been chosen, an indicator group of letters is sent at the start of the message.
|
|
Arthur Cayley (1858) "A memoir on the theory of matrices", Philosophical Transactions of the Royal Society of London, 148 : 17–37. The transpose (or "transposition") is defined on page 31.
|
|
In classical cryptography, the bifid cipher is a cipher which combines the Polybius square with transposition, and uses fractionation to achieve diffusion. It was invented around 1901 by Felix Delastelle.
|
|
Viral replication is cytoplasmic. Entry into the host cell is achieved by adsorption into the host cell. Replication follows the replicative transposition model. DNA-templated transcription is the method of transcription.
|
|
Using a coarser notion of equivalence that also allows transposition, there are 4 inequivalent matrices of order 16, 3 of order 20, 36 of order 24, and 294 of order 28.
|
|
In error detection, the Damm algorithm is a check digit algorithm that detects all single-digit errors and all adjacent transposition errors. It was presented by H. Michael Damm in 2004.
|
|
The Insertion sequence IS1222 ribosomal frameshifting element is an RNA element found in the insertion sequence IS222. The ribosomal frameshifting element stimulates frameshifting which is known to be required for transposition.
|
|
Cut- and-paste transposition does not cause an increase in the number of transposons per se: there is one copy at the start and one copy at the end. If this was the end of the matter the transposon would perish by genetic drift and the loss of copies owing to the occasional failure to achieve successful integration at the target site. However, the transposon has a mechanism to favor transposition immediately after a replication fork passes through, leaving a hemimethylated copy of Tn10 on each sister chromosome. Since transposition is favored when Tn10 is hemimethylated, the transposon on one sister chromosome can hop somewhere onto the other chromosome so that two copies of the transposon end up on one chromosome.
|
|
Levo-Transposition of the great arteries is an acyanotic congenital heart defect in which the primary arteries (the aorta and the pulmonary artery) are transposed, with the aorta anterior and to the left of the pulmonary artery; the morphological left and right ventricles with their corresponding atrioventricular valves are also transposed. Use of the term "corrected" has been disputed by many due to the frequent occurrence of other abnormalities and or acquired disorders in l-TGA patients. In segmental analysis, this condition is described as atrioventricular discordance (ventricular inversion) with ventriculoarterial discordance. l-TGA is often referred to simply as transposition of the great arteries (TGA); however, TGA is a more general term which may also refer to dextro-transposition of the great arteries (d-TGA).
|
|
Excerpt of the trumpet part of Symphony No. 9 of Antonín Dvořák, where sight transposition is required. Although transpositions are usually written out, musicians are occasionally asked to transpose music "at sight", that is, to read the music in one key while playing in another. Musicians who play transposing instruments sometimes have to do this (for example when encountering an unusual transposition, such as clarinet in C), as well as singers' accompanists, since singers sometimes request a different key than the one printed in the music to better fit their vocal range (although many, but not all, songs are printed in editions for high, medium, and low voice). There are three basic techniques for teaching sight transposition: interval, clef, and numbers.
|
|
Unfortunately, this situation is likely to get worse before it gets better, as workload for users and workers using manual direct data entry (DDE) devices increases. Double entry (or more) may also be leveraged to minimize transcription or transposition error, but at the cost of a reduced number of entries per unit time. Mathematical transposition errors are easily identifiable. Add up the numbers that make up the difference and the resultant number will always be evenly divisible by nine.
|
|
Similarly, moving one section towards the left of the performer generally corresponds to a transposition of a perfect fifth upwards. These are only rules of thumb since the arrangement has to be modified towards the extremes of the pitch range to fill out notes in the chromatic scale. Such an arrangement facilitates transposition. In the playing of traditional Chinese music, most Chinese yangqin players use a numerical notation system called jianpu, rather than Western staff notation.
|
|
The defect is called transposition of the great vessels, or transposition of the great arteries (TGV or TGA). Until the late 1950s, and Senning's operation the condition was commonly fatal. The defect causes blood from the lungs to flow back to the lungs and blood from the body to flow back to the body. This occurs because the aorta and the pulmonary artery, the two major arteries coming out of the heart, are connected to the wrong chambers.
|
|
Transposition can be seen as a rotation of t either clockwise or anti-clockwise on a circle, where each note of the chord is rotated equally. For example, if t = 2 and the chord is [0 3 6], transposition (clockwise) will be [2 5 8]. Inversion can be seen as a symmetry with respect to the axis formed by 0 and 6. If we carry on with our example [0 3 6] becomes [0 9 6].
|
|
The mechanism of Tn10 transposition has served as a model system and the archetype for the cut-and-paste mechanisms. However, the transposase is difficult to work with in vitro and the Tn5 transposase was the first to be crystallized. Tn10 was one of the great work-horses of bacterial genetics for many years during which it served as a useful tool. A commercial kit for Tn5 transposition is commercially available and is extensively used in post- genomic technologies.
|
|
According to the RTM2 model the 3' terminus of another Helitron serves as an RC terminator of transposition. This occurs after a malfunction of the RC terminator. Lastly in the FDNA model portions of genes or non-coding regions can accidentally serve as templates during repair of ds DNA breaks occurring in helitrons. Even though helitrons have been proven to be a very important evolutionary tool, the specific details for their mechanisms of transposition are yet to be defined.
|
|
Helitrons are proposed to transpose by a mechanism similar to rolling-circle replication via a single- stranded DNA intermediate. Two models are proposed for the transposition mechanism: the concerted and the sequential. In the concerted model, the donor strand cleavage and ligation occurs simultaneously while in the sequential model they occur in a stepwise fashion. The concerted model does not require a circular intermediate although they could occur if a step fails or is bypassed during transposition.
|
|
The number of positions searched by a computer often greatly exceeds the memory constraints of the system it runs on; thus not all positions can be stored. When the table fills up, less-used positions are removed to make room for new ones; this makes the transposition table a kind of cache. The computation saved by a transposition table lookup is not just the evaluation of a single position. Instead, the evaluation of an entire subtree is avoided.
|
|
Rules of replacement are used in propositional logic to manipulate propositions. Common rules of replacement include de Morgan's laws, commutation, association, distribution, double negation, transposition, material implication, material equivalence, exportation, and tautology.
|
|
Repeating the transposition allows formulas with deeper nesting to be simplified to a form in which they have a single existential quantifier followed by a single universal quantifier, showing that PH=\Sigma_2.
|
|
Epstein had already imagined that "through the transposition of natural sounds, it becomes possible to create chords and dissonances, melodies and symphonies of noise, which are a new and specifically cinematographic music" .
|
|
Arterial switch operation In 1977, he devised a two-stage approach for an arterial switch operation (ASO) in older people with transposition of the great arteries with an intact ventricular septum (IVS).
|
|
A single columnar transposition could be attacked by guessing possible column lengths, writing the message out in its columns (but in the wrong order, as the key is not yet known), and then looking for possible anagrams. Thus to make it stronger, a double transposition was often used. This is simply a columnar transposition applied twice. The same key can be used for both transpositions, or two different keys can be used. As an example, we can take the result of the irregular columnar transposition in the previous section, and perform a second encryption with a different keyword, `STRIPE`, which gives the permutation "564231": 5 6 4 2 3 1 E V L N A C D T E S E A R O F O D E E C W I R E E As before, this is read off columnwise to give the ciphertext: CAEEN SOIAE DRLEF WEDRE EVTOC If multiple messages of exactly the same length are encrypted using the same keys, they can be anagrammed simultaneously.
|
|
White has three viable moves to meet the check. 4.Nc3 is a transposition to the Kasparov Variation of the Nimzo-Indian, therefore the main independent variations are 4.Bd2 and 4.Nbd2.
|
|
50 CE), writing in Greek, listed the operations as addition (πρόσθεσις), subtraction (ἀφαίρεσις), transposition (μετάθεσις), and transmutation (ἀλλοίωσις).Harry Caplan Quintilian (c. 35 – c. 100) mentioned them in Institutio Oratoria (ca 95 CE).
|
|
A coherent algebra is an algebra of complex square matrices that is closed under ordinary matrix multiplication, Schur product, transposition, and contains both the identity matrix I and the all-ones matrix J.
|
|
Since transposing the mode up a whole tone produces the same set of notes, mode 1 has only 2 transpositions. Any scale having 12 different transpositions is not a mode of limited transposition.
|
|
Movement of the keyboard allows one to play higher or lower, though the topmost or bottommost key will not produce sound unless the builder has provided extra strings to accommodate the transposition feature.
|
|
The TB-303 has a 16-step sequencer wherein each step can contain a note (ranging from a bottom C to upper C), a transposition up or down, a slide, and an accent.
|
|
Fi23 is one of the 26 sporadic groups and is one the three Fischer groups introduced by while investigating 3-transposition groups. The Schur multiplier and the outer automorphism group are both trivial.
|
|
Olivier Messiaen in his work The Technique of my Musical Language developed what he called Modes of limited transposition which displayed a special type of symmetry and which he used in numerous compositions.
|
|
Apollo 7 S-IVB, with docking target inside the SLA. Note the right-hand panel is not fully opened to the same angle as the others, preventing a safe simulated docking approach. Transposition and docking was performed on all Apollo missions which carried both the CSM and the LM, from Apollo 9 onward. Transposition and a mock LM-docking approach was first simulated on the Earth-orbiting Apollo 7 flight (which carried a docking target in the SLA, but no LM).
|
|
If excision is precise and the original sequence of DNA is restored, reversible phase variation can be mediated by transposition. Phase variation mediated by transposition targets specific DNA sequences. P. atlantica contains an eps locus that encodes extracellular polysaccharide and the ON or OFF expression of this locus is controlled by the presence or absence of IS492. Two recombinases encoded by MooV and Piv mediate the precise excision and insertion, respectively, of the insertion element IS492 in the eps locus.
|
|
Conservative transposition uses the "cut-and-paste" mechanism driven by the catalytic activity of the enzyme transposase. Transposase acts like DNA scissors; it is an enzyme that cuts through double-stranded DNA to remove the transposon, then transfers and pastes it into a target site. A simple, or conservative, transposon refers to the specific genetic sequence that is moved via conservative transposition. These specific genetic sequences range in size, they can be hundreds to thousands of nucleotide base-pairs long.
|
|
The transposition of Ds in different cells is random, it may move in some but not others, which causes color mosaicism. The size of the colored spot on the seed is determined by stage of the seed development during dissociation. McClintock also found that the transposition of Ds is determined by the number of Ac copies in the cell. Between 1948 and 1950, she developed a theory by which these mobile elements regulated the genes by inhibiting or modulating their action.
|
|
Primacy and recency effects: Primacy effects refer to better recall of items earlier in the sequence, while recency effects refer to better recall of the last few items. Recency effects are seen more with auditory stimuli rather than verbal stimuli as auditory presentation seems to protect the end of lists from output interference. ; 3. Transposition gradients: Transposition gradients refer to the fact that recall tends to be better to recognize what an item is rather than the order of items in a sequence.
|
|
The VIC cipher can be regarded as the evolutionary pinnacle of the Nihilist cipher family. The VIC cipher has several important integrated components, including mod 10 chain addition, a lagged Fibonacci generator (a recursive formula used to generate a sequence of pseudorandom digits), a straddling checkerboard, and a disrupted double transposition. Until the discovery of VIC, it was generally thought that a double transposition alone was the most complex cipher an agent, as a practical matter, could use as a field cipher.
|
|
Atrial septostomy is a surgical procedure in which a small hole is created between the upper two chambers of the heart, the atria. This procedure is primarily used to palliate dextro-Transposition of the great arteries or d-TGA (often imprecisely called transposition of the great arteries), a life- threatening cyanotic congenital heart defect seen in infants. It is performed prior to an arterial switch operation. Atrial septostomy has also seen limited use as a surgical treatment for pulmonary hypertension.
|
|
Performed as either an open surgery or laparoscopically, duodenojejunostomy involves the creation of an anastomosis between the duodenum and the jejunum, bypassing the compression caused by the AA and the SMA. Less common surgical treatments for SMA syndrome include Roux-en-Y duodenojejunostomy, gastrojejunostomy, anterior transposition of the third portion of the duodenum, intestinal derotation, division of the ligament of Treitz (Strong's operation), and transposition of the SMA. Both transposition of the SMA and lysis of the duodenal suspensory muscle have the advantage that they do not involve the creation of an intestinal anastomosis. The possible persistence of symptoms after surgical bypass can be traced to the remaining prominence of reversed peristalsis in contrast to direct peristalsis, although the precipitating factor (the duodenal compression) has been bypassed or relieved.
|
|
The procedure chosen will depend upon the degree to which any function remains in the affected lateral rectus. Where there is complete paralysis, the preferred option is to perform vertical muscle transposition procedures such as Jensen's, Hummelheim's or whole muscle transposition, with the aim of using the functioning inferior and superior recti to gain some degree of abduction. An alternative approach is to operate on both the lateral and medial rectii of the affected eye, with the aim of stabilising it at the midline, thus giving single vision straight ahead but potentially diplopia on both far left and right gaze. This procedure is often most appropriate for those with total paralysis who, because of other health problems, are at increased risk of the anterior segment ischaemia associated with complex multi-muscle transposition procedures.
|
|
La venexiana (internationally released as The Venetian Woman) is a 1986 Italian erotic film directed by Mauro Bolognini. The film is a transposition of the anonymous 16th century comedy play with the same name.
|
|
Helitrons seem to have a major role in the evolution of host genomes. They frequently capture diverse host genes, some of which can evolve into novel host genes or become essential for Helitron transposition.
|
|
The Akor-Neb civilization of Last Enemy is Second Level; its technology is almost identical to the Home Timeline except for paratemporal transposition. The culture there has legends or records of their Martian origins.
|
|
Cecil Adams article on Irving Berlin at straightdope.com Many electronic or digital pianos and keyboards can transpose. The harmonium sometimes features a mechanically shifted keyboard for transposition. A guitar capo has much the same effect.
|
|
Barrabás created the original drum and bass lines, with the flute transposition of the melodic loop (the famous sample in the Beatnuts and Jennifer Lopez tracks) introduced in the Herbie Mann and Enoch Light covers.
|
|
Within the transposon are five discrete genes encoding for proteins that make up the transposition machinery. In addition, the transposon contains an integron, a DNA segment containing several cassettes of genes encoding for antibiotic-resistance.
|
|
The novel is many things: an elegy, a fever dream, a document of abuse, a distorted transposition of one consciousness into language. It is not clear; it is not easy. It takes effort to decode.
|
|
Many other optimizations can be used to make chess-playing programs stronger. For example, transposition tables are used to record positions that have been previously evaluated, to save recalculation of them. Refutation tables record key moves that "refute" what appears to be a good move; these are typically tried first in variant positions (since a move that refutes one position is likely to refute another). The drawback is that transposition tables at deep ply depths can get quite large - tens to hundreds of millions of entries.
|
|
The term Mixolydian was originally used to designate one of the traditional harmoniai of Greek theory. It was appropriated later (along with six other names) by 2nd-century theorist Ptolemy to designate his seven tonoi or transposition keys. Four centuries later, Boethius interpreted Ptolemy in Latin, still with the meaning of transposition keys, not scales. When chant theory was first being formulated in the 9th century, these seven names plus an eighth, Hypermixolydian (later changed to Hypomixolydian), were again re-appropriated in the anonymous treatise Alia Musica.
|
|
Examples of ciphers that combine fractionation and transposition include the bifid cipher, the trifid cipher, the ADFGVX cipher and the VIC cipher. Another choice would be to replace each letter with its binary representation, transpose that, and then convert the new binary string into the corresponding ASCII characters. Looping the scrambling process on the binary string multiple times before changing it into ASCII characters would likely make it harder to break. Many modern block ciphers use more complex forms of transposition related to this simple idea.
|
|
And still later, access to Japanese Army messages from decrypts of Army communications traffic assisted in planning the island hopping campaign to the Philippines and beyond. Another source of information was the Japanese Military Attaché code (known as JMA to the Allies) introduced in 1941. This was a fractionating transposition system based on two-letter code groups which stood for common words and phrases. The groups were written in a square grid according to an irregular pattern and read off vertically, similar to a disrupted columnar transposition.
|
|
Musical set theory uses the language of mathematical set theory in an elementary way to organize musical objects and describe their relationships. To analyze the structure of a piece of (typically atonal) music using musical set theory, one usually starts with a set of tones, which could form motives or chords. By applying simple operations such as transposition and inversion, one can discover deep structures in the music. Operations such as transposition and inversion are called isometries because they preserve the intervals between tones in a set.
|
|
Implantable colour-to-sound chips, software, mobile apps and cyborg antennas use Harbisson's Sonochromatic Scales as a standard transposition of colour frequencies to sound frequencies. The Sonochromatic Music Scale is a microtonal and logarithmic scale with 360 notes in an octave. Each note corresponds to a specific degree of the color wheel. Modern Painters, The International Contemporary Art Magazine pp 70–73 (New York City, June 2008) Harbisson's Pure Sonochromatic Scale is a non- logarithmic scale based on the transposition of light frequencies to sound frequencies.
|
|
For example, associative chaining predicts the tendencies of transposition errors, which occur most often with items in nearby positions. An example of a transposition error would be recalling the sequence "apple, orange, banana" instead of "apple, banana, orange." Positional coding theory suggests that every item in a list is associated to its position in the list. For example, if the list is "apple, banana, orange, mango" apple will be associated to list position 1, banana to 2, orange to 3, and mango to 4.
|
|
LUCIFER uses a combination of transposition and substitution crypting as a starting point in decoding ciphers. One variant, described by Feistel in 1971,Horst Feistel. Block Cipher Cryptographic System, US Patent 3,798,359. Filed June 30, 1971.
|
|
Moreover, any reasonable choice for the adjacent transpositions will work: it suffices to choose at each step a transposition of i and where i is a descent of the permutation as modified so far (so that the transposition will remove this particular descent, although it might create other descents). This is so because applying such a transposition reduces the number of inversions by 1; as long as this number is not zero, the permutation is not the identity, so it has at least one descent. Bubble sort and insertion sort can be interpreted as particular instances of this procedure to put a sequence into order. Incidentally this procedure proves that any permutation σ can be written as a product of adjacent transpositions; for this one may simply reverse any sequence of such transpositions that transforms σ into the identity.
|
|
The three octatonic collections are transpositionally and inversionally symmetric—that is, they are related by a variety of transposition and inversion operations: They are each closed under transpositions by 3, 6, or 9 semitones. A transposition by 1, 4, 7, or 10 semitones will transform the E scale into the D scale, the D scale into the D scale, and the D scale into the E scale. Conversely, transpositions by 2, 5, 8, or 11 semitones acts in the reverse way; the E scale goes to the D scale, D to D and D to E. Thus, the set of transpositions acts on the set of diminished collections as the integers modulo 3. If the transposition is congruent to 0 mod 3 the pitch collection is unchanged and the transpositions by 1 semitone or by 2 semitones are inverse to one another.
|
|
Three note sets from the diatonic scale in the chromatic circle: M2M2=red, M2m2=yellow, and m2M2=blue The musical operation of scalar transposition shifts every note in a melody by the same number of scale steps. The musical operation of chromatic transposition shifts every note in a melody by the same distance in pitch class space. In general, for a given scale S, the scalar transpositions of a line L can be grouped into categories, or transpositional set classes, whose members are related by chromatic transposition. In diatonic set theory cardinality equals variety when, for any melodic line L in a particular scale S, the number of these classes is equal to the number of distinct pitch classes in the line L. For example, the melodic line C-D-E has three distinct pitch classes.
|
|
During transposition of the helitron, a circular intermediate is formed which was isolated in the cells transfected with the plasmid. It is formed by the joining of the terminal ends and suggests a rolling-circle model of transposition during which the cleavage of both the donor and the target strands do not occur at the same time since a single-stranded circular DNA is first formed with one of the strands of the helitron. This model is supported by the fact that the deletion of one of the two tyrosines (Y727) of the Rep domain thought to be involved in cleavage of the strands doesn't actually affect the efficiency of helitron transposition. Only one of the tryosines would be required, in order to ensure a two-step process: 1) the cleavage of the donor DNA and 2) the integration into the target site.
|
|
The E octatonic collection from mm. 1–11 is related to this D octatonic collection by the transposition operations, T, T4, T7, T10. In mm. 26–29, all eight pitch classes from the D octatonic collection appear.
|
|
In some types of congenital heart defect (e.g., transposition of the great arteries), prostaglandins may be administered to maintain the ductus arteriosus open, allowing for the continual circulation and oxygenation of blood, until surgery can be performed.
|
|
Another frequent transposition into the Modern Benoni occurs when White invites a Catalan Opening with 1.d4 Nf6 2.c4 e6 3.g3 and Black responds with 3...c5. If White responds with 4.d5 exd5 5.
|
|
Note that the method of transposition and contraposition should not be confused. Contraposition is a type of immediate inference in which from a given categorical proposition another categorical proposition is inferred which has as its subject the contradictory of the original predicate. Since nothing is said in the definition of contraposition with regard to the predicate of the inferred proposition, it is permissible that it could be the original subject or its contradictory. This is in contradistinction to the form of the propositions of transposition, which may be material implication, or a hypothetical statement.
|
|
In puzzles where previous actions do not influence the solution, you need to only evaluate this position once to get a solution for both paths. To avoid evaluating the same position more than once (and thus wasting computation cycles), programs written to solve these kinds of puzzles use transposition tables. A transposition is a puzzle state that can be reached by different paths but has the same solution. Every time such a program starts evaluating a position, it first looks up in a table if the position has already been evaluated.
|
|
This language, Bakhtin argues, cannot be adequately verbalized or translated into abstract concepts, but it is amenable to a transposition into an artistic language that resonates with its essential qualities: it can, in other words, be "transposed into the language of literature". Bakhtin calls this transposition the carnivalization of literature. Although he considers a number of literary forms and individual writers, it is Francois Rabelais, the French Renaissance author of Gargantua and Pantagruel, and the 19th century Russian author Fyodor Dostoevsky, that he considers the primary exemplars of carnivalization in literature.
|
|
In cryptography, a substitution cipher is a method of encrypting by which units of plaintext are replaced with ciphertext, according to a fixed system; the "units" may be single letters (the most common), pairs of letters, triplets of letters, mixtures of the above, and so forth. The receiver deciphers the text by performing the inverse substitution. Substitution ciphers can be compared with transposition ciphers. In a transposition cipher, the units of the plaintext are rearranged in a different and usually quite complex order, but the units themselves are left unchanged.
|
|
Even late in the twentieth century, McClintock's contribution to biology was still not widely acknowledged as amounting to the discovery of genetic regulation. McClintock was widely credited with discovering transposition after other researchers finally discovered the process in bacteria, yeast, and bacteriophages in the late 1960s and early 1970s. During this period, molecular biology had developed significant new technology, and scientists were able to show the molecular basis for transposition. In the 1970s, Ac and Ds were cloned by other scientists and were shown to be class II transposons.
|
|
JN-39 was replaced by JN-40, which was originally believed to be a code super-enciphered with a numerical additive in the same way as JN-25. However, in September 1942, an error by the Japanese gave clues to John MacInnes and Brian Townend, codebreakers at the British FECB, Kilindini. It was a fractionating transposition cipher based on a substitution table of 100 groups of two figures each followed by a columnar transposition. By November 1942, they were able to read all previous traffic and break each message as they received it.
|
|
Front cover of general Reservehandverfahren instruction booklet ' () was a German Naval World War II hand-cipher system used as a backup method when no working Enigma machine was available.The Enigma General Procedure Manual, 1940 The cipher had two stages: a transposition followed by bigram substitution. In the transposition stage, the cipher clerk would write out the plaintext into a "cage" — a shape on a piece of paper. Pairs of letters were then substituted using a set of bigram tables.Hugh Sebag-Montefiore, Enigma: Battle for the Code, 2000, pp. 213-214.
|
|
Composers transform musical patterns by moving every note in the pattern by a constant number of scale steps: thus, in the C major scale, the pattern C–D–E might be shifted up, or transposed, a single scale step to become D–E–F. This process is called "scalar transposition" or "shifting to a new key" and can often be found in musical sequences and patterns. (It is D-E-F# in Chromatic transposition). Since the steps of a scale can have various sizes, this process introduces subtle melodic and harmonic variation into the music.
|
|
Arpeggios can be played on the built-in keyboard (not on external keyboard) in realtime, during performance or recording. Arpeggios may move up, down, or randomly with several sorting, holding, octave range, and transposition options.Owner's Manual, page 62.
|
|
Documented data on misspelling patterns indicate that majority of misspellings fall under the four categories of letter insertion, deletion, transposition and substitution.Kukich, K. (1992). Techniques for Automatically Correcting Words in Text. ACM Computing Surveys, 24(4), 376-439.
|
|
Qe2, aiming to quickly overrun Black in the centre with the e4-e5 advance. However, 8.a4 Bg7 is the most popular continuation, when White can aim for a transposition to the Classical Main Line with 9.e4.
|
|
Despite the cultural transposition, Shakespeare's text and the names of his characters remain the same. The film closely follows Shakespeare's plot. Some critics praised the setting. Others found it useless and irrelevant, since few of the characters are Japanese.
|
|
Dyslexia primarily involves difficulties with reading, spelling and sentence structure, transposition, memory, organization and time management, and lack of confidence.Woodfine, et. al. (2006). Text- based synchronous e-learning and dyslexia: Not necessarily the perfect match!. Science Direct, 703-717.
|
|
Possession of several messages written using the same grille is a considerable aid. Gaines, in her standard work on hand ciphers and their cryptanalysis, gave a lengthy account of transposition ciphers, and devoted a chapter to the turning grille.
|
|
Specimen provenance complications (SPCs) result from instances of biopsy specimen transposition, extraneous/foreign cell contamination or misidentification of cells used in clinical or anatomical pathology. If left undetected, SPCs can lead to serious diagnostic mistakes and adverse patient outcomes.
|
|
There are also other gene capture mechanism models proposed for Helitrons: Site-specific recombination model which is based on the shared features between Helitrons and Integrons; Transposable element capture which is based on the integration of TEs via transposition into other TEs, also called TE nesting. Despite all these proposed models, there is a lack of examples to limit the mechanism of gene capture to a single model. Further research is needed to understand the molecular mechanism behind gene capture and how it favors the survival of Helitrons. Evidence supporting the "read- through" models seems to lie in the relative lack of importance of the 3' RTS when compared to the 5' LTS: deletion of the LTS leads to a severe reduction in the efficiency of helitron transposition, whereas the complete deletion of the RTS still leads to significant transposition despite a reduced number of copies.
|
|
The digraphs for the message key are encoded with the letter conversion table and then included in the message header. The secret variable start cell and first column ensure a unique transposition for each message, making multiple anagramming very difficult.
|
|
POG octave effect Pitch shifting is a sound recording technique in which the original pitch of a sound is raised or lowered. Effects units that raise or lower pitch by a pre-designated musical interval (transposition) are called pitch shifters.
|
|
The Richter–Veresov Attack (or Veresov Opening) is a chess opening that begins with the moves: :1. d4 d5 :2. Nc3 Nf6 :3. Bg5 It is also often reached by transposition, for example 1.d4 Nf6 2.Nc3 d5 3.
|
|
S. Smith, A. Witkowski, and A K. Joshi, Prog. Lipid Res. 2003, 42, 289-317. This pathway involves condensation of a thiamine-activated acetyl group arising from the decarboxylation of pyruvate and glyceraldehyde-3-phosphate followed by a transposition step.
|
|
The conclusion to this data was that the beginning and the end were more important for word recognition than the middle. From there, the transposition letter effect was used to test how people process and recognize words using many tasks.
|
|
Empress Eugénie possessed one of his œuvres. a literary dwelling ? Marcel Proust visited the castle along with Paul Helleu and may have made a transposition of the castle in À la recherche du temps perdu, which he renamed "château de Guermantes".
|
|
Rarely, the inferior vena cava may vary in its size and position. In transposition of the great arteries the inferior vena cava may lie on the left. It may be replaced by two vessels beneath the level of the renal veins.
|
|
Fi22 is one of the 26 sporadic groups and is the smallest of the three Fischer groups. It was introduced by while investigating 3-transposition groups. The outer automorphism group has order 2, and the Schur multiplier has order 6.
|
|
IBM's Deep Blue transposition table in 1996, for example was 500 million entries. Transposition tables that are too small can result in spending more time searching for non-existent entries due to threshing than the time saved by entries found. Many chess engines use pondering, searching to deeper levels on the opponent's time, similar to human beings, to increase their playing strength. Modern chess programs typically employ a variety of domain-independent extensions and reductions, searching some nodes to arbitrary depth while searching others to reduced depth depending on the configuration and history of moves in the tree.
|
|
The optimal ordering of a list is the one in which items are ordered in the list by the probability with which they will be needed, with the most accessed item first. The optimal ordering may not be known in advance, and may also change over time. McCabe introduced the transposition strategy in which an accessed item is exchanged with the item in front of it in the list. He made the conjecture that in the average case, transposition worked at least as well as MTF in approaching the optimal ordering of records in the limit.
|
|
Although it is generally accepted that Helitrons are RC transposons and through numerous investigations, the role of Helitron transposition in gene duplication and shaping the genetic architecture has been proven, but neither the various mechanisms by which this occurs nor the frequency is well understood. At this point, it is even unclear whether the 3' terminus in a Helitron transposon initiates or terminates the Helitron replicative transposition. An important step towards investigating this mechanism would be the isolation of autonomous Helitrons active in vitro and in vivo. This can be done by computational identification of complete young Helitrons.
|
|
There are various theories that somehow the transposition of this name to nearby St Kilda may have created the name for this latter archipelago, whose origins are otherwise obscure.Quine, David (2000) St Kilda. Grantown-on-Spey. Colin Baxter Island Guides. . Page 21.
|
|
The Senning procedure is an atrial switch heart operation performed to treat transposition of the great arteries. It is named after its inventor, the Swedish cardiac surgeon Åke Senning (1915–2000), also known for implanting the first permanent cardiac pacemaker in 1958.
|
|
The Frankenstein–Dracula Variation is a chess opening for Black, usually considered a variation of the Vienna Game, beginning with the moves: :1. e4 e5 :2. Nc3 Nf6 :3. Bc4 Nxe4 or it can be reached by transposition from the Bishop's Opening: :2.
|
|
Bacterial transposons are especially good at facilitating horizontal gene transfer between microbes. Transposition facilitates the transfer and accumulation of antibiotic resistance genes. In bacteria, transposable elements can easily jump between the chromosomal genome and plasmids. In a 1982 study by Devaud et al.
|
|
Bakhtin's term the carnivalization of literature (which Morson and Emerson point out could also be called "the literization of carnival") refers to the transposition of the essential qualities of the carnival sense of the world into a literary language and a literary genre.
|
|
The Songs2See Editor analysis options include automatic main melody transcription, beat and key analysis, solo and backing track creation, different instrument transposition, efficient and easy editing of results, etc. These analysis options are direct research results from the Music Information Retrieval community.
|
|
He revised every orchestral work up to and including his Third Symphony—some, like Antar and Sadko, more than once.Abraham, Slavonic, 197. These revisions range from minor changes of tempo, phrasing and instrumental detail to wholesale transposition and complete recomposition.Abraham, Slavonic, 197–98.
|
|
Multiple anagramming is a technique used to solve some kinds of cryptograms, such as a permutation cipher, a transposition cipher, and the Jefferson disk.Bletchley Park Cryptographic Dictionary. Codesandciphers.org.uk. Retrieved on 2014-05-12. Solutions may be computationally found using a Jumble algorithm.
|
|
It is one of the few hospitals in China able to perform cardiac surgery on newborns, including transposition of great vessels. In 1998, the hospital helped to establish Shanghai Children's Medical Center with support from Project HOPE (Health Opportunities for People Everywhere).
|
|
Since May 2014 MuseScore has mobile apps available for iOS, Android and Kindle Fire which tie into the MuseScore score sharing site. The app can play scores, and allows changing of transposition and part extraction, but does not allow creating or editing scores.
|
|
The second is a transposition of the first theme, while the third is underlined by a heavily syncopated melody in the relative minor (B-flat minor). With a duple time signature and an Allegro tempo marking, the composition features many shifting moods and virtuosic passages.
|
|
La villa del venerdì (internationally released as Husband and Lovers) is a 1991 Italian erotic-drama film directed by Mauro Bolognini. The film is a transposition of the novel with the same name written by Alberto Moravia. It is the last film directed by Bolognini.
|
|
If is a number representing a pitch class, its transposition by semitones is written T = + mod 12\. Inversion corresponds to reflection around some fixed point in pitch class space. If is a pitch class, the inversion with index number is written I = - mod 12\.
|
|
The Black Knights' Tango (also known as the Mexican Defense, Two Knights' Tango or Kevitz–Trajkovic Defense) is a chess opening beginning with the moves: :1. d4 Nf6 :2. c4 Nc6 This position can also be reached by transposition, for example 1.c4 Nf6, 1.
|
|
Together with Joseph-François Malgaigne, Mirault introduced flap transposition for cleft-lip closure.Mirault G. Deux lettres sur l'operation du bec-delievre. J Chir. 1844;2:257. In 1935, this work was championed by Victor Veau, who stated "Mirault is the genius of cleft lip surgery".
|
|
In scalar transposition, every pitch in a collection is shifted up or down a fixed number of scale steps within some scale. The pitches remain in the same scale before and after the shift. This term covers both chromatic and diatonic transpositions as follows.
|
|
Transposable elements represent one of several types of mobile genetic elements. TEs are assigned to one of two classes according to their mechanism of transposition, which can be described as either copy and paste (Class I TEs) or cut and paste (Class II TEs).
|
|
In jazz theory, a pitch axis is the center around which a melody is inverted.Pease, Ted (2003). Jazz Composition: Theory and Practice, p.152. . The "pitch axis" works in the context of the compound operation transpositional inversion, where transposition is carried out after inversion.
|
|
It was used to break the Japanese two-letter code (J-19) and would find a solution in less than two hours. According to Dr Hüttenhain: ::The machine was once used to work on an English meteorology cipher... used by the Air Force Weather Service The device made the solutions of a single transposition (Transposition cipher) easy. A message being studied must be broken into likely columns, with these matched against each other, with the resulting bigrams (Digraphs) examined for their suitability. It consisted of a two teleprinter reading head, a relay-bank interpreter circuit, a plugboard weight assigner and a recording pen and drum.
|
|
The Rastelli procedure can also be done by rerouting the left ventricular outflow, dividing the pulmonary trunk, and placing a conduit in between the right ventricle and pulmonary trunk. Levo-transposition happens in about 1 in 13,000 newborns and is characterized by the left ventricle pumping blood into the lungs and the right ventricle pumping the blood into the aorta. This may not produce problems at the beginning, but will eventually due to the different pressures each ventricle uses to pump blood. Switching the left ventricle to be the systemic ventricle and the right ventricle to pump blood into the pulmonary artery can repair levo-transposition.
|
|
Bacteriophage Mu, also known as mu phage or mu bacteriophage, is a muvirus (the first of its kind to be identified) of the family Myoviridae which has been shown to cause genetic transposition. It is of particular importance as its discovery in Escherichia coli by Larry Taylor was among the first observations of insertion elements in a genome. This discovery opened up the world to an investigation of transposable elements and their effects on a wide variety of organisms. While Mu was specifically involved in several distinct areas of research (Including E. coli, maize, and HIV), the wider implications of transposition and insertion transformed the entire field of genetics.
|
|
130f) and Rebecca Maloy revisited recently (2009, pp. 77f) the old discussion (Jacobsthal 1897) of "non-diatonic" intervals as "absonia" caused by a transposition (μεταβολή κατὰ τόνον), or as "vitia" caused by a change to another genus (μεταβολή κατὰ γένος). Both pointed at the transposition diagrams used in several manuscripts of these treatises—as example the manuscript of the Abbey Saint-Amand, folio 54. The Scolica enchiriadis documents a certain understanding that passages within more complex soloistic chant might be transposed which must have caused considerable difficulties for the oral tradition of melodies by troping melismatic structures, so that its memory was supported by poetry.
|
|
Existing manuscripts and witnesses of the Historia Augusta fall into three groups: # A manuscript of the first quarter of the ninth century, Vatican Pal. lat. 899 (Codex Palatinus), known as P, and its direct and indirect copies. P was written at Lorsch in Caroline minuscule. The text in this manuscript has several lacunae marked with dots indicating the missing letters, a confusion in the order of the biographies between Verus and Alexander, and the transposition of several passages: two long ones which correspond to a quire of the original which became loose and was then inserted in a wrong place, and a similar transposition in Carus.
|
|
Hybrid dysgenesis refers to the high rate of mutation in germ line cells of Drosophila strains resulting from a cross of males with autonomous P elements (P Strain/P cytotype) and females that lack P elements (M Strain/M cytotype). The hybrid dysgenesis syndrome is marked by temperature-dependent sterility, elevated mutation rates, and increased chromosomal rearrangement and recombination. The hybrid dysgenesis phenotype is affected by the transposition of P elements within the germ-line cells of offspring of P strain males with M strain females. Transposition only occurs in germ-line cells, because a splicing event needed to make transposase mRNA does not occur in somatic cells.
|
|
Tn10 has a composite structure and it is composed of a pair of insertion sequence elements (IS10) flanking five genes. Only one of the IS10 elements encodes a functional transposase. Since the ends of the IS10 element contain the transposase recognition sites, Tn10 has a total of four such sites. If the transposase binds the two recognition sites flanking an IS10 element, the IS10 element undergoes transposition independently of the larger composite structure. If the transposase binds the two outermost recognition sites, the whole composite Tn10 structure undergoes transposition. Two of the five genes encoded by the central portion of Tn10, tetA and tetR, confer resistance to the antibiotic tetracycline.
|
|
For example, a written C on a B clarinet or a trumpet sounds a concert B. The transposition is not a property of the instrument, but rather a convention of musical notation. Instruments whose music is typically notated in this way are called transposing instruments. As transposing instruments is a notation convention, the issue of transposition is mainly an issue for genres of music which use sheet music, such as classical music and jazz (while jazz is an improvisation-based type of music, professional players are still expected to be able to read lead sheets and big band sheet music). For some instruments (e.g.
|
|
It is transcribed by RNA polymerase II to give an mRNA that codes for two proteins: ORF1 and ORF2, which are necessary for transposition. Upon transposition, L1 associates with 3' flanking DNA and carries the non-L1 sequence to a new genomic location. This new location does not have to be in a homologous sequence or in close proximity to the donor DNA sequence. The donor DNA sequence remains unchanged throughout this process because it functions in a copy-paste manner via RNA intermediates; however, only those regions located in the 3' region of the L1 have been proven to be targeted for duplication.
|
|
However, unlike in set theory, the transposition may be a chromatic or diatonic transposition. Thus, if D-A-G (P5 up, M2 down) is inverted to D-G-A (P5 down, M2 up) the "pitch axis" is D. However, if it is inverted to C-F-G the pitch axis is G while if the pitch axis is A, the melody inverts to E-A-B. The notation of octave position may determine how many lines and spaces appear to share the axis. The pitch axis of D-A-G and its inversion A-D-E either appear to be between C/B or the single pitch F.
|
|
The transposase will catalyze the excision of the transposon from the plasmid and subsequent integration into the genome. Integration within a coding region will capture the elements necessary for gene trap expression. PB possesses several ideal properties: (1) it preferentially inserts within genes (50 to 67% of insertions hit genes) (2) it exhibits no local hopping (widespread genomic coverage) (3) it is not sensitive to over-production inhibition in which elevated levels of the transposase cause decreased transposition 4) it excises cleanly from a donor site, leaving no “footprint,” unlike Sleeping Beauty.Mitra, R., J. Fain- Thornton, and N.L. Craig, piggyBac can bypass DNA synthesis during cut and paste transposition.
|
|
The history of the preparation, printing and distribution of cryptographic keys by the German Army was described by Walter Fricke and Erich Hüttenhain. According to Fricke, the keys for the Army were produced at the beginning of the war on In 7/IV's own press. The number of personnel required was small, about 20 people in all, since only enigma, weather and book staple keys () were printed. The number of personnel required for producing keys increased in 1940, when the Heftschlüssel was replaced by the double transposition and in 1942 when the double transposition was replaced by the TS-42a and the NS-42.
|
|
An imbalanced inductance among the three conductors is problematic because it may result in the middle line carrying a disproportionate amount of the total power transmitted. Similarly, an imbalanced load may occur if one line is consistently closest to the ground and operating at a lower impedance. Because of this phenomenon, conductors must be periodically transposed along the length of the transmission line so that each phase sees equal time in each relative position to balance out the mutual inductance seen by all three phases. To accomplish this, line position is swapped at specially designed transposition towers at regular intervals along the length of the transmission line in various transposition schemes.
|
|
In many reactions, the transposon is completely excised from the donor site in what is called a "cut and paste" transposition and inserted into the target DNA to form a simple insertion. Occasionally, genetic material not originally in the transposable element gets copied and moved as well.
|
|
In 1843 Malgaigne, together with Germanicus Mirault designed a flap transposition procedure to close cleft lips.Mirault G. Deux lettres sur l'operation du bec-delievre. J Chir. 1844;2:257. As an advocate of statistical analysis in medicine, he is remembered for conducting statistical hospital surveys in Paris.
|
|
Two musical objects are transpositionally equivalent if one can be transformed into another by transposition. It is similar to enharmonic equivalence, octave equivalence, and inversional equivalence. In many musical contexts, transpositionally equivalent chords are thought to be similar. Transpositional equivalence is a feature of musical set theory.
|
|
The 1998 Agreement currently has 33 Contracting Parties and 14 UN GTRs that have been established into the UN Global Registry. Manufacturers and suppliers cannot use directly the UN GTRs as these are intended to serve the Countries and require transposition in national or regional law.
|
|
Similarly, The Guardian Arts editor felt the piece to be "a surprisingly faithful transposition", which "ingeniously" solves some of the problems inherent in relocating the original, but objected to what he saw was a "dependence on authorial cleverness in finding post-war parallels to their source".
|
|
This theory has become known as the "transposition of sexes theory" in Proust criticism, which in turn has been challenged in Epistemology of the Closet (1990) by Eve Kosofsky Sedgwick and in Proust's Lesbianism (1999) by Elisabeth Ladenson. Feminized forms of masculine names were and are commonplace in French.
|
|
The Springer correspondence in this case is a bijection, and in the standard parametrizations, it is given by transposition of the partitions (so that the trivial representation of the Weyl group corresponds to the regular unipotent class, and the sign representation corresponds to the identity element of G).
|
|
L. Macy (accessed 21 February 2006), grovemusic.com (subscription access). those are more usually regarded as soprano clarinets as well. All have a written range from the E below middle C to about the C three octaves above middle C, with the sounding pitches determined by the particular instrument's transposition.
|
|
Sensorial transposition is a technique used in remote reality to transfer the perception of one sense to another, or where a user receives feedback through a different sense unexpectedly. For example, a thermographic camera allows us to have a visual sensation of the temperature, which is atypical thermoception.
|
|
Cyanotic heart defects are called such because they result in cyanosis, a bluish-grey discoloration of the skin due to a lack of oxygen in the body. Such defects include persistent truncus arteriosus, total anomalous pulmonary venous connection, tetralogy of Fallot, transposition of the great vessels, and tricuspid atresia.
|
|
Orhan Karaveli's family was a member of Karaevli Turkmen tribe .Bir Ankara Ailesinin Öyküsü p.19(Their surname reflects their tribe name with a transposition of two letters) Orhan was born to Mahmut and his wife Rafia in Ankara on 26 February 1930.Bir Ankara Ailesinin Öyküsü,p.
|
|
The movement is in C major and common time. The second movement is a soprano aria with oboe da caccia, a transposition of the bass and violin pairing of BWV 59. The new arrangement lends a "childlike openness" to the movement. It is in F major and common time.
|
|
To find the minimax value, MTD(f) calls AlphaBeta a number of times, converging towards it and eventually finding the exact value. A transposition table stores and retrieves the previously searched portions of the tree in memory to reduce the overhead of re-exploring parts of the search tree.
|
|
William J. Rashkind (February 12, 1922 - July 6, 1986) was an American cardiologist. Rashkind worked at the Children's Hospital of Philadelphia. He is best known for his contributions to the treatment of congenital heart defects. He introduced the Rashkind balloon atrial septostomy to treat transposition of the great vessels.
|
|
She appeared in London, and at the Théâtre-Italien in Paris, singing Romeo, La straniera, La donna del lago, etc. Superbly gifted, she suffered early from serious vocal problems, which necessitated considerable transposition and rewriting of the vocal line. She died prematurely aged only 34, at Lodi, Lombardy.
|
|
The resolvase is part of the tns genome and cuts at flanking inverted repeats. Transposition frequency of IS elements is dependent of multiple parameters, including culture growth phase, medium composition, oxygen tension, growth scale, and structural conformation of target sites (e.g.: curvature, presence of certain motifs, DNA composition).
|
|
Berg's Wozzeck: Harmonic Language and Dramatic Design, p.48. . Alexander Scriabin's mystic chord is a primary example, being a whole tone scale with one note raised a semitone; this alteration allows for a greater variety of resources through transposition."The Evolution of Twelve-Note Music", p.56. Oliver Neighbor.
|
|
Black too can deviate: for example, the idea of playing for ...b7-b5 after 9...Na6 10.Nd2 Nc7 is frequently seen. The Fianchetto Variation is often reached via transposition from other openings. For instance, the position in the diagram can be reached from the King's Indian via 1.
|
|
Current researchers have developed gene transfer systems on the basis of conservative transposition which can integrate new DNA in both invertebrates and vertebrate genomes.. Scientists alter the genetic sequence of a transposon in a laboratory setting, then insert this sequence into a vector which is then inserted into a target cell. The transposase coding region of these transposons is replaced by a gene of interest intended to be integrated into the genome. Conservative transposition is induced by the expression of transposase from another source within the cell, since the transposon no longer contains the transposase coding region to be self sufficient. Generally a second vector is prepared and inserted into the cell for expression of transposase.
|
|
In early 1948, she made the surprising discovery that both Dissociation and Activator could transpose, or change position, on the chromosome. She observed the effects of the transposition of Ac and Ds by the changing patterns of coloration in maize kernels over generations of controlled crosses, and described the relationship between the two loci through intricate microscopic analysis. She concluded that Ac controls the transposition of the Ds from chromosome 9, and that the movement of Ds is accompanied by the breakage of the chromosome. When Ds moves, the aleurone-color gene is released from the suppressing effect of the Ds and transformed into the active form, which initiates the pigment synthesis in cells.
|
|
Once he determined the transposition scheme for one message, he would then be able to crack any other message that was enciphered with the same transposition key. Painvin broke the ADFGX cipher in April 1918, a few weeks after the Germans launched their Spring Offensive. As a direct result, the French army discovered where Erich Ludendorff intended to attack. The French concentrated their forces at that point, which has been claimed to have stopped the Spring Offensive. However, the claim that Painvin's breaking of the ADFGX cipher stopped the German Spring Offensive of 1918, while frequently made,"Painvin's manna had saved the French", wrote David Kahn, in The Codebreakers - The Story of Secret Writing, 1967, , Chapter 9.
|
|
While MNase-seq is primarily used to sequence regions of DNA bound by histones or other chromatin-bound proteins, the other three are commonly used for: mapping Deoxyribonuclease I hypersensitive sites (DHSs), sequencing the DNA unbound by chromatin proteins, or sequencing regions of loosely packaged chromatin through transposition of markers, respectively.
|
|
1600 were apparently the first to build two-manual harpsichords. They built them merely to permit easy transposition: the keyboards sounded the same strings, but one fourth apart.Hubbard 1967, 64-67 Thus, the player could effortlessly transpose at this interval (e.g., to accommodate a singer) by playing on the second manual.
|
|
No user program memory is available. Its effects include white noise generator, portamento, octave transposition, two low frequency oscillators and a random note generator. Even with a single oscillator, it sounds like there are several thanks to the 8 sub-osc keys. The ninth is the (white or pink) noise.
|
|
In this movement he takes advantage of the hexachords to establish a link between the transformations of the tone-row and its inversions. In this way, on one hand he pairs each transposition of the original sequence, with its retrograde and, on the other, with another inversion and its respective retrogradation.
|
|
' According to a review in The Scots Magazine (lxv, 1803, p. 165), the system was taught in several boarding schools near Edinburgh, in addition to Herriot and Watson's Hospital. Another publication about a musical invention, Tonometer (London, c. 1800), describes a mechanical aid for transposition and tuning using movable brass wheels.
|
|
Released: 20 May 2020 Pitch before duration in note input; Enhanced expression maps; Line style editors; Figured bass support; Condensing for divisi and section players; Properties filter; Manual staff visibility changes; Clef and transposition overrides; Use chord diagrams grid; Graphic slices; Making part- scores in Hollywood style; Blank staves support, etc.
|
|
Quinn DW, McGuirk SP, Metha C, et al. The morphologic left ventricle that requires training by means of pulmonary artery banding before the double-switch procedure for congenitally corrected transposition of the great arteries is at risk of late dysfunction. J Thorac Cardiovasc Surg. May 2008;135(5):1137-44, 1144.e1-2.
|
|
However, since member states set their own timelines for transposition, there is a democratic deficit between states. Decisions are binding on non-state litigants to whom they are addressed. Recommendations are intended to guide legal judgments and are non-binding, similar to opinions. In the SLP, the Council is the sole ruling body.
|
|
Females with cancer have fertility preservation options such as oocyte cryopreservation (also called egg cryopreservation or egg freezing), embryo cryopreservation (also called embryo banking or embryo freezing), ovarian shielding (also called gonadal shielding), ovarian tissue cryopreservation (also called ovarian tissue freezing), ovarian transposition (also called oophoropexy), and radical trachelectomy (also called radical cervicectomy).
|
|
The addition of Es starting in measure 364 predicts the coming modulation to C major for the final movement. The third movement, marked Adagio, is in C major and returns to common time. This postlude is the same as the orchestral prelude, save for some changes in instrumentation and transposition into C major.
|
|
Adib Domingos Jatene (June 4, 1929 - November 14, 2014) was a noted Brazilian physician of Lebanese background, university professor, scientist and thoracic surgeon. He is remembered as the inventor of the arterial switch operation (sometimes called the Jatene arterial switch), a surgical technique to correct transposition of the great vessels in the newborn.
|
|
Specific topological changes by NAPs not only regulate gene transcription, but are also involved in other processes such as DNA replication initiation, recombination, and transposition. In contrast to specific gene regulation, how higher-order chromosome structure and its dynamics influences gene expression globally at the molecular level remains to be worked out.
|
|
Additional controls include a toggle for auto-accompaniment, a tap-based tempo setting button, a transposition feature, and a rapid way to access the user's favorite presets. The Multi Pads allow drum sounds or short melodies to embellish user songs. The user can even record their own phrases for the Multi Pads.
|
|
M. Brady Brower. Unruly Spirits: The Science of Psychic Phenomena in Modern France (University of Illinois Press, 2010) p. 63. He also investigated animal magnetism, and various hypnotic phenomena such as the induction of sleep, "transposition of senses", "magnetic rapport", "exteriorisation of sensitiveness", "exteriorisation of motor nerve force" etc.Boirac, "La psychologie inconnue", 1917.
|
|
If the separation is incomplete, the result is a "persistent truncus arteriosis". The vessels may be reversed ("transposition of the great vessels"). The two halves of the split tract must migrate into the correct positions over the appropriate ventricles. A failure may result in some blood flowing into the wrong vessel (e.g.
|
|
This code was devised by Louis Uedemann (1854–1912). The method was never actually used, mainly because a transposition of letters can result in a valid but incorrect move. Many sources incorrectly use this name for the Gringmuth code. The files are labeled "A", "E", "I", "O", "O", "I", "E", and "A".
|
|
Stevens, C. L.; Hanson, H. T.; Taylor, K. G. J. Am. Chem. Soc. 1966, 88, 2769. As a result, subtle conformational and steric factors can play a role in the speed and extent of these reactions. Allylic transposition has been observed in migrations of allyl groups, but propargyl groups undergo simple alkyl migration.
|
|
In contrast to retrotransposons, retroposons never encode reverse transcriptase (RT) (but see below). Therefore, they are non-autonomous elements with regard to transposition activity (as opposed to transposons). Non-long terminal repeat (LTR) retrotransposons such as the human LINE1 elements are sometimes falsely referred to as retroposons. However, this depends on the author.
|
|
She also demonstrates how Burke embodies the worst of his own ideas. He becomes the hysterical, illogical, feminine writer, and Wollstonecraft becomes the rational, masculine writer. Ironically, in order to effect this transposition, Wollstonecraft herself becomes passionate at times, for example, in her description of slavery (quoted above).Todd, 163; Taylor, 67.
|
|
Then we apply the transposition operation T_n by adding n . For example, to calculate T_5I(3) , first subtract 3 from 12 (giving 9) and then add 5 (giving 14, which is equivalent to 2). Thus, T_5I(3)=2 . To invert a set of pitches, simply invert each pitch in the set in turn.
|
|
Transcription and transposition errors may also occur in syntax when computer programming or programming, within variable declarations or coding parameters. This should be checked by proofreading; some syntax errors may also be picked up by the program the author is using to write the code. Common desktop publishing and word processing applications use spell checkers and grammar checkers, which may pick up on some transcription/transposition errors; however, these tools cannot catch all errors, as some errors form new words which are grammatically correct. For instance, if the user wished to write "The fog was dense", but instead put "The dog was dense", a grammar and spell checker would not notify the user because both phrases are grammatically correct, as is the spelling of the word "dog".
|
|
As long as they have localized this transposition, singers will always find their way back to the untransposed column. By this example the use of Gabriel's kanonion as illustration of the Byzantine tonal system, as it can be found in same Papadikai, becomes evident. A protopsaltes or maistoros who was well skilled in the psaltic art, could use these memorial landscapes in order to find their way through the labyrinth of tonal relation- and kinships. Even in improvised teretismata or nenanismata, inserted sections using abstract syllables, complex structures were possible, a soloist could pass through several transpositions and was still able to find their way out—which meant back to the transposition of the first column and the echos of the main signature.
|
|
Any permutation can be expressed as the composition (product) of transpositions—formally, they are generators for the group. In fact, when the set being permuted is for some integer , then any permutation can be expressed as a product of ' (1~2), (2~3), (3~4), and so on. This follows because an arbitrary transposition can be expressed as the product of adjacent transpositions. Concretely, one can express the transposition (k~~l) where k < l by moving to one step at a time, then moving back to where was, which interchanges these two and makes no other changes: :(k~~l) = (k~~k+1)\cdot(k+1~~k+2)\cdots(l-1~~l)\cdot(l-2~~l-1)\cdots(k~~k+1).
|
|
The property of spin relates to another basic property concerning systems of identical particles: Pauli's exclusion principle, which is a consequence of the following permutation behaviour of an -particle wave function; again in the position representation one must postulate that for the transposition of any two of the particles one always should have i.e., on transposition of the arguments of any two particles the wavefunction should reproduce, apart from a prefactor which is for bosons, but () for fermions. Electrons are fermions with ; quanta of light are bosons with . In nonrelativistic quantum mechanics all particles are either bosons or fermions; in relativistic quantum theories also "supersymmetric" theories exist, where a particle is a linear combination of a bosonic and a fermionic part.
|
|
Thus, transposition table entries for nodes at a shallower depth in the game tree are more valuable (since the size of the subtree rooted at such a node is larger) and are therefore given more importance when the table fills up and some entries must be discarded. The hash table implementing the transposition table can have other uses than finding transpositions. In alpha–beta pruning, the search is fastest (in fact, optimal) when the child of a node corresponding to the best move is always considered first. Of course, there is no way of knowing the best move beforehand, but when iterative deepening is used, the move that was found to be the best in a shallower search is a good approximation.
|
|
In general, the ISBN-13 check digit is calculated as follows. Let Then This check system – similar to the UPC check digit formula – does not catch all errors of adjacent digit transposition. Specifically, if the difference between two adjacent digits is 5, the check digit will not catch their transposition. For instance, the above example allows this situation with the 6 followed by a 1. The correct order contributes 3×6+1×1 = 19 to the sum; while, if the digits are transposed (1 followed by a 6), the contribution of those two digits will be 3×1+1×6 = 9. However, 19 and 9 are congruent modulo 10, and so produce the same, final result: both ISBNs will have a check digit of 7.
|
|
The monster group is generated by a triad of elements of orders , , and . All such triads are conjugate. The prototype for rigidity is the symmetric group , which is generated by an -cycle and a transposition whose product is an -cycle. The construction in the preceding section used these generators to establish a polynomial's Galois group.
|
|
The earliest known examples of text referring to music in China are inscriptions on musical instruments found in the Tomb of Marquis Yi of Zeng (d. 433 B.C.). Sets of 41 chimestones and 65 bells bore lengthy inscriptions concerning pitches, scales, and transposition. The bells still sound the pitches that their inscriptions refer to.
|
|
Bubù (also known as Bubu) is a 1971 Italian historical drama film directed by Mauro Bolognini. The film is a transposition, set in Milan and Turin, of the novel Bubu de Montparnasse by Charles-Louis Philippe. It's also known for the name of a small creature, to whom a comics serie has been dedicated.
|
|
Gradually the SOE replaced the poem code with more secure methods. Worked-out Keys (WOKs) was the first major improvement – an invention of Marks. WOKs are pre-arranged transposition keys given to the agents and which made the poem unnecessary. Each message would be encrypted on one key, which was written on special silk.
|
|
Retrotransposons are classified based on sequence and method of transposition. Most retrotransposons in the maize genome are LTR, whereas in humans they are mostly non-LTR. Retrotransposons (mostly of the LTR type) can be passed onto the next generation of a host species through the germline. The other type of transposon is the DNA transposon.
|
|
The longest span of any hydroelectric crossing ever built belongs to the powerline crossing of Ameralik fjord with a length of . In addition to steel, other materials may be used, including concrete and wood. There are four major categories of transmission towers: suspension, terminal, tension, and transposition. Some transmission towers combine these basic functions.
|
|
Apple published a Swift Playgrounds curriculum recommending the iPad app for middle school students and up. A stand-alone version of Swift Playgrounds for macOS was released on February 11, 2020 on the Mac App Store. This version is fully detached from Xcode and it is a transposition of the iPad version for macOS.
|
|
In women requiring local pelvic radiation therapy may benefit from surgical transposition of the ovaries to a site remote from maximal radiation exposure.American Society for Reproductive Medicine: The use of GnRH agonists for ovarian protection during chemotherapy is suggested to benefit the ability to ovulate, but benefits in terms of e.g. pregnancy rate are lacking.
|
|
This pseudoknot stimulates programmed -1 ribosomal frameshifting (PRF-1) which in turn stimulates the express of transposase, an enzyme required for transposition. Mutagenesis and chemical probing were used to determine the secondary structure of this pseudoknot and it has been proposed that this pseudoknot is formed by interactions between an apical loop and internal loop.
|
|
The Blasius solution is not unique from a mathematical perspective, as Ludwig Prandtl himself noted it in his transposition theorem and analyzed by series of researchers such as Keith Stewartson, Paul A. Libby.Libby, Paul A., and Herbert Fox. "Some perturbation solutions in laminar boundary-layer theory." Journal of Fluid Mechanics 17.3 (1963): 433-449.
|
|
The bishop was on a hunger strike for the second time, the first in Cabrobó, Pernambuco, in protest against the transposition of the São Francisco River. Sabatella is part of the non- governmental organization Human Rights Movement. Her experience with the Indians led her to start a career as a filmmaker. In 2008, she launched the documentary Hotxuá.
|
|
Sakate was born in Okayama, Japan in 1962. He studied Japanese literature at Keiō University in Tokyo. During his time at Keiō University, he was inspired and learned from Tetsu Yamazaki, a second wave playwright, to utilize theater as a method to confront contemporary issues in society. He later joined Yamazaki’s theater company called Transposition 21.
|
|
The actual mechanism of septation of the outflow tract is poorly understood, but is recognized as a dynamic process with contributions from contractile, hemodynamic, and extracellular matrix interactions. Misalignment of the septum can cause the congenital heart conditions tetralogy of Fallot, persistent truncus arteriosus, dextro- Transposition of the great arteries, tricuspid atresia, and anomalous pulmonary venous connection.
|
|
Under the mutational hypothesis, hybrizymes likely arise due to simple point mutations. Sequencing data have indicated this and imply low likelihood that hybrizymes arise as a result of transposition or recombination. Research on pocket gophers and Japanese freshwater crabs confirms that the phenomenon is possibly caused by simple nucleotide substitutions. However, the hypothesis has several weaknesses.
|
|
He was named The Sporting News Player of the Year for the second time in his career. For his work off the field, he was named the 2008 winner of the Roberto Clemente Award. He considered having Tommy John surgery after the season but underwent nerve transposition surgery on his right elbow instead to ease discomfort.
|
|
NSW maps did not make this mistake. The Victorian error created confusion. In 1885, Austrian explorer Robert von Lendenfeld, guided by James M. Spencer," Jas. M. Spencer The Highest Point in Australia The Sydney Morning Herald, February 18, 1885", a local pastoralist, aided by a map containing the transposition error, reached Mount Townsend believing it was Mount Kosciusko.
|
|
Catheterization can also be used to perform balloon septostomy, which is the widening of a foramen ovale, patent foramen ovale (PFO), or atrial septal defect (ASD) using a balloon catheter. This can be done in certain congenital heart diseases in which the mechanical shunting is required to sustain life such as in transposition of the great vessels.
|
|
The term "Angry theatre" was coined by critic John Russell Taylor.John Russell Taylor. Anger and After, 1962, London: Methuen. This was all part of the British New Wave—a transposition of the concurrent nouvelle vague film movement in France, some of whose works, such as The 400 Blows of 1959, also emphasised the lives of the urban proletariat.
|
|
This region is also not conserved between Ty1 and Ty5, whereas the rest of the integrase is, suggesting that this divergence could be responsible for the different targeting of the yeast Ty elements. A mutation was identified in the integrase C-terminus that randomized Ty5 integration, suggesting that this region of integrase was in fact involved in targeted transposition.
|
|
From this, it was a natural transposition to build ski lifts and chairlifts. The first cable car in North America was at Cannon Mountain in Franconia, New Hampshire in 1938. After the Second World War installations proliferated in Europe, America, Japan, Canada and South Africa. Many hundreds of installations have emerged in mountainous and seascape areas.
|
|
Transposition driven scheduling (TDS) is a load balancing algorithm for parallel computing. It was developed at the Vrije Universiteit in Amsterdam, The Netherlands as an algorithm to solve puzzles. The algorithm provides near- linear speedup with some problems and scales extremely well. It was published about by John Romein, Aske Plaat, Henri Bal and Jonathan Schaeffer.
|
|
The CSM and LM separated from the spent third stage 50 minutes later. This process is known as Transposition, docking, and extraction. If it were to remain on the same trajectory as the spacecraft, the S-IVB could have presented a collision hazard, so its remaining propellants were vented and the auxiliary propulsion system fired to move it away.
|
|
From here the metrophonia might descend two steps clockwise to the plagios devteros (πλ β'). According to the trochos system Chrysanthos' adaptation to the Ottoman tambur frets was already a transposition. Nearly every melos is related to the heptaphonia by the reproduction of the plagios in the octave of the eighth phthongos. This practice separated the four octaves.
|
|
It also employed usual algorithms as found in computer chess systems: alpha-beta pruning with move ordering, transposition tables, etc.Available: Universal Game Engine email to comp.ai.games by Jeff Mallett, 10-Dec-1998. The package was extended in 2007 by the addition of the Axiom plug-in, an alternate metagame engine that incorporates a complete Forth-based programming language.
|
|
The film was entered into the 1962 Cannes Film Festival where it won the award of Best Cinematic Transposition. The film was also nominated for the Academy Award for Best Foreign Language Film. The film also won three awards in Thessaloniki Film Festival, for best film and best director (Michalis Cacoyannis) and best actress (Irene Papas).
|
|
It implements standard multigenic chromosomes and the genetic operators mutation, crossover, and transposition. PyGEP is hosted at Google Code. ; jGEP – Java GEP toolkit: Created by Matthew Sottile to rapidly build Java prototype codes that use GEP, which can then be written in a language such as C or Fortran for real speed. jGEP is hosted at SourceForge.
|
|
The six-octave model employing octave transposition was developed by Harald Bode, and under licensed by Jörgensen Electronic in Germany. In England, the Jennings Organ Company's first successful product was the Univox, an early self-powered electronic keyboard inspired by the Selmer Clavioline. In Japan, Ace Tone's first prototype, the Canary S-2 (1962), was based on the Clavioline.
|
|
The reconstruction also had a symbolic message that the evil walnut tree of Nero was supplanted by the beneficent oak of the Della Rovere. The papal coats of arms were placed on the façade and the vaults as "symbols of eternal happiness and protection from lightning", as Landucci explained praising the transposition of the two trees.Landucci, pp.
|
|
535 and 539. It was also used by agents of the American Office of Strategic ServicesKahn, p. 539. and as an emergency cipher for the German Army and Navy. Until the invention of the VIC cipher, double transposition was generally regarded as the most complicated cipher that an agent could operate reliably under difficult field conditions.
|
|
Transposition is particularly effective when employed with fractionation – that is, a preliminary stage that divides each plaintext symbol into several ciphertext symbols. For example, the plaintext alphabet could be written out in a grid, and every letter in the message replaced by its co-ordinates (see Polybius square and Straddling checkerboard). Daniel Rodriguez-Clark. "Transposing Fractionated Ciphertext".
|
|
This involved taking the attack segment of each sound and repeating it to produce a relatively constant sound . The result was then transposed using a transposition machine called a phonogène . The entire process was accomplished in twelve days, concluded on 15 December 1952 . It was the first piece by a non-French composer made in the Paris studio .
|
|
Ileal Transposition / Interposition should only be performed by surgeons with a dedicated team who received appropriate training and performed at least 100 operations under supervision. It should not be forgotten that even though this operation can provide miraculous results, it can lead to disastrous outcomes when performed by people who do not have the necessary qualifications.
|
|
Chinese Guqin notation, 1425 The earliest known examples of text referring to music in China are inscriptions on musical instruments found in the Tomb of Marquis Yi of Zeng (d. 433 B.C.). Sets of 41 chimestones and 65 bells bore lengthy inscriptions concerning pitches, scales, and transposition. The bells still sound the pitches that their inscriptions refer to.
|
|
A flow diagram of the VIC CipherThe VIC cipher was a pencil and paper cipher used by the Soviet spy Reino Häyhänen, codenamed "VICTOR". If the cipher were to be given a modern technical name, it would be known as a "straddling bipartite monoalphabetic substitution superenciphered by modified double transposition." David Kahn. "Number One From Moscow". 1993\.
|
|
If the above statement holds only for positive definite distributions then the pair satisfies GP3 (see the next case). The property GP1 often follows from GP2. For example, this holds if there exists an involutive anti-automorphism of G that preserves K and preserves every closed conjugacy class. For G = GL(n) the transposition can serve as such involution.
|
|
The total number of cache misses is \Theta(mn). Principle of cache-oblivious algorithm for matrix transposition using a divide and conquer-approach. The graphic shows the recursive step (a → b) of dividing the matrix and transposing each part individually. The cache-oblivious algorithm has optimal work complexity O(mn) and optimal cache complexity O(1+mn/B).
|
|
The Verhoeff algorithm is a checksum formula for error detection developed by the Dutch mathematician Jacobus Verhoeff and was first published in 1969. It was the first decimal check digit algorithm which detects all single-digit errors, and all transposition errors involving two adjacent digits, which was at the time thought impossible with such a code.
|
|
Alegant (2001), p.3n6. "Kurth 1992 and Mead 1988 use mosaic and mosaic class in the way that I use partition and mosaic," are used here. However later, he says that, "the DS determines the number of distinct partitions in a mosaic, which is the set of partitions related by transposition and inversion."Alegant (2001), p.5.
|
|
These three moves could also be transposed to 1. P-26 P-34 2. P-76. After this, White does the same rook pawn push (2...P-84) leading to a symmetrical Double Static Rook board. Another possible (but less common) transposition of the four moves could be 1. P-26 P-84 2. P-76 P-34.
|
|
Rashkind was born in Paterson, New Jersey, and he attended the University of Louisville School of Medicine. He was a physician at the Children's Hospital of Philadelphia. He is best known for the balloon septostomy procedure. In this technique, a cardiologist feeds a catheter into the heart of a patient with transposition of the great vessels.
|
|
Coques is mainly known for his portraits, and in particular, his group portraits. His work shows the influence of the great Antwerp masters such as Rubens. However, the most important influence on his work was van Dyck. Some of Coques' works can in fact be regarded as the transposition of van Dyck compositions to smaller scale cabinet pieces.
|
|
The system for 13-digit ISBNs is not compatible with SBNs and will, in general, give a different check digit from the corresponding 10-digit ISBN, so does not provide the same protection against transposition. This is because the 13-digit code was required to be compatible with the EAN format, and hence could not contain an 'X'.
|
|
The five words are written sequentially, and their letters numbered to create a transposition key to encrypt a message. Numbering proceeds by first numbering the A's in the five words starting with 1, then continuing with the B's, then the C's, and so on; any absent letters are simply skipped. In our example of THE WABE TOVES TWAS MOME, the two A's are numbered 1, 2; the B is numbered 3; there are no C's or D's; the four E's are numbered 4, 5, 6, 7; there are no G's; the H is numbered 8; and so on through the alphabet. This results in a transposition key of 15 8 4, 19 1 3 5, 16 11 18 6 13, 17 20 2 14, 9 12 10 7.
|
|
Transposing the accent to the first syllable distinguishes Χρἰστος (Christos), the common name, from Χριστός, Jesus Christ. Similarly the given name Stavros (Σταύρος, Stávros) has the stress on the first syllable, differentiating it from σταυρός (stavrós), the Christian cross. Constantine P. Cavafy gave two reasons for the transposition of the accent in the name "Christos": firstly, the rule of transposition of the accent from the final syllable to the immediately preceding syllable in ancient adjectives when they become proper nouns, "and secondly, the pious practice of differentiating in appearance from the divine epithet". Cavafy gave other anthropological examples of the need felt to distinguish between the "sacred" and the "profane", and university professor Giorgos Veloudis added tο Cavafy's examples the distinction between the "profane" word Σταύρος (the name "Stavros") and the "sacred" word σταυρός ("cross").
|
|
Due to the varying complications, different modifications of PAB have been developed to improve outcomes. Adjustable pulmonary artery banding has been available since 1972,Trusler, G. A., and W. T. Mustard. "A Method of Banding the Pulmonary Artery for Large Isolated Ventricular Septal Defect with and without Transposition of the Great Arteries." The Annals of Thoracic Surgery 13.4 (1972): 351-5.
|
|
In the OLP, there are four types of rulings: Regulations, Directives, Decisions, and Recommendations. Decision- making is shared by the European Parliament and the Council, which are equally weighted. Regulations are binding on all member states effective immediately. Directives are binding on all member states, but the implementation is left up to the national courts in a process called transposition.
|
|
LIANTI transposome. LIANTI transposome is made by mixing equal molar of Tn5 transposase and LIANTI transposon DNA. The sequence of LIANTI transposon DNA is: 5'/Phos/CTGTCTCTTATACACATCTGAACAGAATTTAATACGACTCACTATAGGGAGATGTGTATAAGAGACAG-3' After self annealing, the LIANTI transposon DNA consists of a 19-bp double- stranded region for Tn5 transposase binding and dimerization, and a 30-nt single-stranded loop containing T7 promoter sequence. 3\. Tn5 transposition.
|
|
Ribó believes that this transposition of feminine ideal corresponds to the neo-platonic tradition that became exceedingly popular in the later stages of Roman antiquity. These philosophical trends undoubtedly allowed for the gradual Christianization of the empire. Ribó would elaborate that medieval Christianity greatly shaped European perceptions and taste placing parameters on those of even the most avid of Humanists during the Renaissance.
|
|
Latinist Maria Wyke called Carotta's views "eccentric" and described the connections between Caesar and Jesus listed by him as "sweeping and often superficial parallels, however detailed and justified at book length". Spanish philologist Antonio Piñero called Carotta's reading of the Gospel as a diegetic transposition an "ingenious exercise" but also noted several methodological shortcomings which made the theory "completely implausible"..
|
|
Structures with mutually attacking pawns are said to have tension. They are ordinarily unstable and tend to transpose into a stable formation with a pawn or exchange. Play often revolves around making the transposition happen under favorable circumstances. For instance, in the Queen's Gambit Declined, Black waits until White the to make the d5xc4 capture, transposing to the Slav formation (see below).
|
|
In 1939, during his appointment at the Children's Hospital, Farber worked with colleague Jerome S. Harris to publish a classic description of the transposition of the great blood vessels in the heart. This work played a major role in the development and advancement of pediatric cardiac surgery. In 1952, Farber described a lipid storage disease that was subsequently named Farber disease.
|
|
To solve this drawback, an approach has been taken that integrates solving the problem and load balancing. To begin, a function is defined that assigns a unique value to every board position. Every computer in the network is assigned a range of board positions for which it holds authority. Every computer has its own transposition table and a job queue.
|
|
This collection is related to the E octatonic collection from mm. 1–11 by the following transposition operations: T2, T5, T8, T11. Other relevant features of the piece include the groups of three notes taken from the whole-half diminished scale in mm. 12–18. In these measures, the right hand features D, E, and G, the tetrachord without the 3rd (F).
|
|
Negrini was a baritonal tenor. The tessitura for the role of Gabriele Adorno he created was so middle voiced, that Verdi later authorised transpositions up for the tenor Emilio Pancani in 1869Harold Powers One Halfstep at a Time: Tonal Transposition and 'Split Association' in Italian Opera, Cambridge Opera Journal, Vol. 7, No. 2 (July 1995), pp. 135–164 and Francesco Tamagno in 1881.
|
|
I. Allegro moderato E-flat major II. Andante molto G minor III. Menuetto: Allegretto - Trio E-flat major IV. Allegro moderato E-flat major This sonata is a transposition and elaboration of the Piano Sonata in D-flat, D. 567.Gibbs p. 156 Daniel Coren summarized the nature of the recapitulation in the first movement of this sonata as "syncopated primary material".
|
|
Even if it was no longer perceived by the audience, it becomes evident during the study of the manuscripts that the protopsaltes got lost in the labyrinth without finding their back to the exit of the same transposition. Even skilled experts got easily lost in the very sophisticated psaltic art as it had been taught by the Papadike over the centuries.
|
|
Multiple loci contribute to these different forms, and a butterfly with alleles for form A at one locus and B at another locus would have poor fitness. However, the multiple loci are tightly linked, so they are inherited together as a single allele. Through transposition, these multiple loci ended up close to each other.Clarke, C. A., and P. M. Sheppard.
|
|
The clinical manifestations of a Taussig-Bing anomaly, therefore, are much like those of dextro-Transposition of the great arteries (but the surgical repair is different). It can be corrected surgically also with the arterial switch operation (ASO). It is managed with Rastelli procedure. It is named after Helen B. Taussig and Richard Bing, who first described it in 1949.
|
|
The difference of these terms is the harmonic series representation of the interval in question (using harmonic numbers), whose bottom note 12n is a transposition of the tonic by n octaves. This suggests why descending interval ratios with denominator a power of two are final. A similar situation is seen if the term in the numerator is a power of two.
|
|
Cryptographie indéchiffrable (subtitle: basée sur de nouvelles combinaisons rationelles) is a French book on cryptography written by Émile Victor Théodore Myszkowski (a retired French colonel) and published in 1902. His book described a cipher that the author had invented and claimed (incorrectly) was "undecipherable" (i.e. secure against unauthorised attempts to read it). It was based on a form of repeated-key transposition.
|
|
Mac Hack played by teletype, was ported to the PDP-10 and was the first computer chess program to be widely distributed. Mac Hack was the first chess computer to use a transposition table, which is a vital optimization in game tree search. Greenblatt and Tom Knight went on to advance artificial intelligence and build the Lisp machine in 1973.
|
|
The coda that follows at measure 125 can be subdivided in two parts. The first is a triumphant fortissimo statement of the descending motive of the second theme over the first theme. The second part is an exact transposition of the codetta of the exposition (which also features the same thematic superposition), which leads the whole movement to a calm end.
|
|
A speaker of Silbo Gomero is sometimes referred to in Spanish as a silbador ('whistler'). Silbo Gomero is a transposition of Spanish from speech to whistling. This oral phoneme-whistled phoneme substitution emulates Spanish phonology through a reduced set of whistled phonemes. It was declared as a Masterpiece of the Oral and Intangible Heritage of Humanity by UNESCO in 2009.
|
|
The report concluded that no more than ″a majority of Member States have completed the transposition of Articles 13 and 18 of REMIT into national law in order to ensure that NRAs have the foreseen investigatory and enforcement powers, and that a sanctioning regime is in place.″CEER memo on REMIT implementation at national level, Ref. C14-MIT-55-03, 18 September 2014.
|
|
This transposition applies even when bass players are reading the tenor and treble clef (which are used in solo playing and some orchestral parts). The tenor clef is also used by composers for cello and low brass parts. The use of tenor or treble clef avoids excessive ledger lines above the staff when notating the instrument's upper range. Other notation traditions exist.
|
|
A variety of editing tools are made available, including a notation display that can be used to create printed parts for musicians. Tools such as looping, quantization, randomization, and transposition simplify the arranging process. Beat creation is simplified, and groove templates can be used to duplicate another track's rhythmic feel. Realistic expression can be added through the manipulation of real-time controllers.
|
|
CSP genes evolved via duplication, intron loss and gain, and retrotransposition events [4, 14, 32, 40-41, 45]. A single unified hypothesis of RNA editing and retrotransposition-driven evolution of CSPs, i.e. initial production of new CSP protein motifs via DNA and RNA -dependent RNA polymerization before retro- transposition of edited CSP-RNA variants, has been proposed in moths [11].
|
|
Only one woman, Barbara McClintock, has received an unshared prize in this category, for the discovery of genetic transposition. Mario Capecchi, Martin Evans, and Oliver Smithies was awarded the prize in 2007 for the discovery of a gene targeting procedure (a type of genetic recombination) for introducing homologous recombination in mice, employing embryonic stem cells through the development of the knockout mouse.
|
|
Some of the techniques include implantation of deep brain stimulators, spinal cord stimulators, peripheral stimulators and pain pumps. Surgery of the peripheral nervous system is also possible, and includes the very common procedures of carpal tunnel decompression and peripheral nerve transposition. Numerous other types of nerve entrapment conditions and other problems with the peripheral nervous system are treated as well.
|
|
For most of the project, Rudolph worked out of his office in New York City and sent them to Sarasota for review. In 1948, Rudolph traveled to Europe as part of a Harvard architecture fellowship. He was struck by the scale and construction of European urban design. He became particularly interested in the transposition of structures and integration of inner and outer space.
|
|
Since the transmissions always use complete groups, "nulls" may have been used to pad out the text. Cryptosystems employed include transposition, dinome, and rotor-based ciphers and a one-part code. While these can be successfully tackled without use of a computer, solution is not easy. The practical exercise reinforces many basic principles, including ways to exploit having a collection of message traffic.
|
|
In 2012, he pitched for Bradenton, Altoona and the Indianapolis Indians. In November 2012, Irwin was added to the 40-man roster to protect him from the Rule 5 draft. Irwin made his major league debut on April 14, 2013. Irwin had ulnar nerve transposition surgery on his right-elbow on July 3, 2013, shortly after returning to the AAA Indians.
|
|
Also known as "transduction" or "read-through" model 1 (RTM1). Transposition initiates at the 5′ end and gene capture occurs if the 3′ termination signal is missed. A cryptic downstream palindrome could furnish a new terminator if the normal terminator was bypassed and all intervening sequence would be captured. In this regard, Helitrons can be viewed as an exon shuffling machines.
|
|
Chisum earned her BS (1951) and MS (1953), in psychology from Howard University. During her undergraduate years she pledged Alpha Kappa Alpha and was a part of the Howard University Players, a dramatic group run by students. In 1960, she earned her PhD from the University of Pennsylvania. Her dissertation was titled "Transposition as a Function of the Number of Test Trials".
|
|
Davi Det Hompson (1939–1996), also known as David E. Thompson, born in Sharon, Pennsylvania, and raised in Warren, Ohio, was a Fluxus book artist, concrete poet, creator of mail art, sculptor and painter living and working in Richmond, Virginia. Hompson's chosen professional name was a nom d'art for David E. Thompson and a transposition of the letters of his name.
|
|
If keys are being hashed repeatedly, and the hash function is costly, computing time can be saved by precomputing the hash codes and storing them with the keys. Matching hash codes almost certainly mean the keys are identical. This technique is used for the transposition table in game-playing programs, which stores a 64-bit hashed representation of the board position.
|
|
See , page 228. Those who support Al-Khwarizmi point to the fact that he introduced the methods of "reduction" and "balancing" (the transposition of subtracted terms to the other side of an equation, that is, the cancellation of like terms on opposite sides of the equation) which the term al-jabr originally referred to,See , The Arabic Hegemony, p. 229: "It is not certain just what the terms al-jabr and muqabalah mean, but the usual interpretation is similar to that implied in the translation above. The word al-jabr presumably meant something like "restoration" or "completion" and seems to refer to the transposition of subtracted terms to the other side of an equation; the word muqabalah is said to refer to "reduction" or "balancing" – that is, the cancellation of like terms on opposite sides of the equation".
|
|
As Ac copy number increases, the expression of genes flanking the Ds promoter insertion are negatively regulated, which is called the negative dosage effect. Ds flanking gene expression is inhibited in the presence of the autonomous Ac element. As the Ac element copy number increases, transposition events that require Ac occur at a later time during endosperm development. Ac causes no or few chromosome breaks.
|
|
Jazz Discography on-line "Lazy Bird" is in part a transposition into the key of "G" of a Tadd Dameron composition of the same title. Coltrane's playing exhibits the move toward what would become his signature style. His solos are more harmonic or "vertical" and lines arpeggiated. His timing was often apart from or over the beat, rather than playing on or behind it.
|
|
The first type is "intrinsic", where the metaphor is constructed by altering musical material into new musical material, as discussed in Lecture 2. This includes "Chomskian transformations", such as augmentation, transposition, diminution, inversion, etc. The second metaphor is "extrinsic" which includes "nonmusical meaning" (p. 133). This metaphor involves the association of a musical passage with extra-musical ideas, such as animals, emotions, or landscapes.
|
|
J. Quantum Electron., , 16 (1), 113-114. too. From the viewpoint of nonlinear electrodynamics, the existence of gradient of the electric field of optical wave in the range of the unit cell corresponds to macroscopic gradient of the external electrical field, if only the frequency transposition is taken into account. In that sense, the electrogyration effect represents the first of the gradient nonlinear optical phenomena ever revealed.
|
|
Menso Folkerts and A. J. E. M. Smeur, "A Treatise on the Squaring of the Circle by Franco of Liège, of about 1050", Archives d'histoire des sciences, 26 (1976), pp. 59-105, 225-253. The musical treatise Quaestiones in musica, primarily ascribed to Rudolf of St Trond, has also been attributed to him.Dolores Pesce, The Affinities and Medieval Transposition (Indiana University Press, 1987), pp. 39-40.
|
|
Long interspersed elements (LINEs) encode genes for reverse transcriptase and endonuclease, making them autonomous transposable elements. The human genome has around 500,000 LINEs, taking around 17% of the genome. Short interspersed elements (SINEs) are usually less than 500 base pairs and are non-autonomous, so they rely on the proteins encoded by LINEs for transposition. The Alu element is the most common SINE found in primates.
|
|
The Blalock–Hanlon procedure is a surgical procedure involving the heart. It involves the intentional creation of a septal defect in order to alter the flow of oxygenated blood. It was devised as a palliative correction for transposition of the great vessels. It was developed by Vivien Thomas at the Hunterian Laboratory ("the dog house") of Johns Hopkins and described by Alfred Blalock and C. Rollins Hanlon.
|
|
In linear algebra, a symmetric matrix is a square matrix that is equal to its transpose (i.e., it is invariant under matrix transposition). Formally, matrix A is symmetric if :A = A^{T}. By the definition of matrix equality, which requires that the entries in all corresponding positions be equal, equal matrices must have the same dimensions (as matrices of different sizes or shapes cannot be equal).
|
|
Transgenesis is a popular approach to study the function of genes in zebrafish. Construction of transgenic zebrafish is rather easy by a method using the Tol2 transposon system. Tol2 element which encodes a gene for a fully functional transposase capable of catalyzing transposition in the zebrafish germ lineage. Tol2 is the only natural DNA transposable element in vertebrates from which an autonomous member has been identified.
|
|
Conversely, there are scholarly arguments that death in Greek tragedy was portrayed off stage primarily because of dramatic considerations, and not prudishness or sensitivity of the audience. A temple nearby, especially on the right side of the scene, is almost always part of the Greek theatre complex. This could justify, as a transposition, the recurrence of the pediment with the later solidified stone scene.
|
|
Libbey, Ted (1999). The NPR Guide to Building a Classical CD Collection: The 350 Essential Works, p.185. . Eric Walter White suggests and dismisses the possibility that the Petrushka chord is derived from Messiaen's "second Modes of limited transposition" (the octatonic scale) in favor of a "black key/white key bitonality" which results from, "Stravinsky's well known habit of composing at the piano."Eric Walter White (1966).
|
|
Self-synthesizing transposition mechanism for Polintons. Polintons are also a group of eukaryotic class II TEs. As one of the most complex known DNA transposons in eurkaryotes, they make up the genomes of protists, fungi, and animals, such as the entamoeba, soybean rust, and chicken, respectively. They contain genes with homology to viral proteins and which are often found in eukaryotic genomes, like polymerase and retroviral integrase.
|
|
On attaching to a host cell, the virus uses its contractile sheath like a syringe, piercing the cell wall with its central tube and injecting the genetic material into the host. The injected DNA takes over the host cell's mechanisms for transcription and translation and begins to manufacture new viruses. Replication follows the replicative transposition model. DNA-templated transcription is the method of transcription.
|
|
So, in gene expression programming transposition can be implemented using two different methods: the first creates a shift at the insertion site, followed by a deletion at the end of the head; the second overwrites the local sequence at the target site and therefore is easier to implement. Both methods can be implemented to operate between chromosomes or within a chromosome or even within a single gene.
|
|
For example, a mind-reading stunt might also involve the magical transposition of two different objects. Such hybrid feats of magic are often called mental magic by performers. Magicians who routinely mix magic with mental magic include David Copperfield, David Blaine, The Amazing Kreskin, and Dynamo. Notable mentalists who mix magic with mentalism include The Amazing Kreskin, Richard Osterlind, David Berglas, Derren Brown, and Joseph Dunninger.
|
|
It contained a number of interesting innovations, some of which remain fairly uncommon. For example, most MIDI controllers provide aftertouch data, but the Midiboard is capable of polyphonic aftertouch, a feature found on few other keyboards. The Midiboard also provides comprehensive signal routing, layering, and transposition control. These advanced features are not without their cost: the Midiboard weighs approximately 100 lb and is fairly difficult to use.
|
|
However, the French success became widely known and, after a publication in Le Matin, the Germans changed to a new system on 18 November 1914.Kahn, pp. 301-304. During World War II, the double transposition cipher was used by Dutch Resistance groups, the French Maquis and the British Special Operations Executive (SOE), which was in charge of managing underground activities in Europe.Kahn, pp.
|
|
Stockfish can use up to 512 CPU threads in multiprocessor systems. The maximal size of its transposition table is 32 TB. Stockfish implements an advanced alpha–beta search and uses bitboards. Compared to other engines, it is characterized by its great search depth, due in part to more aggressive pruning, and late move reductions. Stockfish supports Chess960, which is one feature that was inherited from Glaurung.
|
|
The original key of the composition was A major, however, it was later transposed and arranged in various ways. Today the transposition in G major (a tone lower) is the most commonly used version. The main form of the composition is called ordinarium and consists of six parts. The mass contains characteristic short melodic motifs inspired by the folk music, supported by colorful rhythms.
|
|
The flap is disconnected from the body except for the uncut edge which contains the blood supply which feeds in horizontally. A rotation flap is similar except instead of being stretched in a straight line, the flap is stretched in an arc. The more complex transposition flap involves rotating an adjacent piece of tissue, resulting in the creation of a new defect that must then be closed.
|
|
In the 2000s, some types of "real books" have been published which fully respect copyright laws. In the same period, some electronic "fake books" became available, which offer instant transposition. This facilitates the performance of music at shows where some performers have transposing instruments, or in shows with a singer who wants the band to play in a different key to accommodate their vocal range.
|
|
7-note segment of interval cycle C7 A Klumpenhouwer Network, named after its inventor, Canadian music theorist and former doctoral student of David Lewin's at Harvard, Henry Klumpenhouwer, is "any network that uses T and/or I operations (transposition or inversion) to interpret interrelations among pcs" (pitch class sets).Lewin, David (1990). "Klumpenhouwer Networks and Some Isographies That Involve Them", p.84, Music Theory Spectrum, Vol.
|
|
Allen Forte defines transposition so as to apply to unordered sets of other than twelve pitches: :the addition mod 12 of any integer k in S to every integer p of P. thus giving, "12 transposed forms of P".Forte (1964). "A Theory of Set-Complexes for Music", p. 149, Journal of Music Theory 8/2:136–83. cited in Schuijer (2008), p. 57.
|
|
However, transformation operations of such smaller sets do not necessarily result in permutation the original set. Here is an example of non- permutation of trichords, using retrogradation, inversion, and retrograde- inversion, combined in each case with transposition, as found within in the tone row (or twelve-tone series) from Anton Webern's Concerto:Whittall, Arnold. 2008. The Cambridge Introduction to Serialism. Cambridge Introductions to Music, p.97.
|
|
Knowlson, Damned to Fame, 531. According to the painter Avigdor Arikha, an intimate of the author, the rotunda was inspired by the Val-de Grâce church in Paris which Beckett could see from his study window. In an imaginative transposition of reality, Beckett reduced the actual dome to a skull-sized vault that "has the ring of bone to it".Knowlson, Damned to Fame, 531.
|
|
Olfactophilia or osmolagnia is a paraphilia for, or sexual arousal by, smells and odors emanating from the body, especially the sexual areas. This webpage cites the source: Money, John. Lovemaps: Clinical Concepts of Sexual/Erotic Health and Pathology, Paraphilia, and Gender Transposition in Childhood, Adolescence, and Maturity. Buffalo, N.Y.: Prometheus Books, 1986 Sigmund Freud used the term osphresiolagnia in reference to pleasure caused by odors.
|
|
Disease and Disorders: NUMT insertion into the genome can be problematic. Transposition of NUMTs into genome has also been associated with human diseases. De novo integration of NUMT pseudogenes into the nuclear genome has an adverse effect in some cases, promoting various disorders and aging. MtDNA integration into coding genes in the germline cells has dramatic consequences for embryo development and, in many cases, is lethal.
|
|
This was the only code or cipher permitted. Behind this danger zone, another code known as the three-letter code was allowed to be used. Communications between divisions, corps, and army headquarters were done with the ADFGVX cipher. The ADFGX and ADFGVX field ciphers were a modified polybius system with single order double columnar transposition and frequent key change, with letters optimized for Morse.
|
|
While some functions of RNA silencing and its machinery are understood, many are not. For example, RNA silencing has been shown to be important in the regulation of development and in the control of transposition events. RNA silencing has been shown to play a role in antiviral protection in plants as well as insects. Also in yeast, RNA silencing has been shown to maintain heterochromatin structure.
|
|
Jean-Max Albert (born 1942) is a French painter, sculptor, writer, and musician. He has published theory, artist's books, a collection of poems, plays and novels inspired by quantum physics. He perpetuated a reflexion initiated by Paul Klee and Edgar Varèse on the transposition of musical structures into formal constructions. He created plant architectures which come close to site-specific art, environmental sculpture and generative art.
|
|
Up to 75 percent of patients with VACTERL association have been reported to have congenital heart disease. The most common heart defects seen with VACTERL association are ventricular septal defect (VSD), atrial septal defects and tetralogy of Fallot. Less common defects are truncus arteriosus and transposition of the great arteries. It is subsequently thought that cardiac defects should be considered an extension of VACTERL.
|
|
The name CuckooChess comes due that the transposition table is based on Cuckoo hashing. Android app based chess gaming app Droidfish employs both CuckooChess and Stockfish chess engines. Similarly, Kickstarter funded AI based virtual reality chess game Square Off also uses CuckooChess engine. It has an ELO rating of 2583 (as of July 2018) and a rank of 135‑137 in the Computer Chess Rating List.
|
|
After this, the cipher became a regular cipher type in ACA puzzles. In 1987, Noel Currer‐Briggs described the double Playfair cipher used by Germans in World War II. In this case, double Playfair refers to a method using two Polybius squares plus seriation. Even variants of Double Playfair that encipher each pair of letters twice are considered weaker than the double transposition cipher. WGBH Educational Foundation.
|
|
In 1996 Albert Kapengut published a dense analysis of the move 7.f3, which now bears his name. Kapengut himself gave it the name "Half-Sämisch Variation", because the positions it leads to are often reached via transposition from the Sämisch Variation of the King's Indian Defence. The pawn on f3 overprotects e4 and prevents ...Ng4, so that White can continue 7...Bg7 8.
|
|
The genome of Petromyzon marinus was sequenced in 2013. This sequencing effort revealed that the lamprey has unusual guanine-cytosine content and amino acid usage patterns compared to other vertebrates. The full sequence and annotation of the lamprey genome is available on the Ensembl genome browser. The lamprey genome may serve as a model for developmental biology and evolution studies involving transposition of repetitive sequences.
|
|
Although there aren't any official conclusions to the origin of the name, it is believed that the road was part of the property owned by a Mr. Alexander, and 'Rednaxela' is an understandable transposition of the English name 'Alexander', since the Chinese language was typically written right to left at the time. Most of the naming errors in Hong Kong are a result of incorrect or inaccurate translations or transliterations, so some believe the explanation of this unique example of right-to-left transposition error in Hong Kong under colonial bureaucrats inconceivable. Another explanation is that the name is linked to abolitionist Robert Alexander Young, who was known to have used the name "Rednaxela" in his 1829 work Ethiopian Manifesto. Whatever the source of the name, Chinese transliteration followed suit and was adopted by the neighbourhood, and the government never made any further alterations.
|
|
Transposing the diatonic major scale up in semitones results in a different set of notes being used each time. For example, C major consists of C, D, E, F, G, A, B, and the scale a semitone higher (D major) consists of D, E, F, G, A, B, C. By transposing D major up another semitone, another new set of notes (D major) is produced, and so on, giving 12 different diatonic scales in total. When transposing a mode of limited transposition this is not the case. For example, the mode of limited transposition that Messiaen labelled "Mode 1", which is the whole tone scale, contains the notes C, D, E, F, G, A; transposing this mode up a semitone produces C, D, F, G, A, B. Transposing this up another semitone produces D, E, F, G, A, C, which is the same set of notes as the original scale.
|
|
Clef transposition is routinely taught (among other places) in Belgium and France. One imagines a different clef and a different key signature than the ones printed. The change of clef is used so that the lines and spaces correspond to different notes than the lines and spaces of the original score. Seven clefs are used for this: treble (2nd line G-clef), bass (4th line F-clef), baritone (3rd line F-clef or 5th line C-clef, although in France and Belgium sight-reading exercises for this clef, as a preparation for clef transposition practice, are always printed with the 3rd line F-clef), and C-clefs on the four lowest lines; these allow any given staff position to correspond to each of the seven note names A through G. The signature is then adjusted for the actual accidental (natural, sharp or flat) one wants on that note.
|
|
From the Introduction in Part I, Volume I, by Callimahos: "This text represents an extensive expansion and revision, both in scope and content, of the earlier work entitled 'Military Cryptanalysis, Part I' by William F. Friedman. This expansion and revision was necessitated by the considerable advancement made in the art since the publication of the previous text." Callimahos referred to parts III–VI at the end of the first volume: "...Part III will deal with varieties of aperiodic substitution systems, elementary cipher devices and cryptomechanisms, and will embrace a detailed treatment of cryptomathematics and diagnostic tests in cryptanalysis; Part IV will treat transposition and fractioning systems, and combined substitution-transposition systems; Part V will treat the reconstruction of codes, and the solution of enciphered code systems, and Part VI will treat the solution of representative machine cipher systems." However, parts IV–VI were never completed.
|
|
Scale of yangqin, the numbers indicate the notes in the diatonic scale, 1 = do, 2 = re etc. The yangqin is a chromatic instrument with a range of slightly over four octaves. Middle C is located on the tenor bridge, third course from the bottom. The pitches are arranged so that in general, moving one section away from the player's body corresponds to a transposition of a whole tone upwards.
|
|
In this way, genes help control the "self- transformation" of an organism by making use of transposition elements, also known as 'transposons' in genetics, "which can effect the remodeling of the own genome". Transposons operate according to their intrinsic rules. In Schmerzgrenze – Vom Ursprung alltäglicher und globaler Gewalt, Bauer summarizes his findings of modern neurobiology on the development of human aggression and violence.Joachim Bauer: Schmerzgrenze – Vom Ursprung alltäglicher und globaler Gewalt.
|
|
The Modern Defense, or Abbazia Defense,The name comes from a tournament, played in Abbazia in 1912, in which all the games had to be a King's Gambit Accepted. The town, at the time in the Austria-Hungary empire, is now in modern Croatia (3.Nf3 d5) has much the same idea as the Falkbeer Countergambit, and can in fact be reached by transposition, e.g. 2.f4 d5 3.
|
|
20 Despite his grief, he resumed his studies, and in 1930 Messiaen won first prize in composition. While a student he composed his first published works—his eight Préludes for piano (the earlier Le banquet céleste was published subsequently). These exhibit Messiaen's use of his modes of limited transposition and palindromic rhythms (Messiaen called these non-retrogradable rhythms). His public début came in 1931 with his orchestral suite Les offrandes oubliées.
|
|
Messiaen's music has been described as outside the western musical tradition, although growing out of that tradition and being influenced by it.Griffiths (1985), p. 15 Much of his output denies the western conventions of forward motion, development and diatonic harmonic resolution. This is partly due to the symmetries of his technique—for instance the modes of limited transposition do not admit the conventional cadences found in western classical music.
|
|
Messiaen used modes he called modes of limited transposition. They are distinguished as groups of notes that can only be transposed by a semitone a limited number of times. For example, the whole-tone scale (Messiaen's Mode 1) only exists in two transpositions: namely C–D–E–F–G–A and D–E–F–G–A–B. Messiaen abstracted these modes from the harmony of his improvisations and early works.
|
|
P elements are administered in pairs of two, which flank the DNA insertion region of interest. Additionally, P elements often consist of two plasmid components, one known as the P element transposase and the other, the P transposon backbone. The transposase plasmid portion drives the transposition of the P transposon backbone, containing the transgene of interest and often a marker, between the two terminal sites of the transposon.
|
|
Early 19th-century French piccolo in D-flat. In the orchestral setting, the piccolo player is often designated as "piccolo/flute III", or even "assistant principal". The larger orchestras have designated this position as a solo position due to the demands of the literature. Piccolos are often orchestrated to double the violins or the flutes, adding sparkle and brilliance to the overall sound because of the aforementioned one-octave transposition upwards.
|
|
The Mustard Procedure allows total correction of transposition of the great vessels. The procedure employs a baffle to redirect caval blood flow to the left atrium which then pumps blood to the left ventricle which then pumps the deoxygenated blood to the lungs. In a normal heart, de-oxygenated blood is pumped into the lungs via the right ventricle. Then it is distributed throughout the body via the left ventricle.
|
|
Surgery for congential heart disease Long-term results of atrial correction for transposition of the great arteries: Comparison of Mustard and Senning operations. Helbing W, Hansen B, Ottenkamp I et al. J Thorac Cardiovasc Surg 1994;108:363-372 Overall, in most studies the survival is good into the second decade post procedure. 78% of patients were alive after 16 years in a large follow up study from the Netherlands.
|
|
In 1970, the Belgian semioticians known under the name Groupe μ, reorganized the four operations. First they observed that the so-called transposition operation can be redefined as a series of addition and omission operations, so they renamed it as "omission-addition".Groupe μ (1970) sections 3 to 3.2.1 They categorized the addition, omission and omission-addition operation as substantial operations, while they considered permutations as categorized permutation as relational operations.
|
|
Atrial switch is a heart operation performed to treat dextro- transposition of the great arteries. It involves the construction of an atrial baffle which redirects the blood coming into the atria to restore the connection between systemic and pulmonary circulation. Two variants of the atrial switch operation exist – the Senning procedure which uses the patient's own tissue (pericardium) to construct the baffle, and the Mustard procedure, which uses a synthetic material.
|
|
Transposons, chromosomal segments that can undergo transposition, can be designed and applied to insertional mutagenesis as an instrument for cancer gene discovery. These chromosomal segments allow insertional mutagenesis to be applied to virtually any tissue of choice while also allowing for more comprehensive, unbiased depth in DNA sequencing. Researchers have found four mechanisms of insertional mutagenesis that can be used on humans. the first mechanism is called enhancer insertion.
|
|
Transposition is done by moving all intervals up or down a certain constant interval, and does change the key but not the mode, which requires the alteration of intervals. The use of triads only available in the minor mode, such as the use of A-major in C major, is relatively decorative chromaticism, considered to add color and weaken the sense of key without entirely destroying or losing it.
|
|
For example, in the case n=3 we start with 123, then we flip 3 with its left neighbor and get 132. We then flip 3 with its left neighbor 1, as flipping 3 with its right neighbor 2 would yield again 123, which we have seen before, so we arrive at 312, etc. The direction of the transposition (left or right) is always uniquely determined in this algorithm.
|
|
Although they are retrotransposons, they cannot carry out reverse transcription using an RNA transposition intermediate in the same way as LTR retrotransposons. Those two key components of the retrotransposon are still necessary but the way they are incorporated into the chemical reactions is different. This is because unlike LTR retrotransposons, non-LTR retrotransposons do not contain sequences that bind tRNA. They mostly fall into two types – LINEs and SINEs.
|
|
Deep dyslexia is mainly characterized by the occurrence of semantic reading errors or semantic paralexias (transposition of letters or words) when reading aloud (e.g. the written word "view" is read aloud as "scene", the word "bird" is read as "canary"). These semantic errors are the major distinguishing feature of deep dyslexia in comparison to other central dyslexias. There are many other symptoms of deep dyslexia, including visual errors (e.g.
|
|
Persian mathematician Al-Khwarizmi's Al-Jabr in the 9th century introduced the fundamental concepts of "reduction" and "balancing", referring to the transposition of subtracted terms to the other side of an equation and the cancellation of like terms on opposite sides of the equation. This is the operation which Al-Khwarizmi originally described as al-jabr. The name "algebra" comes from the "al-jabr" in the title of his book.
|
|
The adaptation and transposition of the play to France, by Stewart Vaughan and Jean-Claude Islert, required that the nationality of the jockey be reversed. The play was directed by Christopher Renshaw. Muir worked for BBC Radio for many years. He appears as the voice of Rosencrantz in Shakespeare's Hamlet and was the voice of Blacksmith in a TV series called animated tales of the world, in 2000.
|
|
Alprostadil is also used in maintaining a patent ductus arteriosus in newborns. This is primarily useful when the threat of premature closure of the ductus arteriosus exists in an infant with ductal- dependent congenital heart disease, including cyanotic lesions (e.g., hypoplastic left heart syndrome, pulmonary atresia/stenosis, tricuspid atresia/stenosis, transposition of the great arteries) and acyanotic lesions (e.g., coarctation of the aorta, critical aortic stenosis, and interrupted aortic arch).
|
|
The rail fence cipher follows a pattern similar to that of the scytale, a mechanical system of producing a transposition cipher used by the ancient Greeks. The system consisted of a cylinder and a ribbon that was wrapped around the cylinder. The message to be encrypted was written on the coiled ribbon. The letters of the original message would be rearranged when the ribbon was uncoiled from the cylinder.
|
|
In perhaps its most famous appearance, Miles defeated reigning World Champion Anatoly Karpov in the 1980 European Team Chess Championship in Skara, Sweden. The opening also acquired the name of "Birmingham Defence" at this time, after Miles' hometown. Boris Spassky also played the St. George Defence, albeit by transposition, in the 22nd game of his 1966 world championship match against World Champion Tigran Petrosian. That game began 1.
|
|
16-22 The point of the piece is once again to make a witty transposition of the Classical scene into present- day circumstances as an extension of the poem's anachronistic fun. At a slightly later date Rowland Rugeley (1738 - 76) was to imitate their performance in much the same manner in "The City Mouse and Country Mouse: a fable to a friend in town".Miscellaneous poems and translations (1763), pp.
|
|
A (erroneous) claim propagated in 1612 held that Willoughby's Land was identical to Spitsbergen, thus supporting an English claim prior to the Dutch discovery by Barentsz in 1596. This claim was used to justify a monopoly charter on whaling rights granted to the Muscovy Company in 1613. Georg Michael Asher (1860) believed the two islands to be merely a western transposition of the two main islands of Novaya Zemlya.
|
|
Because of this, the New Automatic Proofreader was introduced in February 1986. This version used a more sophisticated checksum algorithm that could catch transposition errors. It also took spaces into account if they were within quotes (where they were generally significant to the program's operation), while ignoring them outside of quotes (where they were not relevant). Also, the decimal display of the checksum was replaced by two letters.
|
|
These short telomeres increase chromosomal instability, and increase the chances of certain cancers progressing in the body, such as with leukemia. In gastric mucosa tissues, the expression of TERF2 proteins was significantly higher than normal, and this over-expression of TERF2, along with over-expression of TERF1, TIN2, TERT, and BRCA1 protein transposition, may cause a reduction in telomere length, further contributing to multistage carcinogenesis of gastric cancer.
|
|
Accessed 5 October 2007 It is also responsible for reporting on drinking water quality to the European Union under the European Drinking Water Directive (DWD), Council Directive 98/83/EC, which concerns the quality of water intended for human consumption.The European Commission's Environment DG web site. Accessed 5 October 2007 In addition, it provides advice to DEFRA on the transposition of European water legislation in England and Wales.
|
|
Improvements in railways at the time made this possible. There was intense competition for markets with Chicago, and to a lesser degree, with Racine and Kenosha. Eventually Chicago won out due to its superior financial and transposition status, as well as being a hub on major railroad lines throughout the United States. Milwaukee did solidify its place as the commercial capital of Wisconsin and an important market in the Midwest.
|
|
Multiple MIDI controllers for each track can be viewed and edited on different lanes. MIDI tracks can also be shown in musical notation within a score editor. MIDI data such as note quantization, duration, transposition, delay and velocity can also be altered non-destructively and in real-time on a track-per-track basis. Video files can be imported to one or more video tracks and organized in multiple playlists.
|
|
Some digital accordions allow the entire instrument to be transposed to a different key and/or change the tuning. The Scandalli EWA has a wireless transmitter and receiver, which means that the instrument can be played onstage without a wired connection to the sound system. External pedals can be plugged into the Scandalli EWA, such as a sustain pedal, or pedals to control transposition or portamento/pitch glide effects.
|
|
He was one of the fathers of the field of interventional catheterization, and he developed not only this life-saving technique and device for neonates with transposition of the great arteries, but also devices to close atrial septal defects (ASDs) and persistent patent ductus arteriosus (PDA). He was the chief of the Division of Pediatric Cardiology at the Children's Hospital of Philadelphia until his death in 1986 from malignant melanoma.
|
|
On any modern trumpet, cornet, or flugelhorn, pressing the valves indicated by the numbers below produces the written notes shown. "Open" means all valves up, "1" means first valve, "1–2" means first and second valve simultaneously, and so on. The sounding pitch depends on the transposition of the instrument. Engaging the fourth valve, if present, usually drops any of these pitches by a perfect fourth as well.
|
|
Large quantities of TEs within genomes may still present evolutionary advantages, however. Interspersed repeats within genomes are created by transposition events accumulating over evolutionary time. Because interspersed repeats block gene conversion, they protect novel gene sequences from being overwritten by similar gene sequences and thereby facilitate the development of new genes. TEs may also have been co-opted by the vertebrate immune system as a means of producing antibody diversity.
|
|
A transposition table is a cache of previously seen positions, and associated evaluations, in a game tree generated by a computer game playing program. For fast searching of the table, a hash function may be used, such as Zobrist hashing, to speed finding matching boards.Albert Lindsey Zobrist, A New Hashing Method with Application for Game Playing, Tech. Rep. 88, Computer Sciences Department, University of Wisconsin, Madison, Wisconsin, (1969).
|
|
SIEL Ochestra 2 internals Later, a more programmable version of the Orchestra was released. It still used 4 preset sections, however it offered many improvements over the original version. A better filter for the brass section was included and more sounds were added to other sections. It also introduced a very simple LFO, a graphic equalizer, octave transposition and an 'animator section' which was effectively a flange effect.
|
|
The check digit is an additional digit, used to verify that a barcode has been scanned correctly. It is computed modulo 10, where the weights in the checksum calculation alternate 3 and 1. In particular, since the weights are relatively prime to 10, the EAN-13 system will detect all single digit errors. It also recognizes 90% of transposition errors (all cases, where the difference between adjacent digits is not 5).
|
|
These are known as cyanotic congenital heart defects and are often more serious. Major congenital heart defects are often picked up in childhood, shortly after birth, or even before a child is born (e.g. transposition of the great arteries), causing breathlessness and a lower rate of growth. More minor forms of congenital heart disease may remain undetected for many years and only reveal themselves in adult life (e.g.
|
|
Hypolydian mode on F (only with B instead of the usual B ). The introit Requiem aeternam, from which the Requiem Mass gets its name, is in Hypolydian mode (Mode 6). The Hypolydian mode, literally meaning "below Lydian", is the common name for the sixth of the eight church modes of medieval music theory . The name is taken from Ptolemy of Alexandria's term for one of his seven tonoi, or transposition keys .
|
|
Transpressional shear zones are characterized by an association of structures that suggest zone-normal shortening and zone-parallel shearing. Commonly developed features include transposition foliations, lineations, stylolites, folds, and reverse faults. Pure shear-dominated transpression usually gives steep lineations, while simple shear-dominated transpression favors horizontal lineations. It is also common for non-vertical transpressional zones to have a significant component of shearing parallel to the dipline of the zone boundary.
|
|
Figure 5. Dogleg jack, English coupler system. When depressed, the upper key lifts the "dogleg" jack (jack A) upwards. The lower key lifts all three jacks A, B, and C. The use of multiple manuals in a harpsichord was not originally provided for the flexibility in choosing which strings would sound, but rather for transposition of the instrument to play in different keys (see History of the harpsichord).
|
|
This may be accomplished by the Hardy–Weinberg law. This is possible because the theorem of Gaussian adaptation is valid for any region of acceptability independent of the structure (Kjellström, 1996). In this case the rules of genetic variation such as crossover, inversion, transposition etcetera may be seen as random number generators for the phenotypes. So, in this sense Gaussian adaptation may be seen as a genetic algorithm.
|
|
During a 2008 lecture and in a subsequent article Carotta presented an extension of his theory, which interprets the Gospel as a diegetic transposition (see above).. English version: "The Gospels as diegetic Transposition: A possible Solution to the Aporia 'Did Jesus exist?'". In 2009 Carotta wrote an article in which he supported the arguments for the authenticity of the so-called Orpheos Bakkikos, a supposedly syncretistic early Christian amulet showing the Crucifixion of Christ.. English version: "Orpheos Bakkikos — The Missing Cross". Carotta postulates that the lost amulet showed the funerary wax effigy of Caesar, presented on a tropaeum. In a 2011 article Carotta argued for a restitution of the Liberalia (17 March) as the correct date of Caesar's funeral ceremony, and for a dismissal of the chronology developed by 19th century German scholars.. In a 2012 book containing earlier and new articles he argued that Fulvia was the mother of Christianity and possibly the author of the ur-gospel.
|
|
From here the medial signature πλ δ' at the end of the following kolon on c is prepared, so the thesis of the melos uses here the melos of phthora nana, as it can be found in the final cadence of the transcriptions. But the use of phthora nana, unlike a conventional transposition (μεταβολή κατὰ τόνον), does not require a second transposition. If the same melos uses the lower register between c (γ') and G (πλ δ') and the lower tetrachord D (πλ α')—G (πλ δ'), the nana melos will find its way back to the ' on G (πλ δ'). Chourmouzios transcribed the νεάγιε νανὰ cadence transposed a third lower on a (πλ δ'), when he followed the method of Germanos of New Patras (EBE 748), or a second lower on b flat (πλ δ') in his own composition according to the style παλαιὸν (EBE 709), which is still close to his transcription of Germanos.
|
|
Matrix transposition To keep the matrices circulating smoothly throughout the machine, it is necessary that oil not be allowed anywhere near the matrix path. If oil is found in the matrix's path (due to careless maintenance or over-lubrication of nearby parts), it combines with dust, forming a gummy substance that is eventually deposited in the magazine by the matrices. The most common result is that the matrix will not be released from the magazine at its usual speed, and almost always results in a letter or two arriving out of sequence in the assembler—a "matrix transposition". When these machines were in heavy use, it was not uncommon for an operator to set type at the rate of over 4,000 ems per hour, with the fastest operators being able to exceed 10,000 ems per hour (approximately 10 to 30 words per minute in today's units) so careful lubrication and regular cleaning were essential to keep these machines operating at their full potential.
|
|
Several projects at European level with impact on medical physics matters and legislation have been undertakenWebsite about projects, EFOMP, retrieved on March 26th 2020. One of the most important was the transposition of the Basic Safety Standards (BSS) Directive (Council Directive 2013/59/Euratom)Council Directive 2013/59/EURATOM laying down basic safety standards for protection against the dangers arising from exposure to ionising radiation, and repealing Directives 89/618/Euratom, 90/641/Euratom, 96/29/Euratom, 97/43/Euratom and 2003/122/Euratom, Council of the European Union, Version 5. December 2013. After the BSS was brought into force in 2014, EFOMP headed a European consortium with the task to merge current scientific, technological and operational knowledge and experience with the consolidation of different directives and recommendations in the field of radiation protection. The objective of this project was to evaluate Member States‘ activities for the transposition and implementation of Council Directive in the medical area.
|
|
Inheritance: Genome-wide analyses showed that the bulk of Helitrons tend to be quite recent. The young age of Helitron families is of course biased by the genomes that have been examined carefully, which are predominately plant and insect where the unconstrained DNA half-life (the average amount of time when half of DNA not conserved for function is lost) is quite rapid. In contrast to other DNA transposons, Helitrons from some species have been reported to exhibit long- term activity probably due to the mechanism of transposition or inability of the host to recognize Helitrons because of either sequence heterogeneity or host gene capture. In contrast, to the relatively faster unconstrained DNA half-life (2.5–14 my) of the plant and insect genomes, the mammalian DNA half- life is estimated to be much slower (884 my) which along with the minimal requirements of Helitron transposition and the slow rate of decay in mammals have caused this pattern of vertical persistence.
|
|
Insertion element (also known as an IS, an insertion sequence element, or an IS element) is a short DNA sequence that acts as a simple transposable element. Insertion sequences have two major characteristics: they are small relative to other transposable elements (generally around 700 to 2500 bp in length) and only code for proteins implicated in the transposition activity (they are thus different from other transposons, which also carry accessory genes such as antibiotic resistance genes). These proteins are usually the transposase which catalyses the enzymatic reaction allowing the IS to move, and also one regulatory protein which either stimulates or inhibits the transposition activity. The coding region in an insertion sequence is usually flanked by inverted repeats. For example, the well-known IS911 (1250 bp) is flanked by two 36bp inverted repeat extremities and the coding region has two genes partially overlapping orfA and orfAB, coding the transposase (OrfAB) and a regulatory protein (OrfA).
|
|
At least seven mechanisms of intron gain have been reported thus far: Intron Transposition, Transposon Insertion, Tandem Genomic Duplication, Intron Transfer, Intron Gain during Double-Strand Break Repair (DSBR), Insertion of a Group II Intron, and Intronization. In theory it should be easiest to deduce the origin of recently gained introns due to the lack of host-induced mutations, yet even introns gained recently did not arise from any of the aforementioned mechanisms. These findings thus raise the question of whether or not the proposed mechanisms of intron gain fail to describe the mechanistic origin of many novel introns because they are not accurate mechanisms of intron gain, or if there are other, yet to be discovered, processes generating novel introns. In intron transposition, the most commonly purported intron gain mechanism, a spliced intron is thought to reverse splice into either its own mRNA or another mRNA at a previously intron-less position.
|
|
A characteristic feature of Oriental Sephardic music is the transposition of popular hymn tunes (themselves sometimes derived from secular songs) to important prayers such as Nishmat and Kaddish. This occurs only to a limited extent in the Spanish and Portuguese ritual: such instances as exist can be traced to the book of hymns Imre no'am (1628), published in Amsterdam by Joseph Gallego, a hazzan originating in Salonica.Link to .pdf file; another link; on screen version.
|
|
Prime, retrograde, inverted, and retrograde-inverted forms of the ascending chromatic scale. P and RI are the same (to within transposition), as are R and I. In the above example, as is typical, the retrograde inversion contains three points where the sequence of two pitches are identical to the prime row. Thus the generative power of even the most basic transformations is both unpredictable and inevitable. Motivic development can be driven by such internal consistency.
|
|
Furthermore, another open reading frame was identified downstream of opd and encodes a protein that further degrades p-nitrophenol, one of the byproducts of OP degradation. This protein is believed to work as a complex with PTE, since a dramatic increase in activity is observed when PTE is present. Therefore, the characteristic architectural organization of the opd gene region suggests that different species acquired the gene through horizontal transfer through transposition and plasmid transfer.
|
|
In cryptography, CRYPTON is a symmetric block cipher submitted as a candidate for the Advanced Encryption Standard (AES). It is very efficient in hardware implementations and was designed by Chae Hoon Lim of Future Systems Inc. The CRYPTON algorithm processes blocks of 128 bits in the form of 4×4 byte arrays. The round transformation consists of four steps: byte-wise substitution, column-wise bit permutation, column-to-row transposition and finally key addition.
|
|
Harbisson's Sonochromatic Music Scale (2003) is a microtonal and logarithmic scale with 360 notes in an octave. Each note corresponds to a specific degree of the color wheel. The scale was introduced to the first eyeborg in 2004. Modern Painters, The International Contemporary Art Magazine pp 70-73 (New York, June 2008) Harbisson's Pure Sonochromatic Scale (2005) is a non-logarithmic scale based on the transposition of light frequencies to sound frequencies.
|
|
Whenever a computer is done with its current job it fetches a new job from the queue. It then computes all possible distinct positions that can be reached from the current position in one action. This is all traditional transposition based problem solving. However, in the traditional method, the computer would now, for every position just computed, ask the computer that holds authority over that position if it has a solution for it.
|
|
I. Allegro ma non troppo (B major) Uses a four-key exposition (B major, G major, E major, F-sharp major). II. Andante (E major) III. Scherzo: Allegretto – Trio (G major, D major) IV. Allegro giusto (B major) The work takes approximately 24 minutes to perform. Daniel Coren has noted that the first movement of this sonata is the only such movement in Schubert's sonatas where the recapitulation is an exact transposition of the exposition.
|
|
The Belgian semioticians known under the name Groupe μ, developed a method of painting research to apply the fundamental rhetorical operations in the interpretation of a work of painting. The method, called structural semantic rhetoric, aimed at determining the stylistic and aesthetic features of any painting through operations of addition, omission, permutation and transposition from a basic "zero degree" painting.Winfried Nöth (1995) Handbook of semiotics pp.342, 459Jean-Marie Klinkenberg et al.
|
|
Wire transposition on top of pole The earliest telephones used telegraph lines which were single-wire earth return circuits. In the 1880s electric trams were installed in many cities, which induced noise into these circuits. In some countries, the tram companies were held responsible for disruption to existing telegraph lines and had to pay for remedial work. For new installations, however, it was necessary to protect against existing trams from the outset.
|
|
Since it is a melodic tuning, depending on intervals, no transposition was required. The same interval going up received a different small pitch increment from that interval going down. Moreover, similarly to known use in tones like the leading tone, Clynes found it appropriate to provide quite small, specific increments to all melodic intervals, 24 in all (twelve up and twelve different ones down). A new patent [US 6,924,426] was granted in 2006.
|
|
The cipher is a transposition based grille cipher, consisting of a grid with 25 columns and 24 rows. Each row contains 10 randomly placed white cells (to be filled with text) and 15 black cells. The columns are labeled with shuffled digraphs and numbers and the rows with digraphs. The key sheet also contains two letter substitution alphabets to encode place names, prior to encryption, and a letter conversion alphabet to encode digraphs.
|
|
Exon shuffling is the creation of novel gene products due to the new placement of two previously unrelated exons through transposition. Because of their ability to alter DNA expression, transposons have become an important target of research in genetic engineering. Barbara McClintock was the first to discover the existence of DNA transposons in maize plants at Cold Spring Harbor Laboratory. She was awarded the Nobel Prize in Physiology or Medicine in 1983.
|
|
Moreover, the glycation can result in the formation of Advanced Glycation End- Products (AGE), which result in abnormal biological effects. Accumulation of AGEs leads to tissue damage via alteration of the structures and functions of tissue proteins, stimulation of cellular responses, through receptors specific for AGE-proteins, and generation of reactive oxygen intermediates. AGEs also react with DNA, thus causing mutations and DNA transposition. Thermal processing of proteins and carbohydrates brings major changes in allergenicity.
|
|
When a LINE is transcribed, the transcript contains an RNA polymerase II promoter that ensures LINEs can be copied into whichever location it decides to insert itself into. RNA polymerase II is the enzyme that transcribes genes into mRNA transcripts. The ends of LINE transcripts are rich in multiple adenines , the bases that are added at the end of transcription so that LINE transcripts would not be degraded. This transcript is the RNA transposition intermediate.
|
|
The Roar of the Greasepaint – The Smell of the Crowd is a musical with a book, music, and lyrics by Leslie Bricusse and Anthony Newley. The musical is best known for introducing the standards "A Wonderful Day Like Today", "Who Can I Turn To?", "Feeling Good", and "The Joker". The show title is a transposition of the phrase "the smell of the greasepaint, the roar of the crowd," referring to the experience of theatre performers.
|
|
A cointegrate is the intermediate molecule between donor DNA and target DNA covalently bind during the formation of a Holliday junction. Transposons elements are DNA sequences that can change its position within the genome, sometimes creating reversing mutations. A number of bacterial transposons, especially those related to Tn3 Tn552, encodes two recombinases that participate in their transposition to other DNA. The initial step that mediated this process involve the formation of cointegrate.
|
|
"In his book "River Town", the New Yorker writer Peter Hessler says, "In most parts of Sichuan, you can walk into a restaurant and order chaoshou without making a sound. Cross your arms and they will understand exactly what you want."" One native speaker claims the Sichuan-only name for these dumplings may have originated at one time by a dialectic transposition, i.e. "chao shou" was originally "shou chao", meaning "hand-folded".
|
|
Vol 12 1986-1987, pages 39-57. These drawings on the subject of Don Quixote's falls are an aesthetic transposition of twenty four physical and symbolic falls suffered by Miguel de Cervantes' literary hero. The series consists of thirty- two drawings, with different versions and studies for some of the falls. Lorenzo Domínguez was always attracted by this Spanish novel, both as reading matter and subject of meditation, and as an aesthetic paradigm.
|
|
In software-efficient ciphers, it can be done by interleaving arithmetic operations with byte-swapping operations and to a small degree with bitwise rotation operations. However, triangular T-functions remain highly inefficient in hardware. T-functions do not have any restrictions on the types and the widths of the update functions used for each bit. Subsequent transposition of the output bits and iteration of the T-function also do not affect bijectivity.
|
|
Alfred Music. . This is a mode of Olivier Messiaen's seventh mode of limited transposition; it has six transpositions, like the tritone, and five modes (the same pitch classes with C, D, D, E, or E taken as the first scale step or tonic). This allows a dominant seventh chord to be built upon the tonic and a seventh sharp nine chord, and allows the tonic chord to have an altered ninth, eleventh, and thirteenth factors.
|
|
Cheshire dialect contains some words that are distinct from standard English, such as "shippen" for cow shed.The National Archives: Photographs related to Gladys Threadgold and family (accessed 14 July 2010) According to Leigh, most unique Cheshire words derive from Anglo-Saxon; "shippen" is from scypen. Other words derive from transposition, for example, "waps" for "wasp" and "neam" for "name". The British Library Sound Archive contains recordings of the dialect from various parts of the county.
|
|
Queensland Club was listed on the Queensland Heritage Register on 21 October 1992 having satisfied the following criteria. The place is important in demonstrating the evolution or pattern of Queensland's history. The Queensland Club is important in demonstrating the pattern of Queensland's history as an example of the transposition of a British, class oriented gentlemen's club, to Brisbane Society. The place is important in demonstrating the principal characteristics of a particular class of cultural places.
|
|
Préludes pour piano (Preludes for piano) is an early work for piano by the French composer Olivier Messiaen composed in 1928–1929, when the composer was 20 years old. Messiaen considered it to be his first work of any value.Letter to Claude Samuel dated July 14, 1986. The composition is based on Messiaen's modes of limited transposition,Christopher Dingle and Robert Fallon (eds.), Messiaen Perspectives 1: Sources and Influences, Ashgate, page 242.
|
|
Source: WIPO. # Modifications to the duration of copyright were by transposition of Council Directive 93/98/EEC of 29 October 1993 harmonizing the term of protection of copyright and certain related rights, OJ no. L290 of 24 November 1993, p. 9\. # Directive 2001/29/EC of the European Parliament and of the Council of 22 May 2001 on the harmonisation of certain aspects of copyright and related rights in the information society, OJ no.
|
|
There are a number of theories that have been challenged by the effects shown with transposition-letter priming. These theories mainly have to do with how letters are used to process words. Slot- based coding theory states that each letter in a word is connected to a particular location, or slot, within that word. One of the major theories that predict letter slots is the interactive activation model created by McClelland and Rumelhart (1981).
|
|
In Haydn's time, this symphony required the use of horns crooked in B natural. Except for period instrument performances, the horn players now use valve horns, and perform the transposition from horns in B natural to horns in F or B-flat in their minds. In many recordings, the players read their parts as if for horns in B basso rather than B alto, which is almost certainly correct.Hodgson (1976): 74, footnote.
|
|
Nozy was introduced to music at a young age through his father, Norbert Nozy, who was in a local band. Nozy studied at the Royal Conservatory of Brussels and at the Lemmens Institute in Leuven. He won first prizes in music theory, transposition, percussion, chamber music, harmony, counterpoint and the higher diploma saxophone. Nozy studied conducting with Andre Vandernoot, Yvon Ducène, Leonce Gras and Jean-Sebastien Bereau of the Conservatoire de Paris.
|
|
A music transposer is a software program, physical or electronic device for the transposition of musical notes and/or chords from one note/key to another. It simply consists of two identical scales which can be moved in relation to each other to give the required result. Until 1994 transposers consisted of sliding three transparencies alongside each other. In November 1994 the circular transposer was invented by Terence Tranter, a British resident in Australia.
|
|
In men, chemotherapy can result in permanent damage to the testicular tissue. Due to advances in reproductive medicine, a variety of fertility-protective methods are now available. These techniques include administration of GnRH-agonists, ovarian stimulation with cryoconservation of fertilised or unfertilised oocytes, as well as cryoconservation of ovarian tissue. Relocation of the ovaries by surgically moving them out of the pelvis (ovarian transposition) to protect them from damage caused by radiotherapy is also possible.
|
|
Ben Johnston uses a "just tone row" (see just intonation) in works including String Quartets Nos. 6 and 7. Each permutation contains a just chromatic scale, however, transformations (transposition and inversion) produce pitches outside of the primary row form, as already occurs in the inversion of P0. The pitches of each hexachord are drawn from different otonality or utonality on A+ utonality, C otonality and utonality, and E- otonality, outlining a diminished triad.
|
|
In this movement he takes advantage of the hexachords to establish a link between the transformations of the tone-row and its inversions. In this way, on one hand he pairs each transposition of the original sequence, with its retrograde and, on the other, with another inversion and its respective retrogradation. Figure 5. Derivació de les durades a partir de la sèrieMitchell, Rachel E. "Form and function in Roberto Gerhard's String Quartet no. 1".
|
|
The division of the tone-row into these two complementary hexachords at the beginning of the quartet predisposes the importance that the hexachordal relationship plays in this work. In addition to this, each hexachord in the original series is part of the SC 6–22 (012468), which is complementary in itself. As a result, each hexachord, either extracted from the beginning or the end of the row, is related by its transposition and retrograded inversion.
|
|
A switch chooses between the keyboard and ribbon. Further adjustments can be made using controls in the body of the instrument. These include several dials for tuning the pitch, a dial for adjusting the overall volume, a switch to transpose the pitch by one octave, and a switch to activate a filter. alt=The drawer of the Seventh model also includes six transposition buttons, which change the pitch by a specific interval.
|
|
A more general definition associates non-negative weight functions ins(), del() and sub(, ) with the operations. Additional primitive operations have been suggested. Damerau–Levenshtein distance counts as a single edit a common mistake: transposition of two adjacent characters, formally characterized by an operation that changes into . For the task of correcting OCR output, merge and split operations have been used which replace a single character into a pair of them or vice versa.
|
|
Gravikord Music for the gravikord can be written in the normal grand staff method using the G clef and F clef. Also people who do not know music theory can play standard music scores. The gravikord has a property that simplifies the reading of musical notation and the transposition of music written in other key signatures for playing on the instrument. It can be done directly from the music using a mental method.
|
|
Perry Broad, born in Rio de Janeiro in 1921, came to Berlin with his mother at the age of five. He studied at the Technical University of Berlin and joined the Waffen-SS in 1941 as a foreigner. Detached on duty to Auschwitz, he asked for transposition to the "Politische Abteilung" where he conducted interrogations. He remained in Auschwitz until the dissolution of the camp in early 1945 and was captured by British armed forces.
|
|
In the case of bacteria, transposition mutagenesis is usually accomplished by way of a plasmid from which a transposon is extracted and inserted into the host chromosome. This usually requires a set of enzymes including transposase to be translated. The transposase can be expressed either on a separate plasmid, or on the plasmid containing the gene to be integrated. Alternatively, an injection of transposase mRNA into the host cell can induce translation and expression.
|
|
If data exchange is interrupted, the trains distance measurement system fails, or the train fails to detect 4 or more cable transposition points the LZB system will go into a failure state. It will light the "Stör" indicator and then flash "Ü". The driver must acknowledge the indications within 10 seconds. The driver must slow the train to no more than or lower; the exact speed depends on the backup signalling system in place.
|
|
" The Film Daily (Sept 13, 1931): "Great: Walt Disney and his assistants have turned out a synchronized cartoon comedy that will be hard to beat. It has all the Mother Goose rhymes worked into the story and the transposition from one to the other is accomplished by turning the pages of a huge story book. Drawings on the pages come to life and perform real laugh-making antics. Gags are new and plentiful.
|
|
The game was sold with a Rumble Pak accessory for the Nintendo DS, marking the first time the accessory was available for the Nintendo DS. Metroid Prime Pinball received generally positive reviews. Critics praised the game's transposition of the Metroid series into a pinball video game, but criticized its lack of variety. Metroid Prime Pinball sold 6,228 copies during its debut month of October 2005 in the United States, and over 15,000 units in Japan as of May 2008.
|
|
Westphal is the author of several other books, such as Roman et Evangile (2000), about the transposition, in a plain narratological sense, of episodes or characters drawn from the Gospels in the contemporary European novel. He is also the author of L’œil de la Méditerranée. Une odyssée littéraire (2005), which brings together a series of studies of Mediterranean places, and Austro-fictions. Une géographie de l’intime (2010), which explores the works of a dozen of contemporary Austrian writers.
|
|
Four centuries later, Boethius interpreted Ptolemy in Latin, still with the meaning of transposition keys, not scales. When chant theory was first being formulated in the 9th century, these seven names plus an eighth, Hypermixolydian (later changed to Hypomixolydian), were again re- appropriated in the anonymous treatise Alia Musica. A commentary on that treatise, called the Nova expositio, first gave it a new sense as one of a set of eight diatonic species of the octave, or scales.
|
|
In October 2013, after a one-month review period for OASIS members, the OASIS Open Document Format for Office Applications (OpenDocument) Technical Committee requested that OASIS submit ODF 1.2 to the ISO/IEC Joint Technical Committee 1 (JTC1) for approval as a proposed International Standard under JTC1's "Publicly Available Specification" (PAS) transposition procedure. This submission happened in late March 2014. As of 3 April 2014, ODF 1.2 had reached the enquiry stage of ISO's ratification process.
|
|
Moreover, transposition activity increases the TE copy number and generates chromosomal rearrangement hotspots. HTT detection is a difficult task because it is an ongoing phenomenon that is constantly changing in frequency of occurrence and composition of TEs inside host genomes. Furthermore, few species have been analyzed for HTT, making it difficult to establish patterns of HTT events between species. These issues can lead to the underestimation or overestimation of HTT events between ancestral and current eukaryotic species.
|
|
The ancient Greeks were aware that their language had changed since the time of Homer (about 730BC). Aristotle (about 330BC) identified four types of linguistic change: insertion, deletion, transposition and substitution. In the 1st century BC, the Romans were aware of the similarities between Greek and Latin. In the post-classical West, with the influence of Christianity, language studies were undermined by the naïve attempt to derive all languages from Hebrew since the time of Saint Augustine.
|
|
The peniche itself affects the fluid dynamics around the half-model. It increases the local angle of attack on an inboard wing, while having no influence on an outboard wing.Melber-Wilkending, Stefan and Georg Wichmann. "Project ForMEx — A New CFD Approach for Transposition of Wind Tunnel Data Towards Flight Conditions", from New Results in Numerical and Experimental Fluid Mechanics VI. Cameron Tropea, Suad Jakirlic, Hans-Joachim Heinemann, Rolf Henke, Heinz Hönlinger eds. pp. 113-120. 2006.
|
|
Management of this condition is surgical and typically involves reducing the strength of the superior rectus muscle or anterior transposition of the inferior oblique muscle of the affected eyes. Several different surgical procedures exist for the correction of DVD including: inferior oblique anteriorization, inferior oblique anteriorization plus resection, superior rectus recession, superior rectus recession plus posterior fixation suture, and inferior oblique myectomy, though there is insufficient evidence to determine which procedure results in the best outcomes for patients.
|
|
This version was not without its problems, however, as it became known that key transposition errors could occur at high typing speeds. In addition, interoperability issues related to the USB hub and lack of power were noticed with some systems. The "Das Keyboard Model S" was introduced in late 2009, and continues to be sold today. It contains revised electronics to address some of the common complaints along with supporting media keys and PS/2 operation.
|
|
Thomas G. Baffes (April 3, 1923 – June 15, 1997) was an American surgeon and attorney noted for developing a surgical procedure to repair a heart defect known as transposition of the great vessels, which often caused "blue baby" deaths.Chicago Tribune;Dr. Thomas Baffes, Surgeon And Lawyer;June 22, 1997;By Teresa Puente;Dr. Thomas G. Baffes, 74, a noted physician and a lawyerNew York Times:NEW OPERATION USED IN BLUE BABY' CASES;January 31, 1956American Academy of Pediatrics;Dr.
|
|
This transposition and decoupling is not merely visual, and extends to Swing's management and application of its own OS-independent semantics for events fired within its component containment hierarchies. Generally speaking, the Swing architecture delegates the task of mapping the various flavors of OS GUI semantics onto a simple, but generalized, pattern to the AWT container. Building on that generalized platform, it establishes its own rich and complex GUI semantics in the form of the model.
|
|
Octave equivalence appears to be used, as transposition down by an octave of subsequent repetitions of a section is common, though may also occur down a perfect fourth or perfect fifth (p. 43). Songs begin with a "head motif" repeated by the second singer and then used to "generate" the rest of the song in ways which are fairly predictable to Blackfoot listeners, which facilitates accomplishing the ideal of learning songs in one hearing (p. 100-101).
|
|
Opening books aid computer programs by giving common openings that are considered good ways to counter poor openings. All strong programs use opening books and update their books automatically after each game. To go through all positions from all games in the game database and determine the best move not played in any database game, transposition tables are used to record positions that have been previously searched. This means those positions do not need to be searched again.
|
|
Also, the scrotum may be higher than usual on either side of the penis (called penoscrotal transposition). The cause of hypospadias is unknown. It most often occurs by itself, without other variations, although in about 10% of cases it may be part of an intersex condition or a medical syndrome with multiple abnormalities. The most common associated difference is an undescended testicle, which has been reported in around 3% of infants with distal hypospadias and 10% with proximal hypospadias.
|
|
"The genetic correlation between characters maintained by selection, linkage and inbreeding." Genetical research 44.03 (1984): 309-320. Transposition allows the loci at different locations on the chromosome to move so that they can become close to each other and be inherited together. This is significant to understanding the relationship between phenotypic integration and evolution because it is one of the mechanisms of how multiple traits that are connected to each other to evolve and change together.
|
|
"Cut and Paste" transposable element mechanism of excision and insertion into target site. Traditionally, DNA transposons move around in the genome by a cut and paste method. The system requires a transposase enzyme that catalyzes the movement of the DNA from its current location in the genome and inserts it in a new location. Transposition requires three DNA sites on the transposon: two at each end of the transposon called terminal inverted repeats and one at the target site.
|
|
Cox, however, wrote that many White players are bluffing, and in fact know nothing about either the Vienna Game or the Four Knights Game, to which the game can easily transpose if Black plays 2...e5, citing one book which recommended 2.Nc3 while assuring readers that 2...e5 is uncommon. Another transposition Black may enter is 2...d6, which usually leads to the Pirc Defence. The independent Alekhine line is 2...d5, known as the Scandinavian Variation.
|
|
In mammals, the Y chromosome directs the development of the testes and plays an important role in spermatogenesis. A high percentage of infertile men have deletions that map to regions of the Y chromosome. The DAZ (deleted in azoospermia) gene cluster maps to the AZFc region and is deleted in many azoospermic and severely oligospermic men. It is thought that the Y chromosomal DAZ gene cluster arose from the transposition, amplification, and pruning of the ancestral autosomal gene DAZL.
|
|
Starting on any degree of the mode gives the same sequence of intervals, and therefore the whole tone scale has only 1 mode. Messiaen's mode 2, or the diminished scale, consists of semitone, tone, semitone, tone, semitone, tone, semitone, tone, which can be arranged only 2 ways, starting with either a tone or a semitone. Therefore mode 2 has two modes. Any scale having the same number of modes as notes is not a mode of limited transposition.
|
|
In cryptography, a transposition cipher is a method of encryption by which the positions held by units of plaintext (which are commonly characters or groups of characters) are shifted according to a regular system, so that the ciphertext constitutes a permutation of the plaintext. That is, the order of the units is changed (the plaintext is reordered). Mathematically a bijective function is used on the characters' positions to encrypt and an inverse function to decrypt. Following are some implementations.
|
|
The Rail Fence cipher is a form of transposition cipher that gets its name from the way in which it is encoded. In the rail fence cipher, the plaintext is written downwards and diagonally on successive "rails" of an imaginary fence, then moving up when we get to the bottom. The message is then read off in rows. For example, using three "rails" and a message of 'WE ARE DISCOVERED FLEE AT ONCE', the cipherer writes out: W . . .
|
|
Interspersed repetitive DNA is found in all eukaryotic genomes. They differ from tandem repeat DNA in that rather than the repeat sequences coming right after one another, they are dispersed throughout the genome and nonadjacent. The sequence that repeats can vary depending on the type of organism, and many other factors. Certain classes of interspersed repeat sequences propagate themselves by RNA mediated transposition; they have been called retrotransposons, and they constitute 25–40% of most mammalian genomes.
|
|
Mūlabhadra (മൂലഭദ്ര) aka Mūlabhadri (:ml:മൂലഭദ്രി) was a secret method of communication employed by the royal spies of the erstwhile Travancore Kingdom during the medieval period. The scheme was also colloquially referred to as Mūlapatra. It was essentially a cryptographic scheme involving a partial transposition of the letters of the Malayalam alphabet. The scheme had been extensively used by King Marthanda Varma (1706–1758) of Travancore Kingdom and his spies both for oral and written communication of messages.
|
|
Alonzo stated, "We're going to be doing the classics of magic but a little high-tech. We'll be doing a little dissection, transposition, a vanish, an appearance — and if I do a trick, she doesn't just hold the props, she's actually getting inside the big boxes or I am slicing her up. ... Some of it's pretty scary, but she gets right in there with no reservations." The costumes were designed by Dean and Dan Caten from DSquared2.
|
|
The transposition of values towards an affirmation of ordinary life emerged within a changing understanding of the cosmic order. The eighteenth-century mechanistic understanding of universe and the human mind did not give rise to an atheist understanding of the cosmos. Rather, the mechanisms discovered through practical, empirical investigation were understood as God's work. A belief in deism emerged, though never uncontested—namely, that miracles and revelation were not required as a proof of God's existence.
|
|
In 1995 Milton started the humorous Viking strip Svend, Knud & Valdemar, produced for the monthly magazine Glimt. This comic strip has since 2001 been released in album format under the name Jomsvikingerne (see Jomsvikings). Two years later, however, he returned to the funny animal scene through a transposition into comics of K. H. Wieth's children's story Musebogen. In parallel, Milton continued to draw Disney comics for the Netherlands, now without Jippes and sometimes after his own scripts.
|
|
When adopted, directives give member states a timetable for the implementation of the intended outcome. Occasionally, the laws of a member state may already comply with this outcome, and the state involved would be required only to keep its laws in place. More commonly, member states are required to make changes to their laws (commonly referred to as transposition) in order for the directive to be implemented correctly. This is done in approximately 99% of the cases.
|
|
Guitars, like double basses, sound an octave below the written note in typical notation. Piccolo, sopranino, soprano, bass and sometimes alto recorders, xylophone, and celesta sound an octave above the written note. Glockenspiel and garklein recorder sound two octaves above the written note. Most authorities include this type of notation under the umbrella "transposing instruments", According to this article, if an octave-transposing clef is used (with a small 8 above or below), the term "transposition" does not apply.
|
|
Millions more listened to radio broadcasts. Propelled by a giant Saturn V rocket, Apollo 11 lifted off from Launch Complex 39A at the Kennedy Space Center on July 16, 1969, at 13:32 UTC (09:32 EDT), and entered Earth orbit twelve minutes later. After one and a half orbits, the S-IVB third-stage engine pushed the spacecraft onto its trajectory toward the Moon. About 30 minutes later, Collins performed the transposition, docking, and extraction maneuver.
|
|
Earlier editions of MCO give only a single column of analysis and consider only the 2...b5 lines. MCO-9 (1957), states that the Polish "fails because it neglects the centre". That negative verdict was softened in the next edition, MCO-10 (1965), to say that the Polish "neglects the centre, but is not refuted". MCO-12 (1982) retains the "not refuted" assessment and notes that the Polish can result by transposition from the Réti system.
|
|
Heinrich Glarean considered that the modal scales including a B had to be the result of a transposition. In his Dodecachordon, he not only described six "natural" diatonic scales (still neglecting the seventh one with a diminished fifth above the reference note), but also six "transposed" ones, each including a B, resulting in the total of twelve scales that justified the title of his treatise. These were the 6 non-Locrian modes of C major and F major.
|
|
Barbara McClintock's studies of maize genetics demonstrated genetic transposition in the 1940s and 1950s. She dedicated her life to her research, and she was awarded the Nobel Prize in Physiology or Medicine in 1983. McClintock is one of several scientists whose works are commemorated by a U.S. postage stamp. Nita Ahuja is a renowned surgeon- scientist known for her work on CIMP in cancer, she is currently the Chief of surgical oncology at Johns Hopkins Hospital.
|
|
The Luhn algorithm will detect any single-digit error, as well as almost all transpositions of adjacent digits. It will not, however, detect transposition of the two-digit sequence 09 to 90 (or vice versa). It will detect most of the possible twin errors (it will not detect 22 ↔ 55, 33 ↔ 66 or 44 ↔ 77). Other, more complex check-digit algorithms (such as the Verhoeff algorithm and the Damm algorithm) can detect more transcription errors.
|
|
Page 127. In contrast, an indirect proof may begin with certain hypothetical scenarios and then proceed to eliminate the uncertainties in each of these scenarios until an inescapable conclusion is forced. For example, instead of showing directly p ⇒ q, one proves its contrapositive ~q ⇒ ~p (one assumes ~q and shows that it leads to ~p). Since p ⇒ q and ~q ⇒ ~p are equivalent by the principle of transposition (see law of excluded middle), p ⇒ q is indirectly proved.
|
|
Historically, this referred to mistakes in manual type-setting (typography). The term includes errors due to mechanical failure or slips of the hand or finger, but excludes errors of ignorance, such as spelling errors, or changing and misuse of words such as "than" and "then". Before the arrival of printing, the "copyist's mistake" or "scribal error" was the equivalent for manuscripts. Most typos involve simple duplication, omission, transposition, or substitution of a small number of characters.
|
|
These are further divided into long terminal repeat (LTR) retrotransposons, long interspersed nuclear elements (LINEs), and short interspersed nuclear elements (SINEs). In LTR retrotransposons, after the RNA template is degraded, a DNA strand complementary to the reverse-transcribed cDNA returns the element to a double-stranded state. Integrase, an enzyme encoded by the LTR retrotransposon, then reincorporates the element at a new target site. These elements are flanked by long terminal repeats (300–500bp) which mediate the transposition process.
|
|
The Harbisson's Sonochromatic Music Scale Harbisson's Sonochromatic Music Scale (2003) is a microtonal and logarithmic scale with 360 notes in an octave. Each note corresponds to a specific degree of the color wheel. The scale was introduced to the first antenna in 2004. Modern Painters, The International Contemporary Art Magazine pp 70-73 (New York, June 2008) Harbisson's Pure Sonochromatic Scale (2005) is a non-logarithmic scale based on the transposition of light frequencies to sound frequencies.
|
|
The Damus–Kaye–Stansel (DKS) procedure is a cardiovascular surgical procedure used as part of the repair of some congenital heart defects. This procedure joins the pulmonary artery and the aorta in situations where the systemic circulation is obstructed. It is commonly used when a patient has the combination of a small left ventricle and a transposition of the great arteries (TGA); in this case, the procedure allows blood to flow from the left ventricle to the aorta.
|
|
Denise Pelletier called Kuproquo a well directed and very funny film with excellent actors, subjecting contemporary québecois to scrutiny through a lens tinged with irony: Charles and Geneviève believe they are a modern open minded couple but balk when confronted by a frustratingly embarrassing question from their son. However, Rivard does not sit in judgement over them; more like a spectator, he presents a point of view with his particular form of transposition: a good dose of humour.
|
|
They make up 1–5% of the genomic DNA in different fruit flies, 0–3% in mammals, >0.5% in the frog. In most mammals Helitron's presence is negligible and limited to remnants of old transposons, with the exception of bat genomes, which are populated by numerous young elements. However, many years after the description autonomous Helitrons, no mechanistic studies have been published and therefore the rolling-circle mechanism of transposition remains a well-supported but not yet tested hypothesis.
|
|
The precise structure of the sudoku symmetry group can be expressed succinctly using the wreath product (≀). The possible row (or column) permutations form a group isomorphic to S3 ≀ S3 of order 3!4 = 1,296. The whole rearrangement group is formed by letting the transposition operation (isomorphic to C2) act on two copies of that group, one for the row permutations and one for the column permutations. This is S3 ≀ S3 ≀ C2, a group of order 1,2962 × 2 = 3,359,232.
|
|
779 In 1781 Gluck produced a German version of the opera, Iphigenia in Tauris, for the visit of the Russian Grand Duke Paul to Vienna, with the libretto translated and adapted by Johann Baptist von Alxinger in collaboration with the composer. Among the major changes was the transposition of the role of Oreste from baritone to tenor and the replacement of the final chorus of Act 2 with an instrumental movement.Krause, p. 14Rushton, booklet notes, p.
|
|
In March 2007 the EU commission published its first progress report on the implementation of the EU Framework Directive. The report notes mixed results. Almost all member countries have transposed the directive into national law, but the report notes that "the legal transposition of the Directive in national law is poor and in many cases inadequate". Indeed, the report finds that only in three countries the national law (Austria, Malta and Portugal) is in conformity with the Directive.
|
|
He began the 2010 season with the Portland Beavers, but underwent ulnar nerve transposition during the season. On November 22, 2011, Inman signed a minor league contract with the Boston Red Sox. After pitching for the Pawtucket Red Sox during the 2012 season, he became a free agent, and signed with the Tampa Bay Rays for the 2013 season, receiving a non-roster invitation to spring training. On July 1, 2013, Inman was released by the Rays.
|
|
Since they are symmetrical, whole-tone scales do not give a strong impression of the tonic or tonality. The composer Olivier Messiaen called the whole-tone scale his first mode of limited transposition. The composer and music theorist George Perle calls the whole-tone scale interval cycle 2, or C2. Since there are only two possible whole-tone-scale positions (that is, the whole-tone scale can be transposed only once), it is either C20 or C21.
|
|
Taruskin (1993: p. 202) The composer created two versions—the Original Version of 1869, which was rejected for production by the Imperial Theatres, and the Revised Version of 1872, which received its first performance in 1874 in Saint Petersburg. Boris Godunov has seldom been performed in either of the two forms left by the composer,Oldani (1982: p. 7) frequently being subjected to cuts, recomposition, re-orchestration, transposition of scenes, or conflation of the original and revised versions.
|
|
Both motifs are usually located with transposase-encoding genes related to the IS605 family. The motifs appear 3′ to these genes. Although transposase genes are often associated with inverted repeats that are a product of their transposition mechanism, both specific RNA/DNA motifs are more complicated than the simple, apparent stemloop structure that inverted repeats exhibit. It is because of this association with transposase genes that IS605-orfB RNA motifs might function as single-stranded DNA.
|
|
Transposition, docking, and extraction (often abbreviated to transposition and docking) was a maneuver performed during Apollo lunar landing missions from 1969 to 1972, to withdraw the Apollo Lunar Module (LM) from its adapter housing which secured it to the Saturn V launch vehicle upper stage and protected it from the aerodynamic stresses of launch. The maneuver involved the command module pilot separating the Apollo Command and Service Module (CSM) from the adapter, turning the CSM around, and docking its nose to the Lunar Module, then pulling the combined spacecraft away from the upper stage. It was performed shortly after the trans-lunar injection maneuver that placed the Apollo spacecraft on a three-day trajectory to the Moon. The docking created a continuous, pressurized tunnel which permitted the astronauts to transfer internally between the CSM and the LM. The same maneuver was performed on the 1975 Apollo–Soyuz Test Project (ASTP) mission to extract a special docking module used to connect the Apollo Command Module with the Soyuz spacecraft.
|
|
In Hilbert-style deductive systems for propositional logic, only one side of the transposition is taken as an axiom, and the other is a theorem. We describe a proof of this theorem in the system of three axioms proposed by Jan Łukasiewicz: :A1. \phi \to \left( \psi \to \phi \right) :A2. \left( \phi \to \left( \psi \rightarrow \xi \right) \right) \to \left( \left( \phi \to \psi \right) \to \left( \phi \to \xi \right) \right) :A3. \left ( \lnot \phi \to \lnot \psi \right) \to \left( \psi \to \phi \right) (A3) already gives one of the directions of the transposition. The other side, ( \psi \to \phi ) \to ( eg \phi \to eg \psi), if proven below, using the following lemmas proven here: : (DN1) eg eg p \to p \- Double negation (one direction) : (DN2) p \to eg eg p \- Double negation (another direction) : (HS1) (q \to r) \to ((p \to q) \to (p \to r)) \- one form of Hypothetical syllogism : (HS2) (p \to q) \to ((q \to r) \to (p \to r)) \- another form of Hypothetical syllogism.
|
|
RECONCILIATION THROUGH a COMMON PURPOSE: THIRD PARTY HUMAN RIGHTS IN CYPRUS UNHCR contributed to the development of the European Refugee Fund (ERF -managed by the Ministry of Interior) annual and multi-annual strategy for Cyprus and participated in the selection committee for ERF project awards in 2005 and 2006. In 2006, it undertook the training of civil servants coming in contact with asylum seekers and refugees, and the training of teachers on asylum as a human right in the context of a project on European citizenship. UNHCR has closely advised the AS and the RA in particular towards sound policy and practice towards applicants from Iraq and Palestine in light of the particular current circumstances.UNITED NATIONS HIGH COMMISSIONER FOR REFUGEESEVALUATION AND POLICY ANALYSIS UNIT , DEPARTMENT OF INTERNATIONAL PROTECTION, ANDREGIONAL BUREAU FOR EUROPEComparative analysis of gender-related persecution in national asylum legislation and practice in Europe UNHCR assisted in the transposition of the EU directive on the minimum standards for the reception conditions (transposed in December 2005), the transposition of the EU qualifications directive (transposed in July 2006), and of the EU procedures directive.
|
|
Transcription and transposition errors are found everywhere, even in professional articles in newspapers or books. They can be missed by editors quite easily, just as they can be created quite easily. The most obvious cure for the errors is for the user to watch the screen when they type, and to proofread. If the entry is occurring in data capture forms, databases or subscription forms, the designer of the forms or the database administrator should use input masks or validation rules.
|
|
He appeared on Opening Day against the Rockies, and did not allow any runs. In the month of April, he recorded 15 strikeouts in 12.1 innings, while only walking one batter. Villarreal was placed on the disabled list on May 10 with a strained right flexor. After playing on a rehab assignment with the Tucson Sidewinders in July, doctors took an MRI on Villarreal's elbow on August 6 and determined that he would need to undergo season-ending nerve transposition surgery.
|
|
Several artists from the 17th century onwards have provided woodcuts for the whole run of La Fontaine's fables, most of which go little beyond illustrating the bird standing beside the water. The most original was J.J.Grandville's transposition of the characters into contemporary terms. The heron is on the left, gazing askance at the fish which impertinently peep at him from the shallows. To the right, the old maid of La Fontaine's parallel fable hangs on the arm of a bloated individual.
|
|
Yamazaki’s work in Transposition 21 heavily influenced Sakate’s theater work, as it was the first kind of theater he had encountered. Inspired from his time in the theater company, he established his own company on this principle. By using real live and historical events as a basis for his plays, they are able to concentrate on political and social commentary going on in modern Japan. Sakate was also influenced by Yamazaki’s journalistic style of writing social criticism by dramatizing contemporary events.
|
|
Example 4. The song of the golden oriole from Le loriot, part of Catalogue d'oiseaux. The birdsong played by the pianist's left hand (notated on the lower staff) provides the fundamental notes, and the quieter harmonies played by the right hand (on the upper staff) alter their timbre. In addition to making harmonic use of the modes of limited transposition, he cited the harmonic series as a physical phenomenon that provides chords with a context he felt was missing in purely serial music.
|
|
Thematic transformation (also known as thematic metamorphosis or thematic development) is a musical technique in which a leitmotif, or theme, is developed by changing the theme by using permutation (transposition or modulation, inversion, and retrograde), augmentation, diminution, and fragmentation. It was primarily developed by Franz Liszt and Hector Berlioz. The technique is essentially one of variation. A basic theme is reprised throughout a musical work, but it undergoes constant transformations and disguises and is made to appear in several contrasting roles.
|
|
Pedro II of Brazil, who was the country's second emperor, was born and bred in the neighborhood and from there he ruled the country for almost half a century. During his reign the neighborhood was modernized and industries were installed. He was deposed by a military coup on November 15, 1889 and the Quinta da Boa Vista became a museum in 1893. Since before the transposition of the Portuguese Court to the neighbourhood, the place attracted a growing Portuguese diaspora.
|
|
Second, the increased homozygosity in selfers removes the opportunity for competition among homologous alleles. Third, theoretical work has shown that the greater linkage disequilibrium in selfing compared to outcrossing genomes may in some, albeit rather limited, cases cause selection for reduced transposition rates. Overall, this reasoning leads to the prediction that asexuals/selfers should experience a lower load of selfish genetic elements. One caveat to this is that the evolution of selfing is associated with a reduction in the effective population size.
|
|
All the seasons (from the last to the first) have adaptated into novels written by John Lang himself. It could have been just a mere transposition from the audio and comic seasons into text, but the author added a fair amount of "cut scenes", as well a "prequel" part in the ironically last written book that relates the first seasons. Ironically because according to John Lang "Naheulbeuk could not go translated and sold in foreign languages unless the (book) series was completed".
|
|
Early work characterizing Ty5 targeted transposition focused on two fronts: identifying the component of Ty5 responsible for targeting and identifying the factor with which it interacted. Due to the central role of the Sir proteins in heterochromatin formation, they were initially considered as potential targeting signals. Because integration is mediated by the retrotransposon integrase enzyme, it was speculated to contain a component that would recognize heterochromatin. The C-terminus of the Ty retrotransposon’s integrase contains an extension not seen in the retroviruses.
|
|
In some cases the terms codes and ciphers are also used synonymously to substitution and transposition. Historically, cryptography was split into a dichotomy of codes and ciphers; and coding had its own terminology, analogous to that for ciphers: "encoding, codetext, decoding" and so on. However, codes have a variety of drawbacks, including susceptibility to cryptanalysis and the difficulty of managing a cumbersome codebook. Because of this, codes have fallen into disuse in modern cryptography, and ciphers are the dominant technique.
|
|
These simple ciphers and examples are easy to crack, even without plaintext-ciphertext pairs. Simple ciphers were replaced by polyalphabetic substitution ciphers (such as the Vigenère) which changed the substitution alphabet for every letter. For example, "GOOD DOG" can be encrypted as "PLSX TWF" where "L", "S", and "W" substitute for "O". With even a small amount of known or estimated plaintext, simple polyalphabetic substitution ciphers and letter transposition ciphers designed for pen and paper encryption are easy to crack.
|
|
It is possible to create a secure pen and paper cipher based on a one-time pad though, but the usual disadvantages of one-time pads apply. During the early twentieth century, electro-mechanical machines were invented to do encryption and decryption using transposition, polyalphabetic substitution, and a kind of "additive" substitution. In rotor machines, several rotor disks provided polyalphabetic substitution, while plug boards provided another substitution. Keys were easily changed by changing the rotor disks and the plugboard wires.
|
|
Rudolf of St Trond (also Rodulf, Rodolfus, Rodolphe, Radulphus, Rudolph, or Raoul, c. 1070–1138) was a Benedictine abbot of St Trond Abbey, chronicler and composer.Radulphus of St. Trond A musical treatise Quaestiones in musica was attributed to him by Rudolf Steglich;Rudolf Steglich, Die Quaestiones in musica: ein Choraltraktat des zentralen Mittelalters und ihr mutmasslicher Verfasser, Rudolf von St Trond (1070–1138) (Leipzig, 1911/R) another suggestion is Franco of Liège.Dolores Pesce, The Affinities and Medieval Transposition (1987), pp. 39-40.
|
|
Such open-wire balanced lines with periodic transpositions still survive today in some rural areas. Twisted-pair cabling was invented by Alexander Graham Bell in 1881. . See also TIFF format scans for USPTO 00244426 By 1900, the entire American telephone network was either twisted pair or open wire with transposition to guard against interference. Today, most of the millions of kilometres of twisted pairs in the world are outdoor landlines, owned and maintained by telephone companies, used for voice service.
|
|
It also includes negascout search, the killer move heuristic, static exchange evaluation, quiescence search, alpha-beta pruning, a transposition table, a refutation table, an evaluation cache, selective extensions, recursive null- move search, and many other features (cf manual). Special editions of the program include enhanced features such as an opening book, positional learning, and an endgame tablebase. Crafty was one of the programs included in the SPEC CPU2000 benchmark test. It is also included as an additional engine in Fritz.
|
|
RNAi, specifically siRNA and miRNA silencing, is a naturally occurring mechanisms that, in addition to regulating eukaryotic gene expression, prevents transcription of DNA transposons. Another mode of inactivation is overproduction inhibition. When transposase exceeds a threshold concentration, transposon activity is decreased. Since transposase can form inactive or less active monomers that will decrease transposition activity overall, a decrease in the production of transposase will also occur when large copies of those less active those elements increase in the host genome.
|
|
A proposed nomenclature aims to clean up the sometimes paraphyletic standards. There are two proposals for how HERVs became fixed in the human genome. The first assumes that sometime during human evolution, exogenous progenitors of HERV inserted themselves into germ line cells and then replicated along with the host's genes using and exploiting the host's cellular mechanisms. Because of their distinct genomic structure, HERVs were subjected to many rounds of amplification and transposition, which lead to a widespread distribution of retroviral DNA.
|
|
Once the 75 seconds have elapsed, the student will have 60 seconds to perform the piece. Transposition of the key is allowed for voice comfort as stated on each year's directions. As with the melodic dictation part of the exam, one piece will generally be compound in meter and major in key, while the other will be simple in meter and minor in key. Students may sing the melody using solfège syllables, numbers, or any other syllable (la, ta, na, etc.).
|
|
Like LTR retrotransposons, non-LTR retrotransposons contain genes for reverse transcriptase, RNA-binding protein, nuclease, and sometimes ribonuclease H domain but they lack the long terminal repeats. RNA-binding protein binds RNA- transposition intermediate. Nucleases are enzymes that break phosphodiester bonds between nucleotides in nucleic acids. Instead they have short repeats that can have an inverted order of bases next to each other aside from direct repeats found in LTR retrotransposons that is just one sequence of bases repeating itself.
|
|
The RNA transposition intermediate moves from the nucleus into the cytoplasm for translation. This gives the two coding regions of a LINE that in turn binds back to the RNA it is transcribed from. The LINE RNA then moves back into the nucleus to insert into the eukaryotic genome. LINEs insert themselves into regions of the eukaryotic genome that are rich in bases AT. At AT regions LINE uses its nuclease to cut one strand of the eukaryotic double-stranded DNA.
|
|
Drèze gave a public lecture on "Human Capital and Risk Bearing" (48). The innovative idea here is the transposition of the reasoning underlying the theory of "implicit labour contracts" to the understanding of wage rigidities and unemployment benefits. When markets are incomplete, so that workers cannot insure the risks associated with their future terms of employment, competitive clearing of spot labour markets is not second-best efficient: wage rigidities cum unemployment benefits offer scope for improvement. The lecture develops this theme informally.
|
|
Modes of limited transposition are musical modes or scales that fulfill specific criteria relating to their symmetry and the repetition of their interval groups. These scales may be transposed to all twelve notes of the chromatic scale, but at least two of these transpositions must result in the same pitch classes, thus their transpositions are "limited". They were compiled by the French composer Olivier Messiaen, and published in his book La technique de mon langage musical ("The Technique of my Musical Language").
|
|
Harpsichord builders in the Southern Netherlands built instruments with two keyboards which could be used for transposition. These Flemish instruments served as the model for Baroque- era harpsichord construction in other nations. In France, the double keyboards were adapted to control different choirs of strings, making a more musically flexible instrument (e.g., the upper manual could be set to a quiet lute stop, while the lower manual could be set to a stop with multiple string choirs, for a louder sound).
|
|
However, because the resulting "fundamental durations" are not small enough for use in the musical detail, subdivisions corresponding to the transposition of the overtones of a pitch's harmonic spectrum are used . The twelve logarithmic metronomic tempos used in Gruppen, covering a tempo "octave" (doubling in speed) from = 60 to 120 are : The composer recalled that, when Igor Stravinsky saw the score for the first time, he wrote that such fractional metronomic values as 63.5 and 113.5 were "a sign of German thoroughness" .
|
|
P elements are a family of transposons that recently proliferated within the genome of Drosophila melanogaster. The P elements have an extremely high transposition rate and induce sterility and abnormal gonad development in D. melanogaster (Johnson, 2). The flies thus developed a maternally inherited technique for combating the invasive DNA and silencing the transposons, now known as P cytotype. P cytotype detects DNA sequences in areas of telomeric heterochromatin and silences those sequences when they are found elsewhere in the genome.
|
|
The treaty envisages that the main principles of EU competition policy are also applicable. The timeline for transposition and implementation is laid down by the treaty or by a Ministerial Council decision. Moldova is a partner country of the EU INOGATE energy programme, which has four key topics: enhancing energy security, convergence of member state energy markets on the basis of EU internal energy market principles, supporting sustainable energy development, and attracting investment for energy projects of common and regional interest.
|
|
This can lead to both recovery of the messages, and to recovery of the keys (so that every other message sent with those keys can be read). During World War I, the German military used a double columnar transposition cipher, changing the keys infrequently. The system was regularly solved by the French, naming it Übchi, who were typically able to quickly find the keys once they'd intercepted a number of messages of the same length, which generally took only a few days.
|
|
Hybrid dysgenesis manifests when crossing P strain males with M strain females and not when crossing P strain females (females with autonomous P elements) with M strain males. The eggs of P strain females contain high amounts of a repressor protein that prevents transcription of the transposase gene. The eggs of M strain mothers, which do not contain the repressor protein, allow for transposition of P elements from the sperm of fathers. In P strain females, the repressors are found in the cytoplasm.
|
|
There is no uniformly accepted notation for these groups. Some authors use F in place of Fi (F22, for example). Fischer's notation for them was M(22), M(23) and M(24)′, which emphasised their close relationship with the three largest Mathieu groups, M22, M23 and M24. One particular source of confusion is that Fi24 is sometimes used to refer to the simple group Fi24′, and is sometimes used to refer to the full 3-transposition group (which is twice the size).
|
|
Complete removal of cardiac neural crests results in persistent truncus arteriosus characterised in most cases by the presence of just one outflow valve and a ventricular septal defect. Mesencephalic neural crest cells interfere with normal development of cardiac outflow septation as its presence leads to persistent truncus arteriosus. However, the addition of trunk neural crest cells results in normal heart development. Other outcomes of cardiac outflow anomalies includes Tetralogy of Fallot, Eisenmenger’s complex, transposition of the great vessels and double outlet right ventricle.
|
|
From the beginning of the 1920s, Karjagdyoglu took an active part in the public life of the republic. The singer stood at the origins of the creation of the national conservatory and played an important role in the formation of new cadres. In addition to teaching, he was a consultant to the research room of Azerbaijani music at the Conservatory. Jabbar Karjagdyoglu was a supporter of the transposition of mugams to notes and in this work assisted the composer Fikret Amirov.
|
|
Senning was influenced to become a cardiovascular surgeon when during his training, he heard of Clarence Crafoord's operations to repair coarctation of the aorta. He trained under Crafoord from 1948 to 1956 in Sabbatsberg Hospital, where he and the doctor turned engineer Rune Elmqvist developed the first totally implantable pacemaker. From 1956, Senning led the Department of Experimental Surgery at Karolinska Hospital. In 1957 Senning performed the first repair of a common congenital heart malformation called transposition of the great arteries or TGA.
|
|
About 30 minutes later, with Collins in the left seat and at the controls, the transposition, docking, and extraction maneuver was performed. This involved separating Columbia from the spent S-IVB stage, turning around, and docking with Eagle still attached to the stage. After the LM was extracted, the combined spacecraft headed for the Moon, while the rocket stage flew on a trajectory past the Moon. This was done to avoid the third stage colliding with the spacecraft, the Earth, or the Moon.
|
|
This is slightly transposed from a reading also found in the Greek minuscules 97 and 421, supported by the Old Latin h and a textual note in the margin of the Harclean Syriac. In Acts 27:7 it has the transposition βρα[δυπλοουντε]ς εν δε ικαν[αις ημεραις. Αll other witnesses have this sentence in the word order: εν ικαναις δε ημεραις βραδυπλοουντες.J. K. Elliott, Seven Recently Published New Testament Fragments from Oxyrhynchus, Novum Testamentum XLII, 3, p. 211.
|
|
About 1895 the inboard oil engine emerged for small boats. From this, hundreds of small boat engine manufactures set up shop: Bolinder, Gray Marine Engine, Kermath, Union Iron Works, Caille, Palmer, Red Wing, St. Lawrence, and Buda; Sulzer, B and W, Gardner, and Ailsa Craig to mention a few. Two-stroke engines were popular for many years, however, the parallel development of the auto engine, with their many cylinders, became a natural transposition. Chrysler, Ford, Packard, and Hudson also made marine engines.
|
|
Local flaps are created by freeing a layer of tissue and then stretching the freed layer to fill a defect. This is the least complex type of flap and includes advancement flaps, rotation flaps, and transposition flaps, in order from least to most complex. With an advancement flap, incisions are extended out parallel from the wound, creating a rectangle with one edge remaining intact. This rectangle is freed from the deeper tissues and then stretched (or advanced) forward to cover the wound.
|
|
He is a member of the Phi Beta Kappa chapter at Bowdoin. He then received a PhD in Molecular Biology from Rockefeller University in 1982, where he worked with Peter Model and Norton Zinder on the genetics of the filamentous phage. He did his postdoctoral work at The Whitehead Institute of MIT as a Helen Hay Whitney Postdoctoral Fellow with Gerald Fink. Boeke is primarily known for his pioneering fundamental genetic and biochemical work on understanding the mechanisms of DNA transposition.
|
|
Conversion by IPP isomerase Isopentenyl-diphosphate delta isomerase type I (also known as IPP isomerase) is seen in cholesterol synthesis and in particular it catalyzes the conversion of isopentenyl diphosphate (IPP) to dimethylallyl diphosphate (DMAPP). In this isomerization reaction a stable carbon-carbon double bond is rearranged top create a highly electrophilic allylic isomer. IPP isomerase catalyzes this reaction by the stereoselective antarafacial transposition of a single proton. The double bond is protonated at C4 to form a tertiary carbocation intermediate at C3.
|
|
The flute d'amour is unsuitable for combination with an orchestra for two reasons. First, it is at a different pitch from the other instruments (though this could, of course, be solved through transposition). The main disadvantage, however, is its mellow, intimate tone quality, which tends to blend rather than contrast with string instruments. Orchestral music demands a level of uniformity and balance between instruments that we take for granted, but which was signally lacking at the beginning of the 18th century.
|
|
This most frequently includes marking string bowings, fixing bad page turns, adding and/or coordinating rehearsal figures, clarifying illegible notation and correcting errata. Editing of tempos, dynamics, articulations, inserts, and cuts or transposition into a singer's preferred vocal range or instrumentalist's preferred key may also be required. Additional proofreading may also be necessary, due to mistakes or inconsistencies in published editions. Once the parts have been prepared appropriately, the orchestra librarian will assemble concert folders or arrange part pick-up for the musicians.
|
|
Additionally LTR retrotransponsons are classified into five subfamilies: Ty1/copia, Ty3/gypsy, Bel/Pao, retroviruses and endogenous retroviruses. The LTR retrotransponsons require an RNA intermediate in their transposition cycle mechanism. Retrotransponsons synthesize a cDNA copy based on the RNA strand using a reverse transcriptase related to retroviral RT. The cDNA copy is then inserted into new genomic positions to form a retrogene. This mechanism has been proven to be important in gene evolution of rice and other grass species through exon shuffling.
|
|
It was loaded into the cassette buffer (memory area), which was overwritten whenever a program was loaded or saved using the Datassette. This caused difficulties if a cassette user had to resume work on a partially completed listing. A complicated method had to be used to get both the Proofreader and the program listing in memory at the same time. Also, the checksum method used was relatively rudimentary, and did not catch transposition errors, nor did it take whitespace into account.
|
|
Optimal cache-oblivious algorithms are known for matrix multiplication, matrix transposition, sorting, and several other problems. Some more general algorithms, such as Cooley–Tukey FFT, are optimally cache-oblivious under certain choices of parameters. Because these algorithms are only optimal in an asymptotic sense (ignoring constant factors), further machine-specific tuning may be required to obtain nearly optimal performance in an absolute sense. The goal of cache-oblivious algorithms is to reduce the amount of such tuning that is required.
|
|
In this work, Lewin applied group theory to music, investigating the basic concepts, interval and transposition, and extending them beyond their traditional application to pitch. Based on a powerful metaphor of musical space, this theory can be applied to pitch, rhythm and metre, or even timbre. Moreover, it can be applied to both tonal and atonal repertories . Lewin's writing on the relationship between text and music in song and opera involves composers from Mozart and Wagner, to Schoenberg and Babbitt.
|
|
Second, mitochondrial DNA integrated into animal nuclear genomes is primarily limited to animals with circular mitochondrial genomes without introns. NUMT studies are not available in animals with linear mitochondrial genomes or those with intron-containing mitochondria. Therefore, despite all the available advanced technologies, it remains to be determined whether NUMT transposition differences exist between circular and linear mtDNAs. Use of Sanger sequencing to locate NUMT insertion in the nuclear genome These difficulties to detect the presence of NUMT can be problematic.
|
|
In traditional Western notation, the scale used for a composition is usually indicated by a key signature at the beginning to designate the pitches that make up that scale. As the music progresses, the pitches used may change and introduce a different scale. Music can be transposed from one scale to another for various purposes, often to accommodate the range of a vocalist. Such transposition raises or lowers the overall pitch range, but preserves the intervallic relationships of the original scale.
|
|
Repetitive elements can accumulate in an organism's genome as the result of a few different transposition processes. The extent to which this has taken place during the evolution of eukaryotes varies greatly: repetitive DNA accounts for just 3% of the fly genome, but accounts for 50% of the human genome. There are different theories explaining the conservation of transposable elements. One holds that, like pseudogenes, they provide a source of new genetic material, allowing for faster adaptation to changes in the environment.
|
|
Janete Gaspar Machado, Romances brasileiros nos anos setenta. Universidade Federal de Santa Catarina, 1981, p. 92. Other critics, however, like the writer Silvano Santiago, maintained that Francis' apparent lack of stylish qualities simply meant that he, like many others, simply felt the imprint of the times: in the absence of open public debate, it was unavoidable that literature would assume a parajournalistic function aimed at a transposition of the real.Silvano Santiago & Ana Lucia Gazzola, The space in-between: essays on Latin American culture.
|
|
Transposition can be classified as either "autonomous" or "non-autonomous" in both Class I and Class II TEs. Autonomous TEs can move by themselves, whereas non-autonomous TEs require the presence of another TE to move. This is often because dependent TEs lack transposase (for Class II) or reverse transcriptase (for Class I). Activator element (Ac) is an example of an autonomous TE, and dissociation elements (Ds) is an example of a non- autonomous TE. Without Ac, Ds is not able to transpose.
|
|
For example, if it is important that a plug is inserted into a socket in a particular orientation, the socket and plug should be designed so that it is physically impossible to insert the plug incorrectly. Power sockets are often keyed in such a manner, to prevent the transposition of live and neutral. They are also recessed in the wall in a way that makes it impossible to touch connectors once they become live. Defensive design in software engineering is called defensive programming.
|
|
As of August 2020, European countries vary wildly in the amount of issued Blue Cards. Cyprus, Greece and Netherlands have not yet issues any cards, while Germany had issued 27,000, followed by France with 1,500. Even years after the transposition deadline passed, some Member States (such as Spain and Belgium) have yet to fully enact the law or give the rights fully promised in the directive. Already, think tanks have presented ideas designed to supplement the Blue Card and its weaknesses.
|
|
Two damaging de novo NAA15 mutations were reported by exome sequencing in parent- offspring trios with congenital heart disease. Patient 1 harbors a frameshift mutation (p. Lys335fs) and displays heterotaxy (dextrocardia, total anomalous pulmonary venous return, left superior vena cava, hypoplastic TV, double outlet right ventricle, hypoplastic RV, D-transposition of the great arteries, pulmonic stenosis) and hydronephrosis, asplenia, malrotation and abnormal neuro-development, the second patient harbors a nonsense mutation (p.S761X) and displays conotruncal defects (tetralogy of Fallot, single left coronary artery).
|
|
Colonies that underwent random transposition events were identified by BamHI digestion and Southern blotting using an internal IS1096 DNA probe. Colonies were screened for attenuated multiplication to identify colonies with mutations in candidate virulence genes. Mutations leading to an attenuated phenotype were mapped by amplification of adjacent regions to the IS1096 sequences and compared with the published M. tuberculosis genome. In this instance transposon mutagenesis identified 13 pathogenic loci in the M. tuberculosis genome which were not previously associated with disease.
|
|
Quarantine measures are implemented in areas where citrus canker is not endemic or has been obliterated to prevent the introduction of X. axonopodis. On the other hand, in regions where citrus canker occurs, Integrated Pest Management (IPM) is utilized. The most notable feature of this management program is the transposition of susceptible citrus plants to field resistant citrus cultivars. Apart from using resistant cultivars in fields, there are several measures that are taken to control citrus canker from causing failed crop.
|
|
The issuing of work permits in Belgium is partially governed by the transposition of EU law, especially the principle of free movement of labour, and partially by Belgium-specific regulations. There are three types of work permits for non-EU nationals: type C for students, relationship/family reasons and humanitarian reasons, type B for special categories of work (mostly in the context of training and posting of workers), and type A if you have repeatedly been granted a type B permit.
|
|
For this reason, the whole-tone scale is also maximally even and may be considered a generated collection. Due to this symmetry, the hexachord consisting of the whole-tone scale is not distinct under inversion or more than one transposition. Thus many composers have used one of the "almost whole-tone" hexachords, whose "individual structural differences can be seen to result only from a difference in the 'location', or placement, of a semitone within the otherwise whole-tone series."Schmalfeldt, Janet (1983).
|
|
After World War I and Alsace's return into France, the transposition of the French 1905-law about designation of origin forbade the use of the word Champagne. The distinction between both products came by Pierre Hussherr, an earlier manager of Wolfberger, who retrieved the term Crémant, then obsolete in Champagne. On 4 July 1975, a law allowed the word "Crémant" only for sparkling wines under AOC-rules. After that, Crémant de Loire and Crémant de Bourgogne were defined by decrees.
|
|
From his studies of the neumatic notation symbols of plainchant, Messiaen had formed the idea of exploring the rhythms corresponding to them. "In an interplay of transposition, the neumatic symbol as an indication of a sinuous melodic entity is now applied to a rhythmic motive. Each rhythmic neume is assigned a fixed dynamic and resonances of shimmering colours, more or less bright or somber, always contrasting" . The collage-like rhythmic structure grows from the iambic rhythm found at the beginning of the first strophe.
|
|
Horizontal gene transfer is common among bacteria, even among very distantly related ones. This process is thought to be a significant cause of increased drug resistance when one bacterial cell acquires resistance, and the resistance genes are transferred to other species. Transposition and horizontal gene transfer, along with strong natural selective forces have led to multi-drug resistant strains of S. aureus and many other pathogenic bacteria. Horizontal gene transfer also plays a role in the spread of virulence factors, such as exotoxins and exoenzymes, amongst bacteria.
|
|
Field, Mike, "Hopkins pioneered 'blue baby' surgery 50 years ago; 'I Remember ... Thinking It Was Impossible'", The Gazette, May 30, 1995 During his later years at Hopkins, Blalock continued his research on the heart and vascular surgery. With Edwards Park, he developed a bypass operation in 1944, and in 1948, with Rollins Hanlon, a cardiac surgeon, he created a technique for overcoming the transposition of the great blood vessels of the heart. By the 1950s, Blalock had performed over 1,000 surgeries to correct congenital heart defects.
|
|
The Synthex is an 8-voice analog synthesizer with 2 oscillators per note, separate envelope generators, and chorus. The use of stable DCOs (digitally controlled analog oscillators) and oscillator cross modulation of pulse width and a multimode filter made it unique in its time. Unusually, the Synthex also contained a built in real-time and step-time 4-track monophonic sequencer with real-time transposition. The four different sequencer tracks can have different length and sounds (Upper/Lower can be allocated to different tracks).
|
|
This procedure, a form of atrial switch, was developed and first performed by Senning in 1957 as a treatment for d-TGA (dextro-Transposition of the great arteries) before improvements in cardiopulmonary bypass made more curative surgical techniques feasible.Atrial Switch Operation: Past, Present, and Future. Konstantinov IE, Alexi-Meskishvili VV, Williams WG et al.Ann Thorac Surg 2004;77:2250 – 8 In this common congenital heart defect, the venous circulation drains into the right ventricle but from this chamber, blood is directed towards the systemic circulation through the aorta.
|
|
After one and a half orbits, the S-IVB third-stage engine pushed the spacecraft onto its trajectory toward the Moon. About thirty minutes later, the transposition, docking, and extraction maneuver was performed: this involved separating the command module Columbia from the spent S-IVB stage, turning around, and docking with lunar module Eagle. After the lunar module was extracted, the combined spacecraft headed for the Moon, while the rocket stage flew on a trajectory past the Moon. Lunar Module Eagle are reflected in his visor.
|
|
In these latter tunings, using electronic transposition could keep the current key's notes centered on the isomorphic keyboard, in which case these wolf intervals would very rarely be encountered in tonal music, despite modulation to exotic keys. A keyboard that is isomorphic with the syntonic temperament, such as Wicki's keyboard above, retains its isomorphism in any tuning within the tuning continuum of the syntonic temperament, even when changing tuning dynamically among such tunings. Figure 2 shows the valid tuning range of the syntonic temperament.
|
|
When the Moon, Earth, and vehicle were in the optimum geometrical configuration, the third stage was reignited to put the vehicle into a translunar orbit. For Apollo 15, for example, this burn lasted 5 minutes 55 seconds. After translunar injection came the maneuver called transposition, docking, and extraction. This was under crew control, but the IU held the S-IVB/IU vehicle steady while the Command/Service Module (CSM) first separated from the vehicle, rotated 180 degrees, and returned to dock with the Lunar Module (LM).
|
|
Tcherepnin invented his own harmonic languages. The most famous of his synthetic scales, derived by combining minor and major hexachords, has nine notes and consists of three conjunct semitone-tone-semitone tetrachords. This came to be known as the "Tcherepnin scale" (Slonimsky 1968, 19–20), and may be classified with Messiaen's modes of limited transposition. He also worked with pentatonic scales, old Russian modal tunes, Georgian harmonies, and a nine-note "chromatic perfect" scale built upon half-step and step-and-a-half intervals.
|
|
It also introduced the fundamental concept of "reduction" and "balancing" (which the term al-jabr originally referred to), the transposition of subtracted terms to the other side of an equation, i.e. the cancellation of like terms on opposite sides of the equation. Mathematics historian Victor J. Katz regards Al-Jabr as the first true algebra text that is still extant. Translated into Latin by Robert of Chester in 1145, it was used until the sixteenth century as the principal mathematical textbook of European universities.
|
|
The transposase will bind to the terminal inverted repeats of the transposon and mediate synapsis of the transposon ends. The transposase enzyme then disconnects the element from the flanking DNA of the original donor site and mediates the joining reaction that links the transposon to the new insertion site. The addition of the new DNA into the target site causes short gaps on either side of the inserted segment. Host systems repair these gaps resulting in the target sequence duplication (TSD) that are characteristic of transposition.
|
|
This conversion ratio is often built into the quick change gearboxes. The precise ratio required to convert a lathe with an Imperial (inch) leadscrew to metric (millimeter) threading is 100 / 127 = 0.7874... . The best approximation with the fewest total teeth is very often 37 / 47 = 0.7872... . This transposition gives a constant -0.020 percent error over all customary and model-maker's metric pitches (0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.60, 0.70, 0.75, 0.80, 1.00, 1.25, 1.50, 1.75, 2.00, 2.50, 3.00, 3.50, 4.00, 4.50, 5.00, 5.50 and 6.00 mm).
|
|
In addition to being a writer and an authority on the music of the Broadway stage, Rudetsky is also an accomplished musician. Having majored in Piano Performance at Oberlin, he has gone on to perform in a variety of shows, including accompanying Patti LuPone in concert, where he also demonstrated a talent for on-sight transposition. In addition, Rudetsky has also displayed a skill for conducting, leading the orchestra for the November 30, 2007 special performance "Light the Lights--Broadway is Back" end-of-the-strike celebration.
|
|
In 1894, Will Harben published "Land of the Changing Sun," a dystopian fantasy set at the center of the earth. In Harben's tale, the earth's core is populated by a scientifically advanced civilization, living beneath the glow of a mechanical sun. Mark Twain explored themes of science in his novel A Connecticut Yankee in King Arthur's Court. By means of "transmigration of souls", "transposition of epochs – and bodies" Twain's Yankee is transported back in time and his knowledge of 19th-century technology with him.
|
|
Individuals affected by Carpenter syndrome often experience cutaneous syndactyly (fusion of the digits) or polydactyly (presence of extra digits) of the toes more often than fingers. Individuals also have short fingers. Approximately one third of individuals born with Carpenter Syndrome have a type of heart defect. Commonly seen heart defects may include: narrowing of the pulmonary artery, transposition of the major blood vessels, or the presence of an abnormally large vena cava, which delivers blood back to the heart from the head, neck, and upper limbs.
|
|
Micropia is the name of a family of LTR retrotransposons widespread in the genomes of fruitflies of the genus Drosophila[1, 2]. Micropia retrotransposons in some species of Drosophila express a male germline-specific and meiotic- specific antisense transcript complementary to the reverse transcriptase (RT) and ribonuclease A (RNaseA) genes of the proviral retrotransposon.[3] No active transposition of micropia has been registered so far. micropia is likely part of a selfish driver system responsible for the Drosophila Y chromosomal lampbrushloop evolution in some species.
|
|
" It concludes once again with the hook line, after which there is a repetition of the second verse. According to Harrison, "The competition between E and A for tonic control is made clear during the break between verse 2 and the recapitulation of verse 1 lyrics. ... the allusion to the harmonic structure of the verse is made subtle both by the transposition and by different melodic activity. Only when the music of the now A-major refrain is encountered do the voices return to their familiar words.
|
|
She was recognized as among the best in the field, awarded prestigious fellowships, and elected a member of the National Academy of Sciences in 1944. During the 1940s and 1950s, McClintock discovered transposition and used it to demonstrate that genes are responsible for turning physical characteristics on and off. She developed theories to explain the suppression and expression of genetic information from one generation of maize plants to the next. Due to skepticism of her research and its implications, she stopped publishing her data in 1953.
|
|
The Finale is in two symmetrical sections, like the second movement. However, the movement differs from the second movement in the absence of unusual chromaticism, and in the second section being an exact transposition of the first (except for some changes of octave register). A repeat sign is written for the first section: if one adheres meticulously to the score, the movement consists of three lengthy, almost identical repeats of the same musical material. Performers sometimes choose to omit the repeat of the first section when playing.
|
|
These had much smaller engine bells, and would lie within the Service Module instead of extending out the end into the SLA area. This also provided redundancy in the case of a single-engine failure. These engines were responsible for both course correction during the flight as well as the braking burn for Earth re-entry. Unlike the Apollo lunar missions, the CSM would perform its transposition and docking maneuver with the S-IVB stage before the burn to leave Earth orbit rather than after.
|
|
That trick allowed Painvin to guess which columns consisted of "side" letters and which columns consisted of "top" letters. He could then pair them up and perform a frequency analysis on the pairings to see if the pairings were only noise or corresponding to plaintext letters. Once he had the proper pairings, he could then use frequency analysis to figure out the actual plaintext letters. The result was still transposed, but to unscramble a simple transposition was all that he still had to do.
|
|
Together they develop and implement a project that targets the transposition, enforcement and implementation of a specific part of the acquis communautaire. The main distinct feature of the Twinning project is direct exchange of specific national experience in EU legislation implementation. Not similar to other technical assistance, a Twinning project is that it sets out to deliver specific and guaranteed results and not to foster general cooperation. The parties agree in advance on a detailed work programme to meet an objective concerning priority areas of the acquis.
|
|
During rehearsals, the conductor may stop the playing of a piece to request changes in the phrasing or request a change in the timbre of a certain section. In amateur orchestras, the rehearsals are often stopped to draw the musicians' attentions to performance errors or transposition mistakes. Conducting requires an understanding of the elements of musical expression (tempo, dynamics, articulation) and the ability to communicate them effectively to an ensemble. The ability to communicate nuances of phrasing and expression through gestures is also beneficial.
|
|
Only movements 4 and 6 are free poetry, with the hymn tune sounding again instrumentally during movement 6. Due to its text structure, the Bach scholar Christoph Wolff dates the work to around 1710. The oldest (and also the only) manuscript was written in 1762, after Bach's death. The provenance of the cantata is disputed: some suggest that it may not be a Bach work because of its "unpretentious" nature and the lack of authoritative original music, or perhaps it was a transposition of an earlier work.
|
|
Also, ESCC patients with high Pitx2 expression did not respond as well to definitive chemoradiotherapy (CRT) compared to ESCC patients with low Pitx2 expression. Thus, physicians may be able to use Pitx2 expression to predict how ESCC patients will respond to cancer treatment. In Congenital Heart Disease, heterozygous mutations in Pitx2 have been involved in the development of Tetralogy of Fallot, ventricular septal defects, atrial septal defects, transposition of great arteries, and endocardial cushion defect (ECD). The mutations of the Pitx2 gene are created through alternative splicing.
|
|
A bacterial DNA transposon A transposable element (TE, transposon, or jumping gene) is a DNA sequence that can change its position within a genome, sometimes creating or reversing mutations and altering the cell's genetic identity and genome size. Transposition often results in duplication of the same genetic material. Barbara McClintock's discovery of them earned her a Nobel Prize in 1983. Transposable elements make up a large fraction of the genome and are responsible for much of the mass of DNA in a eukaryotic cell.
|
|
The village contains the historic Church of All Saints and some preserved 17th-century almshouses. The Christopher Saxton map of Warwickshire (1637 edition) includes a curious transposition: Leamington Hastings appears as Lemington priors, and what is now called Leamington Spa, or Royal Leamington Spa, appears as Lemington hastings. The first mention of a post office in Leamington Hastings was in September 1845, when a type of postmark known as an undated circular handstamp was issued.The Undated Circular Marks of the Midland Counties, p. 150.
|
|
" On Thursday, May 8, 1952, Ussachevsky presented several demonstrations of tape music/effects that he created at his Composers Forum, in the McMillin Theatre at Columbia University. These included Transposition, Reverberation, Experiment, Composition, and Underwater Valse. In an interview, he stated: "I presented a few examples of my discovery in a public concert in New York together with other compositions I had written for conventional instruments." Otto Luening, who had attended this concert, remarked: "The equipment at his disposal consisted of an Ampex tape recorder . . .
|
|
A transpositional pun is a complicated pun format with two aspects. It involves transposing the words in a well-known phrase or saying to get a daffynition-like clever redefinition of a well-known word unrelated to the original phrase. The redefinition is thus the first aspect, the transposition the second aspect. As a result, transpositional puns are considered among the most difficult to create, and commonly the most challenging to comprehend, particularly for non-native speakers of the language in which they're given (most commonly English).
|
|
Samyama, as Patanjali's Yoga Sutras states, engenders prajñā. Adi Yoga or Mahasandhi discusses the 'mūla prajñā' of "listening/studying, investigation/contemplation, realization/meditation" which are a transposition of the triune of Samyama. These are activated subconsciously in non-structured form (thus producing fragmented spontaneous Samyama-like effects) by any thinking activity or contemplative absorption (particularly the Catuskoti and Koan) and deep levels of trance. Any kind of intuitive thinking at its various stages of expression is strongly related to Samyama-like phenomena as well.
|
|
The Elizabethan spymaster Sir Francis Walsingham (1530–1590) is reported to have used a "trellis" to conceal the letters of a plaintext in communication with his agents. However, he generally preferred the combined code-cipher method known as a nomenclator, which was the practical state-of-the-art in his day. The trellis was described as a device with spaces that was reversible. It appears to have been a transposition tool that produced something much like the Rail fence cipher and resembled a chess board.
|
|
Conjunto São Mateus (GO-011) is a complex of caves measuring 20500 meters long and considered until recently as the largest in Brazil, being replaced by the Toca da Boa Vista. It is located inside Terra Ronca State Park, in the speleologic district of São Domingos, State of Goiás. It is one of the richest in speleothems including the famous "Hall of the Pearls", where visitors should go barefoot to avoid the transposition of sediment. It houses the typical fauna of the caves, including the blind catfish.
|
|
The background strongly resembles that of H. Beam Piper's Paratime series and Keith Laumer's Imperium Series. One tribute paid to Piper's series is the names of the inventors of temporal transposition: Ghaldron and Hesthor in Piper, Galbraith and Hester in Turtledove. In all of the series the "home timeline" was running low on resources, and it has used its knowledge of time to covertly import supplies from other Earths and save their civilization from collapse. The most important difference is the nature of the home timeline.
|
|
Another standard pitch, the so-called Baroque pitch, has been set in the 20th century as A = 415 Hz—approximately an equal-tempered semitone lower than A440 to facilitate transposition. Transposing instruments have their origin in the variety of pitch standards. In modern times, they conventionally have their parts transposed into different keys from voices and other instruments (and even from each other). As a result, musicians need a way to refer to a particular pitch in an unambiguous manner when talking to each other.
|
|
To supervise Paratime, the Paratime Commission exists; to enforce the Paratime Code, the Paratime Police exists. There is only one law that is totally inviolate: no one from outside the Home Timeline civilization must ever know about paratime travel. The Paratime Transposition Code sets out legal penalties for this, as well as other crimes involving paratime, such as kidnapping and enslavement. Paratime Police officers are authorized to use extrajudiciary means, such as assassination, of both Home Time residents or outtimes, to protect the secret if necessary.
|
|
They included the first harpsichords with two keyboards, used for transposition. The Flemish instruments served as the model for 18th-century harpsichord construction in other nations. In France, the double keyboards were adapted to control different choirs of strings, making a more musically flexible instrument. Instruments from the peak of the French tradition, by makers such as the Blanchet family and Pascal Taskin, are among the most widely admired of all harpsichords, and are frequently used as models for the construction of modern instruments.
|
|
Manuel Chrysaphes separated the level of metrophonia by the formal function of a changing disposition, which allowed always to find a kyrios in the upper pentachord, if the phthongos was plagios, or a plagios in the lower pentachord, if the phthongos was kyrios. But plagios and kyrios on the level of metrophonia were only defined by the direction from which singers arrived at a certain phthongos. As a degree of a certain mode or echos like kyrios and plagios the psaltes left the level of parallage and metrophonia, and entered the level of a melos defined by one echos and one of the peripheral wheels, and on this level the tritos was always the octave on B flat or F, while the octave of B natural is always a devteros octave which can be reached by a transposition (μεταβολή κατὰ τόνον) which turns the protos on D into a tetartos and looks from there for its mesos on B natural. Such a transposition will cause a transition within the central wheel, which turns the phthongos of protos (α') on the top of the outer ring into the tetartos (δ') in the second ring.
|
|
A mainly tonal work (a trait of earlier works that he progressively abandoned decades later), it is in F-sharp major, Messiaen's favorite tonality. As in Le banquet céleste, this tonality expresses the mystical experience of "superhuman love". However, some scholars have attempted to dispute the tonal aspect of the work and have offered different explanations to why Messiaen used a system that he later came to call "modes of limited transposition". Even though it is one of the composer's best-known works, he noted later that it was not representative of his compositional style.
|
|
In chess, a transposition is a sequence of moves that results in a position which may also be reached by another, more common sequence of moves. Transpositions are particularly common in the opening, where a given position may be reached by different sequences of moves. Players sometimes use transpositions deliberately, to avoid variations they dislike, lure opponents into unfamiliar or uncomfortable territory or simply to worry opponents. See review at In chess the verb "transpose" means to shift the game onto a different opening track from which it started.
|
|
Transposition example from KochSchuijer, Michiel (2008). Analyzing Atonal Music, p.52-54. . . The melody on the first line is in the key of D, while the melody on the second line is identical except that it is major third lower, in the key of B. In music, a transformation consists of any operation or process that may apply to a musical variable (usually a set or tone row in twelve tone music, or a melody or chord progression in tonal music), or rhythm in composition, performance, or analysis. Transformations include multiplication, rotation, permutation (i.e.
|
|
The work has two movements: #Allegro (a solo-piano transcription of the second movement of the violin sonata, K. 547) #Allegretto (a transposition of the finale to the C major "Sonata Facile" into F major) The set of six keyboard variations on an original Andante, K. 54/547b are sometimes played as an additional third movement to this piece. These variations are themselves also transcribed from the same violin sonata (K. 547) as the Allegro with its fourth variation (which was violin-centric in the original) re-written.Zaslaw, Neal, with Cowdery, William eds.
|
|
In traditional logic the reasoning process of transposition as a rule of inference is applied to categorical propositions through contraposition and obversion,Stebbing, 1961, pp. 65–66. For reference to the initial step of contraposition as obversion and conversion, see Copi, 1953, p. 141. a series of immediate inferences where the rule of obversion is first applied to the original categorical proposition "All S is P"; yielding the obverse "No S is non-P". In the obversion of the original proposition to an 'E' type proposition, both terms become distributed.
|
|
The Academy's Lucky Bag yearbook for 1917 described him as "a fellow with the map of a big heart written all over his face". Clarke played on the varsity football team, rowed crew, and was elected Regimental Staff Petty Officer of the class of 1917 (one of the six officers of the class). His Navy colleagues frequently called him "WOP", a transposition of his initials. In 1923, Clarke received an M.S. degree from MIT, co-authoring a dissertation entitled "Effect of Roll of Ship on Fall of Shot When Using Director Fire".
|
|
Examples of these two categories of use for data efficiency (managerial and technical) can be found in process industries and computer chip research and development: 1.Traditional water/wastewater management procedures include travel to pump stations, reading and hand recording of meter numbers, transposition of log sheets, and other manual operations. This whole process can be said to have low data efficiency4. 2.In the design of today’s Dynamic Random Access Memory (DRAM) computer chips, R&D; optimizes parameters such as row and column access times, chip area usage, burst length and row granularity.
|
|
One of Marks's first challenges was to phase out double transposition ciphers using keys based on poems. These poem ciphers had the limited advantage of being easy to memorise, but significant disadvantages, including limited cryptographic security, substantial minimum message sizes (short ones were easy to crack), and the fact that the method's complexity caused encoding errors. Cryptographic security was enhanced by Marks's innovations, especially "worked-out keys". He was credited with inventing the letter one-time pad, but while he did independently discover the method, he later found it already in use at Bletchley.
|
|
Chest X-ray of the same patient as the picture above. A small crescent of air can be seen under the right part of the diaphragm, caused by Chilaiditi's sign. However, it could easily be mistaken for free intra-abdominal air (pneumoperitoneum) which could mistakenly be attributed to bowel perforation. Chilaiditi syndrome is a rare condition when pain occurs due to transposition of a loop of large intestine (usually transverse colon) in between the diaphragm and the liver, visible on plain abdominal X-ray or chest X-ray.
|
|
Therefore, Caleb (or Calev as pronounced in Hebrew) would actually mean "whole hearted". This might be due to the Biblical Caleb, a companion of Moses and Joshua, being noted for his astute powers of observation and fearlessness in the face of overwhelming odds. Another plausible origin is a transposition of a name found in other ancient Semitic languages such as Phoenician and Ugaritic, meaning "servant of the Lord". The early Medieval King Kaleb of Axum was the most well-known monarch of this kingdom (in modern Ethiopia and Eritrea).
|
|
The list of ciphers in this work included both substitution and transposition, and for the first time, a cipher with multiple substitutions for each plaintext letter (later called homophonic substitution). Also traced to Ibn al-Durayhim is an exposition on and a worked example of cryptanalysis, including the use of tables of letter frequencies and sets of letters which cannot occur together in one word. The earliest example of the homophonic substitution cipher is the one used by Duke of Mantua in the early 1400s.David Salamon Coding for Data and Computer Communications.
|
|
There were two models, the R30 and R40, running at 30 MHz and 40 MHz respectively, and having 512 KB and 1 MB of transposition tables, respectively. The units were in small boxes about the size of a chess clock, which attached via a serial cable to a wooden sensory board called the SmartBoard. They were only sold with The King chess engine. This was the end of the era of strong dedicated chess computers, and these two models are acknowledged as the strongest dedicated chess computers that were ever sold.
|
|
Throughout the 1930s and 1940s, Raymond Burrows, a professor at Columbia University Teachers College, pioneered collegiate group piano instruction using piano labs. By 1952, Burrows calculated that 256 universities in the United States provided group piano classes. These courses were designed to provide music majors with functional keyboard skills that would aid them in their musical careers; these classes focused on harmonization, transposition, and sight-reading. Because most university piano teachers were more familiar with the individual/private lesson format, universities began to offer courses in teaching group piano.
|
|
If the bitstrings are long enough, different board positions will almost certainly hash to different values; however longer bitstrings require proportionally more computer resources to manipulate. The most commonly used bitstring (key) length is 64 bits. Many game engines store only the hash values in the transposition table, omitting the position information itself entirely to reduce memory usage, and assuming that hash collisions will not occur, or will not greatly influence the results of the table if they do. Zobrist hashing is the first known instance of tabulation hashing.
|
|
To provide legal continuity, it enables the transposition of directly- applicable already-existing EU law into UK law, and so "create a new category of domestic law for the United Kingdom: retained EU law". It will also give the government some restricted power to adapt and remove laws that are no longer relevant. It makes future ratification of the withdrawal agreement, as a treaty between the UK and EU, depend upon the prior enactment of another Act of Parliament to approve the final terms of withdrawal when Brexit negotiations are completed.
|
|
In general population, the incidence of isolated levocardia is 1: 22,000; in all patients with congenital heart disease, the incidence is from 0.4% to 1.2%. There are extensive cases reporting that children and adults with isolated levocardia have complex cardiac defects, and neonate or infant with isolated levocardia may be complicated by bowel obstruction and cardiac anomalies. It is estimated that up to 95% of cases of isolated levocardia have associated cardiac deformities like right ventricular outflow tract (RVOT) obstruction, septal defects, inversion of cardiac chambers and transposition of cardiac chambers.
|
|
In economic terms, agricultural products, and especially the fresh produce for the vast nearby market of İzmir, occupy a prominent place in Urla's economy, with fish, poultry and flowers standing out. An international Artichoke Festival is celebrated since 2015 The name "Urla" is derived from the Greek Βουρλά ("Vourla") meaning marshlands and the town was cited as such in western sources until the 20th century. Bryela (Byzantine name meaning Woman of God i.e. Holy Maria) whereas it has been suggested that due to the transposition of vowels Bryela has become Vourla, meaning marshlands.
|
|
The poem code is a simple, and insecure, cryptographic method which was used during World War II by the British Special Operations Executive (SOE) to communicate with their agents in Nazi-occupied Europe. The method works by the sender and receiver pre-arranging a poem to use. The sender chooses a set number of words at random from the poem and gives each letter in the chosen words a number. The numbers are then used as a key for a transposition cipher to conceal the plaintext of the message.
|
|
If it has, the solution is taken from the table instead of calculated, saving large amounts of time. However, in parallel computing, this approach has a serious drawback. To make full use of the advantages of transposition lookups, all computers in the network have to communicate their solutions to the other computers one way or the other, or you run the risk of redundantly solving some positions. This incurs a severe communication overhead, meaning that a lot of all computers' time is spent communicating with the others instead of solving the problem.
|
|
The pursuit of a local nymph by an Olympian god, part of the archaic adjustment of religious cult in Greece, was given an arch anecdotal turn in the MetamorphosesOvid, Metamorphoses i. 452; the treatment is commonly viewed as an Ovidian invention: see H. Fränkel, Ovid: A Poet Between Two Worlds (1945), p. 79, or E. Doblhofer, "Ovidius Urbanus: eine Studie zum Humor in Ovids Metamorphosen" Philologus 104 (1960), p. 79ff; for the episode as a witty transposition of Calvus' Io, see B. Otis, Ovid as an Epic Poet, 2nd ed.
|
|
In these latter tunings, using electronic transposition could keep the current key's notes on the isomorphic keyboard's white buttons, such that these wolf intervals would very rarely be encountered in tonal music, despite modulation to exotic keys. Isomorphic keyboards expose the invariant properties of the meantone tunings of the syntonic temperament isomorphically (that is, for example, by exposing a given interval with a single consistent inter-button shape in every octave, key, and tuning) because both the isomorphic keyboard and temperament are two- dimensional (i.e., rank-2) entities (Milne, 2007).
|
|
Cesereanu's other Partly expanding on her earlier themes, the pieces were defined by Cernat as "exercises in virtuosity", and noted for their "imaginative exuberance". However, the critic objected to their "inkhorn" and "didactic" aspects, raising concern that the author's tendency to "reveal the conventions of her own narratives" echoed "pedantry". Early in the 2000s, Ruxandra Cesereanu took a more experimental approach to poetry, theorizing a style for which she coined the term delirionism (from "delirium"). According to her own definition, it implies "the transposition of a semi-psychedelic trance into poetry".
|
|
To a large degree European Union environmental policy is based on directives which are only minimum requirements and allow for adaptation to the regulatory requirements and systems of the European member states. Thus, the transposition may differ slightly country by country around Europe. Once a given member state had written its national law, it notifies its regulation with the EU Commission. If a member state violates the provisions in its national transcription, the EU Commission is asking the authorities in the given member state to make the necessary changes.
|
|
Lemaitre obtained a PhD in genetics from the Université Pierre-et-Marie-Curie in 1992, defending a thesis on the regulation of P element transposition in Drosophila. He then pursued postdoctoral work in the laboratory of Jules Hoffmann, where he identified Toll-like receptors as essential mediators of innate immunity in Drosophila. In 1998, he was appointed group leader at the Molecular Genetics Center of the French National Center for Scientific Research in Gif-sur-Yvette. He moved to EPFL in 2007 as a full professor within the Global Health Institute.
|
|
In 1999, the band released the concept album EXIT with Marco Balbo (guitar), Marioluca Bariona (keyboards) and Andrea Biancheri (vocals). In 2002, the Museo accepted the offer from the Finnish magazine "Colossus" to participate to the transposition in rock music of the poem Kalevala. The same band members from the album Exit with a new member, Andrea Pavan (bass), recorded the short suite "Fiore di vendetta". In 2012, Moreno and Golzi were joined by Galifi, singer of the 1970s' band, guitarists Max Borelli and Sandro Libra, and keyboardist Fabio Meggetto.
|
|
The second is in G minor and undergoes a transformation such that it resembles a Czech polka. The exposition's closing theme in G major is known for being similar to the African-American spiritual "Swing Low, Sweet Chariot". The development primarily focuses on the main and closing themes, and the recapitulation consists of a repetition of the main theme as well as a transposition of the second and closing themes up a semitone. The movement is concluded with a coda, with the main theme stated by the brass above an orchestral tutti.
|
|
This conjecture was later proved by Rivest. McCabe also noted that with either the transposition or MTF heuristic, the optimal ordering of records would be approached even if the heuristic was only applied every Nth access, and that a value of N might be chosen that would reflect the relative cost of relocating records with the value of approaching the optimal ordering more quickly. Further improvements were made, and algorithms suggested by researchers including: Rivest, Tenenbaum and Nemes, Knuth, and Bentley and McGeoch (e.g. Worst-case analyses for self- organizing sequential search heuristics).
|
|
Genesis of a Music: An Account of a Creative Work, Its Roots, and Its Fulfillments, p.89-90. . The minor key and scale are also considered less justifiable than the major, with Paul Hindemith calling it a "clouding" of major, and Moritz Hauptmann calling it a "falsehood of the major". Changes of mode, which involve the alteration of the third, and mode mixture are often analyzed as minor changes unless structurally supported because the root and overall key and tonality remain unchanged. This is in contrast with, for instance, transposition.
|
|
On March 2, 2012, a video was posted to her brother, Jake Newton's YouTube channel of the two singing a song cover of Whitney Houston's "I Wanna Dance With Somebody". Newton was born with several congenital heart defects, including a ventricular septal defect, an atrial septal defect, transposition of the great vessels, and pulmonic stenosis. She has undergone 4 open heart surgeries between the ages of 14 days and 13 years old. Due to this, Newton has often said that she is an advocate of people donating organs.
|
|
The concepts of musical set theory are very general and can be applied to tonal and atonal styles in any equal temperament tuning system, and to some extent more generally than that. One branch of musical set theory deals with collections (sets and permutations) of pitches and pitch classes (pitch-class set theory), which may be ordered or unordered, and can be related by musical operations such as transposition, melodic inversion, and complementation. Some theorists apply the methods of musical set theory to the analysis of rhythm as well.
|
|
The number of distinct operations in a system that map a set into itself is the set's degree of symmetry . The degree of symmetry, "specifies the number of operations that preserve the unordered pcsets of a partition; it tells the extent to which that partition's pitch- class sets map into (or onto) each other under transposition or inversion". Every set has at least one symmetry, as it maps onto itself under the identity operation T . Transpositionally symmetric sets map onto themselves for T where does not equal 0 (mod 12).
|
|
Inversionally symmetric sets map onto themselves under TI. For any given T/TI type all sets have the same degree of symmetry. The number of distinct sets in a type is 24 (the total number of operations, transposition and inversion, for n = 0 through 11) divided by the degree of symmetry of T/TI type. Transpositionally symmetrical sets either divide the octave evenly, or can be written as the union of equally sized sets that themselves divide the octave evenly. Inversionally symmetrical chords are invariant under reflections in pitch class space.
|
|
But the replication of strings is trivial in artificial evolutionary systems, where only an instruction to copy strings is required to pass all the information in the genome from generation to generation. The replication of the selected programs is a fundamental piece of all artificial evolutionary systems, but for evolution to occur it needs to be implemented not with the usual precision of a copy instruction, but rather with a few errors thrown in. Indeed, genetic diversity is created with genetic operators such as mutation, recombination, transposition, inversion, and many others.
|
|
Because DNA transposition events are inherently mutagenic, the low activity of transposases is necessary to reduce the risk of causing a fatal mutation in the host, and thus eliminating the transposable element. One of the reasons Tn5 is so unreactive is because the N- and C-termini are located in relatively close proximity to one another and tend to inhibit each other. This was elucidated by the characterization of several mutations which resulted in hyperactive forms of transposases. One such mutation, L372P, is a mutation of amino acid 372 in the Tn5 transposase.
|
|
This amino acid is generally a leucine residue in the middle of an alpha helix. When this leucine is replaced with a proline residue the alpha helix is broken, introducing a conformational change to the C-Terminal domain, separating it from the N-Terminal domain enough to promote higher activity of the protein. The transposition of a transposon often needs only three pieces: the transposon, the transposase enzyme, and the target DNA for the insertion of the transposon. This is the case with Tn5, which uses a cut-and-paste mechanism for moving around transposons.
|
|
Companion products to capella provide Music OCR (Capella Scan, which uses the FineReader engine from the Russian company ABBYY to recognize text, including Gothic letters), music recognition out of audio files (Capella Wave Kit), music teaching and training (rondo, audite!), composition aids (tonica fugata, with automatic composition of polyphonic sets, canons, and fugues), and production of accompaniment music files or CDs for karaoke-like uses for amateurs and professionals (Capella Playalong). ;capella-scan Convert scanned sheet music into a capella score for editing. including transposition. ;capella melody trainer Personal trainer for singers and instrumentalists.
|
|
Then the "Lyricon II" was engineered, which included a two-oscillator synthesizer. All the Lyricons used the same saxophone style fingering system, with two octave keys above the left-hand thumb rest. The Wind Synthesizer Driver and the Lyricon II also had a transposition footswitch feature, where a foot pedal could be used to transpose the entire range up or down one octave. None of the Lyricons were engineered to use MIDI (which was invented after Computone went out of business in 1980), although external MIDIfication modules were produced by JL Cooper and STEIM.
|
|
Consider the intervals of the major scale: tone, tone, semitone, tone, tone, tone, semitone. Starting the scale on a different degree will always create a new mode with individual interval layouts—for example starting on the second degree of a major scale gives the "Dorian mode"—tone, semitone, tone, tone, tone, semitone, tone. This is not so of the modes of limited transposition, which can be modally shifted only a limited number of times. For example, mode 1, the whole tone scale, contains the intervals tone, tone, tone, tone, tone, tone.
|
|
A review and meta-analysis showed that paracetamol may be effective for closure of a PDA in preterm infants. A recent network meta-analysis that compared indomethacin, paracetamol and ibuprofen at different doses and administration schemes among them found that a high dose of oral ibuprofen may offer the highest likelihood of closure in preterm infants. While indomethacin can be used to close a PDA, some neonates require their PDA be kept open. Keeping a ductus arteriosus patent is indicated in neonates born with concurrent heart malformations, such as transposition of the great arteries.
|
|
Inserted into the wall is a Gothic inscription. It is likely that intervention of Coimbra sandstone marks the importance of this temple for Art History: the phenomenon that developed from the dispersion of Coimbra's influence into the Romanesque churches can be seen the similarities to buildings such as the Sé and Church of Santiago. The themes used to decorate the capitals reveal a transposition of Coimbran models, such as the use of carved birds, lions, while the tympanum, Agnus Dei and vegetable decoration continue many of the similar treatments.Manuel Luís Real (1986), vol.
|
|
The truncus arteriosus and the adjacent bulbus cordis partition by means of cells from the neural crest. Once the cells from the truncal ridge meet with the cells from the bulbar ridge they twist around each other in a spiral orientation as they fuse and form the aorticopulmonary septum. This will end dividing the aorta from the pulmonary trunk. Defects in this process is known as aortopulmonary septal defect, and causes persistent truncus arteriosus, unequal division of the truncus arteriosus, transposition of the great arteries, aortic and pulmonary valve stenosis or tetralogy of fallot.
|
|
Almirante Oquendo sometime between 1893 and 1898. Laid down in January 1889, launched in 1891, and completed in 1893,The Spanish–American War Centennial Web Site: Almirante Oquendo; and Conway's All The World's Fighting Ships 1860–1905, p. 382; the former reports the launch date as 10 April 1898, the latter as 4 October 1891, apparently because of transposition of the numerals representing the month and year, making it impossible to identify correct date. was in Havana, Cuba, when war with the United States became likely in the spring of 1898.
|
|
With the invention of motorised mechanical kilns, traditional smokers began referring to their product as "smoked" to emphasise that their process was entirely dependent on the smoke produced from the natural smouldering wood.Rodrigo Tarté, Ingredients in Meat Products, Properties, Functionality and Applications, Springer, 2008, p. 216. By contrast, mechanical kilns developed various methods using automatic smoke generators. The most common method of mechanical smoking involves the use of smoke condensates, smoke distilled and transported to the factory in liquid or solid form before the industrial transposition of the condensate back into a gaseous substance.
|
|
During this period its main functions were associated with the formation and conduct of the Bulgarian pre-accession politics. The committee's key responsibility was the examination of the relevant legislation proposals with the EU legislation, which assisted the government along the transposition of the significantly vast acquis communautaire. The chairperson at that time was Daniel Valchev. Within the 40th National Assembly, after the accession of Bulgaria to the European Union on 1 January 2007, the focus of the committee's activity was shifted towards the decision-making process on a European level.
|
|
In a columnar transposition, the message is written out in rows of a fixed length, and then read out again column by column, and the columns are chosen in some scrambled order. Both the width of the rows and the permutation of the columns are usually defined by a keyword. For example, the keyword `ZEBRAS` is of length 6 (so the rows are of length 6), and the permutation is defined by the alphabetical order of the letters in the keyword. In this case, the order would be "6 3 2 4 1 5".
|
|
Transposase regulates and catalyzes the excision of a P element from the host DNA, cutting at the two recognition sites, and then reinserting randomly. It is the random insertion that may interfere with existing genes, or carry an additional gene, that can be used for genetic research. To use this as a useful and controllable genetic tool, the two parts of the P element must be separated to prevent uncontrolled transposition. The normal genetic tools are DNA coding for transposase with no transposase recognition sequences so it cannot insert and a "P Plasmid".
|
|
Pontarlier occupies the ancient Roman station of Ariolica, in Gallia and is placed in the Tables on the road from Urba (modern Orbe, Canton Vaud, Switzerland), to Vesontio (modern Besançon). Although the distances in the Antonine Itinerary do not agree with the real distances, French geographer D'Anville recognized a transposition of the numbers. The Theodosian Tabula names the place "Abrolica", which William Smith states as a possible error of transcription. After the Burgundian invasion in the 5th century, Pontarlier became an unavoidable way of trade from the kingdom of Burgundy to Switzerland, Germany or Lombardy.
|
|
For Bourdieu, habitus and field can only exist in relation to each other. Although a field is constituted by the various social agents participating in it (and thus their habitus), a habitus, in effect, represents the transposition of objective structures of the field into the subjective structures of action and thought of the agent. The relationship between habitus and field is twofold. First, the field exists only insofar as social agents possess the dispositions and set of perceptual schemata that are necessary to constitute that field and imbue it with meaning.
|
|
The purpose was to let Franz study at the famous Conservatoire de Paris, but Cherubini told them that foreigners weren't admitted. (Long after this piece of unintentional satire, Liszt would always scorn the conservatoires and their products). So Adam continued to teach his son, with a rigid schedule of practising Bach and other composers on the piano, with transposition of fugues and other daily technique improving exercises. After resigning from the Esterhazys' service Adam spent most of his time as the manager of his son's career, with tours in many European countries.
|
|
Film maker and photographer Francesca Phillips wrote and directed a documentary on the usage of Silbo Gomero in La Gomera titled “Written in the Wind” (2009) and this 26min film won Best Short Documentary in Anthropology at The World Mountain Documentary Festival held in Qinghai, China in 2010. Romanian filmmaker Corneliu Porumboiu directed the 2019 movie The Whistlers, in which the language is featured prominently. French singer Féloche dedicated a song to this traditional singing called Silbo. There are other examples of transposition of an oral natural language into a pitch string.
|
|
A protein binding site, represented by a consensus sequence, may be a short sequence of nucleotides which is found several times in the genome and is thought to play the same role in its different locations. For example, many transcription factors recognize particular patterns in the promoters of the genes they regulate. In the same way, restriction enzymes usually have palindromic consensus sequences, usually corresponding to the site where they cut the DNA. Transposons act in much the same manner in their identification of target sequences for transposition.
|
|
Olivier Messiaen in 1937 This is a list of compositions by Olivier Messiaen. Works are listed initially by genre and can be sorted chronologically by clicking on the "Date" header. The compositions by Olivier Messiaen include works for chamber ensemble, orchestra, vocal music, music for piano and organ, as well as some of the earliest electronic music, with his use of the ondes martenot in several of his compositions. Messiaen's work is characterised by rhythmic complexity, his interest in ornithology and birdcalls, and his system of modes of limited transposition.
|
|
Students have described her as knowing every significant piece, by every significant composer. Copland recalls, > Nadia Boulanger knew everything there was to know about music; she knew the > oldest and the latest music, pre-Bach and post-Stravinsky. All technical > know-how was at her fingertips: harmonic transposition, the figured bass, > score reading, organ registration, instrumental techniques, structural > analyses, the school fugue and the free fugue, the Greek modes and Gregorian > chant. Murray Perahia recalled being "awed by the rhythm and character" with which she played a line of a Bach fugue.
|
|
Higher L1 copy numbers have been observed in the human brain compared to other organs. Studies of animal models and human cell lines have shown that L1s become active in neural progenitor cells (NPCs), and that experimental deregulation of or overexpression of L1 increases somatic mosaicism. This phenomenon is negatively regulated by Sox2, which is downregulated in NPCs, and by MeCP2 and methylation of the L1 5' UTR. Human cell lines modeling the neurological disorder Rett syndrome, which carry MeCP2 mutations, exhibit increased L1 transposition, suggesting a link between L1 activity and neurological disorders.
|
|
Biliary atresia seems to affect females slightly more often than males, and Asians and African Americans more often than Caucasians. It is common for only one child in a pair of twins or within the same family to have the condition. There seems to be no link to medications or immunizations given immediately before or during pregnancy. Diabetes during pregnancy particularly during the first trimester seems to predispose to a number of distinct congenital abnormalities in the infant such as sacral agenesis, transposition of the great vessels and the syndromic form of biliary atresia.
|
|
Anagrams constructed without aid of a computer are noted as having been done "manually" or "by hand"; those made by utilizing a computer may be noted "by machine" or "by computer", or may indicate the name of the computer program (using Anagram Genius). There are also a few "natural" instances: English words unconsciously created by switching letters around. The French chaise longue ("long chair") became the American "chaise lounge" by metathesis (transposition of letters and/or sounds). It has also been speculated that the English "curd" comes from the Latin crudus ("raw").
|
|
Tn10 is a transposable element, which is a sequence of DNA that is capable of mediating its own movement from one position in the DNA of the host organism to another. There are a number of different transposition mechanisms in nature, but Tn10 uses the non-replicative cut-and-paste mechanism. The transposase protein recognizes the ends of the element and cuts it from the original locus. The protein-DNA complex then diffuses away from the donor site until random collisions brings it in contact with a new target site, where it is integrated.
|
|
Windows are rectangular sash, set in openings with simple surrounds. The interior retains a number of original features, including wide floorboards, wooden paneling, and fireplace surrounds. The date of its construction was determined to be 1785 according to research performed in the 1950s by the Colonial Dames, and this date accords with the house's styling; however, in local records its construction date is given as 1758, which may be a simple transposition error. Ezekiel Woodruff for whom it was built, was descended from one of the area's first settlers.
|
|
A brief break at the end of the second musical digression creates tension which leads into the final sequence of the song. The refrain reappears for an additional five measures, marching through a transpositional structure that begins in B, repeats at A, and then ends at G for an unexpectedly short single measure. The section uses a descending progression, which mirrors the ascending progression of the previous two refrains. There follows a short section of vocalizing in three-part counterpoint that references the original refrain by reproducing upward transposition.
|
|
Later, she made an extensive study of the cytogenetics and ethnobotany of maize races from South America. McClintock's research became well understood in the 1960s and 1970s, as other scientists confirmed the mechanisms of genetic change and protein expression that she had demonstrated in her maize research in the 1940s and 1950s. Awards and recognition for her contributions to the field followed, including the Nobel Prize in Physiology or Medicine, awarded to her in 1983 for the discovery of genetic transposition; she was the only woman to receive an unshared Nobel Prize in that category.
|
|
Two important advantages and one disadvantage about Ileal Transposition (Interposition) have been reported. First of the advantages is that it can be performed on patients with a broad range of BMI (Body Mass Index), and the other one is that with the exception of patients who already need iron, B12 vitamin and D vitamin supplement prior to the surgery, the operation does not necessitate any additional vitamin supplement. Its disadvantage is that the operation technically quite challenging because it consists of numerous stages and therefore require serious training and technical expertise.
|
|
Le Banquet Céleste (The Heavenly Feast or The Celestial Banquet) is a work for organ, written by the French composer Olivier Messiaen in 1928. Based on the slow movement of an earlier unfinished orchestral work Le Banquet Eucharistique dating from 1926–1927, it is Messiaen's first published work. The work's epitaph, "He that eateth my flesh and drinketh my blood dwelleth in me and I in him" (John 6:56), indicates that the work is intended for Communion. The work is written in an octatonic scale, one of Messiaen's modes of limited transposition.
|
|
In the absence of congenital heart defects, individuals with situs inversus are homeostatically normal, and can live standard healthy lives, without any complications related to their medical condition. There is a 5–10% prevalence of congenital heart disease in individuals with situs inversus totalis, most commonly transposition of the great vessels. The incidence of congenital heart disease is 95% in situs inversus with levocardia. Many people with situs inversus totalis are unaware of their unusual anatomy until they seek medical attention for an unrelated condition, such as a rib fracture or a bout of appendicitis.
|
|
The existing settlement is the second village to bear this name, the original having been a mile to the northwest of the present position and inundated by the sea. This transposition was not an overnight catastrophe but a gradual withdrawal from the earlier site during the late seventeenth and early eighteenth centuries. Some sources (e.g. Graham), claim it is the third village to bear the name, perhaps erroneously assuming that the seventeenth century destruction of the nearby Barony of Culbin by shifting sands resulted in an earlier relocation.
|
|
Crina Bud links the anti-utopian quality to contemporary writings by, among others, Matei Călinescu (Viaţa şi opiniile lui Zacharias Lichter, "The Life and Opinions of Zacharias Lichter") and Baconsky's friend Octavian Paler (Viaţa pe un peron—"Life on a Platform"; Un om norocos—"A Lucky Man"). Written from the perspective of a sculptor, who is probably a transposition of Baconsky himself, it is a parable of totalitarian command, artistic submission, individual despair and withdrawal. The volume also offers a glimpse into the world of political imprisonment under communism.
|
|
Different permutations may be related by transformation, through the application of zero or more operations, such as transposition, inversion, retrogradation, circular permutation (also called rotation), or multiplicative operations (such as the cycle of fourths and cycle of fifths transforms). These may produce reorderings of the members of the set, or may simply map the set onto itself. Order is particularly important in the theories of composition techniques originating in the 20th century such as the twelve-tone technique and serialism. Analytical techniques such as set theory take care to distinguish between ordered and unordered collections.
|
|
The Eloesser flap is still utilized for patients with chronic empyemas who have not improved despite being treated with antibiotics and first line surgical procedures to remove pus and re-expand the lung such as decortication or video-assisted thoracoscopic surgery. Often they are thought to be too ill for more definitive procedures such as a major thoracotomy or muscle flap transposition. In a recent case series, the most common reasons to need an Eloesser flap were parapneumonic effusions and postresection empyemas, with only 9% done for tuberculosis.
|
|
After TLI, Swigert performed the separation and transposition maneuvers before docking the CSM Odyssey to the LM Aquarius, and the spacecraft pulled away from the third stage. Ground controllers then sent the third stage on a course to impact the Moon in range of the Apollo 12 seismometer, which it did just over three days into the mission. The crew settled in for the three-day trip to Fra Mauro. At 30:40:50 into the mission, with the TV camera running, the crew performed a burn to place Apollo 13 on a hybrid trajectory.
|
|
Lastly the third motif has two tyrosines and catalyzes DNA cleavage and ligation. There are three models of gene capture by helitrons: the 'read-through" model 1 (RTM1), the 'read-through" model 2 (RTM2) and a filler DNA model (FDNA). According to the RTM1 model an accidental "malfunction" of the replication terminator at the 3' end of the Helitron leads to transposition of genomic DNA. It is composed of the read-through Helitron element and its downstream genomic regions, flanked by a random DNA site, serving as a "de novo" RC terminator.
|
|
Macsinof Island also appears as Macsin or Matsyn Island. A theory propagated in 1612 held that Willoughby's Land was identical to Spitsbergen, thus supporting an English claim prior to the Dutch discovery by Barentsz in 1596. This theory was used to justify a monopoly charter on whaling rights granted to the Muscovy Company in 1613. Asher (1860) believed the two islands to be merely a western transposition of the two islands of Novaya Zemlya, and he saw a connection between Matsyn Island and "Matthew's Island," an early name for Severny Island.
|
|
The Damm algorithm is similar to the Verhoeff algorithm. It too will detect all occurrences of the two most frequently appearing types of transcription errors, namely altering one single digit, and transposing two adjacent digits (including the transposition of the trailing check digit and the preceding digit). But the Damm algorithm has the benefit that it makes do without the dedicatedly constructed permutations and its position specific powers being inherent in the Verhoeff scheme. Furthermore, a table of inverses can be dispensed with provided all main diagonal entries of the operation table are zero.
|
|
Nineteenth century cryptography, in contrast, used simple tables which provided for the transposition of alphanumeric characters, generally given row-column intersections which could be modified by keys which were generally short, numeric, and could be committed to human memory. The system was considered "indecipherable" because tables and keys do not convey meaning by themselves. Secret messages can be compromised only if a matching set of table, key, and message falls into enemy hands in a relevant time frame. Kerckhoffs viewed tactical messages as only having a few hours of relevance.
|
|
A repeat polymorphism of cytosines and adenines (CA) was found to be near BCYRN1 and was used as a reference for mapping the gene. Linkage mapping and radiation hybrid mapping localized the BCYRN1 gene to chromosome 2p16. As a long non-coding cytoplasmic RNA, BC200 RNA is a part of the largest group of non-coding transcripts in the human genome, which is more prevalent than protein coding genes. The 5' region (left arm) of monomeric Alu short interspersed repetitive elements (SINEs) allows for BC200 RNA transposition and has been evolutionarily conserved in other primates.
|
|
China Resident ID Card to board a high-speed train on China Railway High-speed. Traffic density and market share of conventional and high-speed rail on major corridors from 2001 to 2013 China Railway High-speed (CRH) (中国铁路高速) is the major high-speed rail service provided by state-owned railway manufacturing and construction corporation China Railway. China Railway is the successor of the former Ministry of Railways. Ministry held the power drafting policy on railroad transposition, development of the rail network and rail infrastructure in China.
|
|
When a single cystic artery arises from gastroduodenal artery it forms a configuration is known as low-lying cystic artery, as it passes inferior to the cystic duct through the cholecystoduodenal ligament, and therefore remains outside the hepatobiliary triangle. This condition has alternatively been described as an inferior cystic artery and transposition of the cystic artery and duct with a prevalence at approximately 5%. In 25% of these patients with this course there will be a secondary arterial supply to the gallbladder, with the low-lying artery acting as the equivalent of the posterior branch.
|
|
The Dorian octave species begins with this tetrachord, which is followed by a whole tone and another tetrachord to complete the octave with a pattern of ¼, ¼, 2, 1, ¼, ¼, and 2 tones. This pattern is rotated downward one degree for the Hypolydian, and one more for the Hypophrygian, for an octave species of 2, 1, ¼, ¼, 2, ¼, and ¼ tones . The name was appropriated by Ptolemy of Alexandria for one of his seven tonoi, or transposition keys. Ptolemy's system differed from the earlier Aristoxenian model, which had thirteen transpositional levels each a semitone from its neighbours.
|
|
Structure and coding capacity of canonical animal and plant Helitrons Helitrons are structurally asymmetric and are the only class of DNA transposons that do not generate duplications of target sites during transposition. Canonical Helitrons typically begin with a 5′ T (C/T) and terminate with the nucleotides CTRR (most frequently CTAG, but occasionally variation has been noted) but do not contain terminal inverted repeats. In addition, they frequently have a short palindromic sequence (16 to 20 nucleotides) hairpin about ∼ 11 bp from the 3′ end. They integrate between an AT host dinucleotide.
|
|
He returned to France the following year and married Marie-Louise-Elodie Berthon, with whom he would father three daughters: Césarine, Fernande and Paule. He apparently became interested in cryptography through solving cryptograms in newspapers' personal columns, and soon applied his cryptanalytic skills in a military context when, in 1890, he solved messages enciphered with the official French military transposition system, causing the War Ministry to change to a new scheme. In an effort to prompt reform within the government and enhance national security, Bazeries further exposed weaknesses in French cipher systems.Candela, Rosario.
|
|
The basic step of the Cooley–Tukey FFT for general factorizations can be viewed as re-interpreting a 1d DFT as something like a 2d DFT. The 1d input array of length N = N1N2 is reinterpreted as a 2d N1×N2 matrix stored in column-major order. One performs smaller 1d DFTs along the N2 direction (the non-contiguous direction), then multiplies by phase factors (twiddle factors), and finally performs 1d DFTs along the N1 direction. The transposition step can be performed in the middle, as shown here, or at the beginning or end.
|
|
Before entering politics he also was a member of the Health Council, which advises the Minister of Health, Welfare and Sport, a member of the board of the Wellcome Trust, member of the Committee on Biotechnology and Animals and of the European Molecular Biology Organization. Plasterk's research was in the area of genetics and functional genomics. He focused on the mechanism and regulation of DNA transposition, and on the mechanisms of RNA interference and microRNAs, including the functions of RNAi as a natural defense against the uncontrolled duplication of transposons.
|
|
In mammals, the Y chromosome directs the development of the testes and plays an important role in spermatogenesis. A high percentage of infertile men have deletions that map to regions of the Y chromosome. The DAZ1 (Deleted in Azoospermia) gene cluster maps to the AZFc region of the Y chromosome and is deleted in many azoospermic and severely oligospermic men. It is thought that the DAZ gene cluster arose from the transposition, amplification, and pruning of the ancestral autosomal gene DAZL also involved in germ cell development and gametogenesis.
|
|
The original facility was 16 structures with a complement of about 95 that grew to 24 major structures with a complement of 280. Apparently the name including "Beach" was a transposition error in the original Navy approval of the facility with the word from Naval Facility Pacific Beach being mistakenly added to the name for Centerville. The closest town was Ferndale, California. The facility was the first to be upgraded in September 1972 with a third generation coaxial cable, based on commercial developments at Bell Laboratories, designated SD-C.
|
|
Despite there being very little known about the internal morphology of Cyclotella, there there have been a sizable number of studies done on the genus’ molecular biology and genome. C. cryptica has been identified to be an oleaginous diatom, with a great deal of triacylglycerol. Its genome has been identified to contain many methylated repetitive sequences, which are supposed to function as a way of limiting the occurrences of DNA transposition. C. cryptica was discovered to have a very efficient lipid metabolism, which is needed for its high triacylglycerol production.
|
|
The first instance of tabulation hashing is Zobrist hashing, a method for hashing positions in abstract board games such as chess named after Albert Lindsey Zobrist, who published it in 1970. In this method, a random bitstring is generated for each game feature such as a combination of a chess piece and a square of the chessboard. Then, to hash any game position, the bitstrings for the features of that position are combined by a bitwise exclusive or. The resulting hash value can then be used as an index into a transposition table.
|
|
Structure of the Tn5 transposon, with insertion sequence flanking a cassette of genes, in this case drug resistance genes. The Tn5 transposon system is a model system for the study of transposition and for the application of transposon mutagenesis. Tn5 is a bacterial composite transposon in which genes (the original system containing antibiotic resistance genes) are flanked by two nearly identical insertion sequences, named IS50R and IS50L corresponding to the right and left sides of the transposon respectively. The IS50R sequence codes for two proteins, Tnp and Inh.
|
|
The Conversion of St. Paul presents a quality of Juan Bautista Maíno's works which is characteristic of his years of residence in Rome. When he returned, Maíno did not only make a mimetic transposition of figurative models that he'd seen but was able to reinterpret these sources with a refreshing impetus. This phenomenon of importing the new via traveling artistic style is what differentiates his works from those of his contemporaries. The painting The Conversion of Saint Paul was acquired by the former Museum of Art of Catalonia in 1952.
|
|
MuseScore's main purpose is the creation of high-quality engraved musical scores in a "What- You-See-Is-What-You-Get" environment. It supports unlimited staves, linked parts and part extraction, tablature, MIDI input and output, percussion notation, cross-staff beaming, automatic transposition, lyrics (multiple verses), fretboard diagrams, and in general everything commonly used in sheet music. Style options to change the appearance and layout are available, and style sheets can be saved and applied to other scores. There are pre-defined templates for many types of ensembles.
|
|
For example, in chess a player may not castle if the king or the rook to be castled with has moved during the course of the game. A common solution to this problem is to add the castling rights as part of the Zobrist hashing key. Another example is draw by repetition: given a position, it may not be possible to determine whether it has already occurred. A solution to the general problem is to store history information in each node of the transposition table, but this is inefficient and rarely done in practice.
|
|
The trifid cipher is a classical cipher invented by Félix Delastelle and described in 1902.Delastelle, pp. 101–3. Extending the principles of Delastelle's earlier bifid cipher, it combines the techniques of fractionation and transposition to achieve a certain amount of confusion and diffusion: each letter of the ciphertext depends on three letters of the plaintext and up to three letters of the key. The trifid cipher uses a table to fractionate each plaintext letter into a trigram,Hence the name trifid, which means "divided into three parts" (Oxford English Dictionary).
|
|
Ds elements are not autonomous because they cannot produce the transposase needed for transposition, and can only transpose when it is provided by the Ac element. Ds elements have shown to cause a 4.1kB and 2.0 kB insertions. The transposable elements were seen in progeny of plants that had undergone stress, and mutations caused by the insertion are like those caused by x-rays, UV light, or chemicals causing events like chromosome breakage and fusion. There are distinct families of transposon controlling elements that are made up of a combination of elements some that can, and some that cannot, transpose.
|
|
Supernumerary teeth were observed in 16.7% of patients; other findings included microdontia (37%), taurodontism (70.5%), transposition or ectopic teeth (30.8%), dilacerations (19.2%), and hypoplasia (30.8%). The incidence of microdontia, dilaceration, and hypoplasia was significantly higher in bilateral CLP patients than in unilateral CLP patients, and none of the anomalies showed any significant sexual dimorphism. It is therefore evident that patients with cleft lip and palate may present with a variety of dental anomalies. It is essential to assess the patient both clinically and radiographically in order to correctly treat and prevent progression of any dental problems.
|
|
During the Cold War Leiberich and his team worked intensively on the cryptanalysis of double transposition ciphers. One of their results led in 1974 to the discovery of the spying activities of Günter Guillaume who was senior aide to Willy Brandt, the statesman who served as Chancellor of the Federal Republic of Germany (West Germany) from 1969 to 1974.In 1972, Leiberich was the successor to Erich Hüttenhain as the Head of the Central Cryptography Office. In 1999, Leiberich wrote a report on the history of cryptography in Germany, which appeared in the international science magazine Spektrum der Wissenschaft.
|
|
The most recent Battery Directive, which entered into force on 26 September 2006, gave European Member States until 26 September 2008 to implement national laws and rules on batteries (Art.26 – Transposition). Some nations took the initiative and had already started programs and passed laws in accordance with the spirit and specifications of earlier battery directives. With the exception of button cells with a mercury content of no more than 2% by weight, the 2006 Battery Directive restates the earlier Battery Directive's prohibition of marketing batteries with more than 0.0005% mercury and 0.002% cadmium by weight.
|
|
Meaning, to transpose or convert (P → Q) to (Q → P) requires that the other proposition, (~Q → ~P), be transposed or converted to (~P → ~Q). Otherwise, to convert the terms of one proposition and not the other renders the rule invalid, violating the sufficient condition and necessary condition of the terms of the propositions, where the violation is that the changed proposition commits the fallacy of denying the antecedent or affirming the consequent by means of illicit conversion. The truth of the rule of transposition is dependent upon the relations of sufficient condition and necessary condition in logic.
|
|
His extensive explanations in opposition to the transposition of his works into other media were groundbreaking in fidelity criticism. He thought that just one episode should be dramatised, or an idea should be taken and incorporated into a separate plot. According to critic Alexander Burry, some of the most effective adaptions are Sergei Prokofiev's opera The Gambler, Leoš Janáček's opera From the House of the Dead, Akira Kurosawa's film The Idiot and Andrzej Wajda's film The Possessed. After the 1917 Russian Revolution, passages of Dostoevsky books were sometimes shortened, although only two books were censored: Demons and Diary of a Writer.
|
|
Law 2000-517 authorized the government to adopt ordinances to convert sums from Francs to Euros in various legislative texts. There is also a practice of using ordinances to transpose European Directives into French law, to avoid late transposition of Directives, which happens often and is criticized by the EU Commission. Ordinances are also used to codify law into codes - to rearrange them for the sake of clarity without substantially modifying them. They are also sometimes used to push controversial legislation through, such as when Prime Minister Dominique de Villepin created new forms of work contracts in 2005.
|
|
Messiaen was Greenwood's "first connection" to classical music, and remains an influence; he said: "He was still alive when I was 15, and for whatever reason I felt I could equate him with my other favourite bands – there was no big posthumous reputation to put me off. So I'm still very fond of writing things in the same modes of limited transposition that he used." He is an admirer of Polish composer Krzysztof Penderecki, and cited a concert of Penderecki's music in the early 90s as a "conversion experience". He is also a fan of Gyorgy Ligeti, Henri Dutilleux, and Steve Reich.
|
|
This joint declaration was signed on 27 October 1960, in Yves Klein's workshop, by nine people: Yves Klein, Arman, Martial Raysse, Pierre Restany, Daniel Spoerri, Jean Tinguely and the Ultra-Lettrists, Francois Dufrêne, Raymond Hains, Jacques de la Villeglé; in 1961 these were joined by César, Mimmo Rotella, then Niki de Saint Phalle and Gérard Deschamps. The artist Christo showed with the group. It was dissolved in 1970. Contemporary of American Pop Art—often conceived as its transposition in France—new realism was along with Fluxus and other groups one of the numerous tendencies of the avant-garde in the 1960s.
|
|
In 1953, Potts was the first surgeon to successfully repair a pulmonary artery sling, an abnormality in which the lung blood vessels wrap around and compress the patient's windpipe. The patient who underwent this first repair was a five- month-old girl. She was still alive at nearly 25 years of age; like many of the patients who underwent Potts' version of this repair, she had decreased blood flow to the left lung, but she was doing well. Potts and his team also advanced the treatment of a heart defect known as transposition of the great arteries.
|
|
Contraposition is a logically valid rule of inference that allows the creation of a new proposition from the negation and reordering of an existing one. The method applies to any proposition of the type If A then B and says that negating all the variables and switching them back to front leads to a new proposition i.e. If Not-B then Not-A that is just as true as the original one and that the first implies the second and the second implies the first. Transposition is exactly the same thing as Contraposition, described in a different language.
|
|
Zobrist hashing (also referred to as Zobrist keys or Zobrist signatures Zobrist keys: a means of enabling position comparison.) is a hash function construction used in computer programs that play abstract board games, such as chess and Go, to implement transposition tables, a special kind of hash table that is indexed by a board position and used to avoid analyzing the same position more than once. Zobrist hashing is named for its inventor, Albert Lindsey Zobrist.Albert Lindsey Zobrist, A New Hashing Method with Application for Game Playing, Tech. Rep. 88, Computer Sciences Department, University of Wisconsin, Madison, Wisconsin, (1969).
|
|
For congenital cardiac malformations, even though surgery remains the treatment of choice, interventional cardiology approaches are increasingly being used. However, such percutaneous approaches can be challenging or even impossible because of difficult and complex anatomies (such as double-outlet right ventricle, or transposition of the great arteries, acute turns or kinks in the pulmonary arteries of tetralogy of Fallot patients) and patient characteristics/ complications (low weight, poor vascular access, induced rhythm disturbances, hemodynamic compromise).Sivakumar, K.; Krishnan, P.; Pieris, R. & Francis, E. (2007). Hybrid approach to surgical correction of tetralogy of Fallot in all patients with functioning Blalock Taussig shunts.
|
|
99, 101, and 109 are octatonic pieces, as is No. 33 of the 44 Duos for Two Violins. "In each piece, changes of motive and phrase correspond to changes from one of the three octatonic scales to another, and one can easily select a single central and referential form of 8-28 in the context of each complete piece." However, even his larger pieces also feature "sections that are intelligible as 'octatonic music'" . Olivier Messiaen made frequent use of the octatonic scale throughout his career as a composer, and indeed in his seven modes of limited transposition, the octatonic scale is Mode 2.
|
|
A wide variety of functional groups are unaffected by these conditions, including many that are transformed by dissolving metal reductions. Reductive desulfonylation with these reagents does not occur in reactions of β-hydroxy sulfones, due to the poor leaving group ability of the hydroxyl group. A significant issue associated with the reduction of allylic sulfones is transposition of the allylic double bond, which occurs in varying amounts during reductions by metal amalgams. and tin hydrides Palladium-catalyzed reductive desulfonylations of allylic sulfones do not have this issue, and afford allylic sulfones with high site and stereoselectivity.
|
|
The two texts also contain hundreds of other differences, including the transposition of words within speeches, the movement of words from one speech to another, the replacement of words with near-synonyms, and many changes in grammar and spelling. At one time, it was thought that the Quarto represented a separate revision of the play by Shakespeare. However, since the Quarto contains many changes that can only be regarded as mistakes, it is now widely believed that the Quarto was produced by memorial reconstruction. It is thought likely that the Quarto was collectively produced by a company of actors remembering their lines.
|
|
In 1971 the group traveled to play in the Netherlands, Germany and the United Kingdom, where they settled. In 1976, they added three Caribbean musicians to their line-up and pursued a more reggae-based sound. After several years of playing the British clubs, pubs and concert halls as Otis Waygood, in 1977 they changed their name to Immigrant and their final tour was supporting Tavares, ending up at the Palladium, in London. The group disbanded in 1979 The band name originated from a transposition of the name appearing on a number of lifts installed in Rhodesian buildings by Waygood Otis elevators.
|
|
The notation is analogous with that for an inverse function. Although many functions do not have an inverse, every relation does have a unique converse. The unary operation that maps a relation to the converse relation is an involution, so it induces the structure of a semigroup with involution on the binary relations on a set, or, more generally, induces a dagger category on the category of relations as detailed below. As a unary operation, taking the converse (sometimes called conversion or transposition) commutes with the order-related operations of the calculus of relations, that is it commutes with union, intersection, and complement.
|
|
Scientific pitch notation is often used to specify the range of an instrument. It provides an unambiguous means of identifying a note in terms of textual notation rather than frequency, while at the same time avoiding the transposition conventions that are used in writing the music for instruments such as the clarinet and guitar. It is also easily translated into staff notation, as needed. In describing musical pitches, nominally enharmonic spellings can give rise to anomalies where, for example in meantone temperaments C is a lower frequency than B; but such paradoxes usually do not arise in a scientific context.
|
|
This metabole kata tonon (μεταβολή κατὰ τόνον) can be localized in the kanonion as follows. If the untransposed column is the first with the parallage (here marked with arrows), the phthongos of protos or plagios protos is in the last line. The echos tetartos is expected three steps or phonai above, which is three lines higher, indicated by "Γ" (3) in the last column which counts the ascending steps. In the fourth column with modal signatures, the singer finds in the same line the transposition which turns the phthongos of echos tetartos into the echos tritos.
|
|
Within the Latin treatises the practical use of tetraphonia was plausible to the author of Musica enchiriadis, even the practice of its transposition was reflected as "absonia" to a certain degree.See Atkinson (2008, 129-131). By the 11th century the so-called "Dasia system" was refused by Guido of Arezzo and Hermann of Reichenau, despite its use within the practice of discant—for the very reason, that fifth equivalence excluded somehow octave equivalence.Charles Atkinson (2008, 114-118) studied mainly Papadikai for the Byzantine influence on Carolingian theory, despite the fact that this treatise type developed much later.
|
|
In abstract algebra, a medial magma or medial groupoid is a magma or groupoid (that is, a set with a binary operation) which satisfies the identity :(x \cdot y) \cdot (u \cdot v) = (x \cdot u) \cdot (y \cdot v), or more simply xy\cdot uv = xu\cdot yv for all x, y, u and v, using the convention that juxtaposition denotes the same operation but has higher precedence. This identity has been variously called medial, abelian, alternation, transposition, interchange, bi-commutative, bisymmetric, surcommutative, entropic etc.Historical comments J.Jezek and T.Kepka: Medial groupoids Rozpravy CSAV, Rada mat. a prir.
|
|
Quantitative metathesis (or transfer of quantity)Smyth, Greek Grammar, paragraph 34 on CCEL: transfer of quantity is a specific form of metathesis or transposition (a sound change) involving quantity or vowel length. By this process, two vowels near each other – one long, one short – switch their lengths, so that the long one becomes short, and the short one becomes long. In theory, the definition includes both :long-short → short-long and :short- long → long-short, but Ancient Greek, which the term was originally created to describe, displays only the former, since the process is part of long-vowel shortening.
|
|
While this will inevitably lead to heightened paralysis, safe removal of a malignant neoplasm is worth the often treatable palsy that follows. In the best case scenario, paralysis can be corrected with techniques including hypoglossal-facial nerve anastomosis, end-to-end nerve repair, cross facial nerve grafting, or muscle transfer/transposition techniques, such as the gracilis free muscle transfer. Patients with facial nerve paralysis resulting from tumours usually present with a progressive, twitching paralysis, other neurological signs, or a recurrent Bell's palsy-type presentation. The latter should always be suspicious, as Bell's palsy should not recur.
|
|
The same placement pattern, alternating between descending and ascending placements of n, applies for any larger value of n. In this way, each permutation differs from the previous one either by the single-position-at-a- time motion of n, or by a change of two smaller numbers inherited from the previous sequence of shorter permutations. In either case this difference is just the transposition of two adjacent elements. When the first and final elements of the sequence, also, differ in only two adjacent elements (the positions of the numbers 1 and 2), as may be shown by induction.
|
|
As noted earlier, the Republican Secretary of State in Michigan was found purging voters from voting rolls when voter ID cards were returned as undeliverable. In the court challenge, the federal judge ordered the state to reinstate the voters. The judge ruled that the state's actions were in violation of the NVRA. His decision noted that there was no way to prevent qualified voters from being disfranchised as their cards may be returned as undeliverable by postal error, clerical error, inadvertent routing within a multi-unit dwelling, or even simple misspelling or transposition of numbers in an address.
|
|
440px Retrotransposons (also called Class I transposable elements or transposons via RNA intermediates) are a type of genetic component that copy and paste themselves into different genomic locations (transposon) by converting RNA back into DNA through the process reverse transcription using an RNA transposition intermediate. Through reverse transcription, retrotransposons amplify themselves quickly to become abundant in eukaryotic genomes such as maize (49–78%) and humans (42%). They are only present in eukaryotes but share features with retroviruses such as HIV. There are two main types of retrotransposon, long terminal repeats (LTRs) and non-long terminal repeats (non-LTRs).
|
|
In a PDA, the vessel does not close, but remains patent (open), resulting in an abnormal transmission of blood from the aorta to the pulmonary artery. PDA is common in newborns with persistent respiratory problems such as hypoxia, and has a high occurrence in premature newborns. Premature newborns are more likely to be hypoxic and have PDA due to underdevelopment of the heart and lungs. If transposition of the great vessels is present in addition to a PDA, the PDA is not surgically closed since it is the only way that oxygenated blood can mix with deoxygenated blood.
|
|
Warren Ellis wrote the series as a direct-to-video film before adapting it for a television format. In March 2007, Frederator Studios acquired the rights to produce an animated film adaption of Castlevania III: Dracula's Curse, intended as a direct-to-video production. Frederator brought writer Warren Ellis aboard as the screenwriter for the series. In an interview with Paste, Warren Ellis said that when he was contacted about Castlevania he had no previous knowledge of the series and discovered it was a "Japanese transposition of the Hammer Horror films I grew up with and loved".
|
|
The extent of sophistication seemed to pose little problem for Friedman; she still mounted successful attacks against both simple substitution and transposition ciphers, and the more complex enciphered codes which eventually came into use. Anti-prohibitionists provided Friedman and her team of cryptanalysts with numerous opportunities to hone their codebreaking skills during her employment with the U.S. Treasury Department. She was one of the people who led the cryptanalytic effort against international smuggling and drug-running radio and encoded messages, which the runners began to use extensively to conduct their operations. In 1923, Friedman was hired as a cryptanalyst for the U.S. Navy.
|
|
The transposition (a~b), executed thereafter, then addresses z by the index of b to swap what initially were a and z. In fact, the symmetric group is a Coxeter group, meaning that it is generated by elements of order 2 (the adjacent transpositions), and all relations are of a certain form. One of the main results on symmetric groups states that either all of the decompositions of a given permutation into transpositions have an even number of transpositions, or they all have an odd number of transpositions. This permits the parity of a permutation to be a well-defined concept.
|
|
Deep learning training mainly relies on variants of stochastic gradient descent, where gradients are computed on a random subset of the total dataset and then used to make one step of the gradient descent. Federated stochastic gradient descentPrivacy Preserving Deep Learning, R. Shokri and V. Shmatikov, 2015 is the direct transposition of this algorithm to the federated setting, but by using a random fraction C of the nodes and using all the data on this node. The gradients are averaged by the server proportionally to the number of training samples on each node, and used to make a gradient descent step.
|
|
Miller has been an important humanities and literature scholar specializing in Victorian and Modernist literature, with a keen interest in the ethics of reading and reading as a cultural act. From 1952 to 1972, Miller taught at Johns Hopkins University. During this time, Miller was heavily influenced by fellow Johns Hopkins professor and Belgian literary critic Georges Poulet and the Geneva School of literary criticism, which Miller characterized as "the consciousness of the consciousness of another, the transposition of the mental universe of an author into the interior space of the critic's mind."Vincent B. Leitch, ed.
|
|
The European Commission may bring a case in the European Court of Justice against states which have not transposed directives adequately. Additionally, any individual or business in a Member State may lodge a complaint with the Commission about the incorrect or delayed transposition of an EU directive or "for any measure (law, regulation or administrative action) or practice attributable to a Member State which they consider incompatible with a provision or a principle of EU law". The Commission publishes an annual report summarising how EU law has been transposed, with statistics on the numbers and types of infringements, per country and sector.
|
|
Classified ad for Revalenta arabica from The Courier (Hobart, Tasmania) November 1, 1856, p. 4. Revalenta Arabica, or Ervalenta, is a name given to a preparation which was sold in the 18th century as an empirical diet for patients, extraordinary restorative virtues being attributed to it. The product that was mass-marketed was, in reality, only a preparation of the common lentil, its first name being formed for disguise by the transposition of its earlier botanical name, Ervum lens. While indeed lentils are a healthy and nutritious food, Revalenta Arabica's value was about similar to the common pea-meal (or ground split peas).
|
|
Cruz's surname simply means "cross", pointing to the heavy burden she places on the shoulders of the young girls she lures into prostitution. Since the character's name is later revealed to be an alias, it could also mean that the name was chosen, as Cruz is a common surname in the Philippines, representing how easily she could walk around the streets of Manila without detection. The name of the antagonist Ah Tek, meanwhile, is a play on the colloquial term atík, ("cash"; a transposition of kità, or income) representing the greed and selfishness of the character.
|
|
He built its church of Sainte-FoyIts dedication was linked to the abbey of Sainte-Foy de Conques in Rouergue which Roger probably passed on his way out of Normandy or on his return from Iberia. See Lucien Musset, le nom de Conches « semble n'être qu'une simple transposition en langue d'oïl de celui de Conques » (before 1026) then the abbey of Saint-Pierre de Castillon (c. 1035) where monks from Fécamp Abbey were installed. This monastery was one of the first baronial foundations in NormandyBefore this, creating or restoring monasteries had been a right reserved to the duke of Normandy alone.
|
|
Examples from the 19th century are the transposition of "Horatio Nelson" into Honor est a Nilo (Latin: Honor is from the Nile); and of "Florence Nightingale" into "Flit on, cheering angel". The Victorian love of anagramming as recreation is alluded to by the mathematician Augustus De MorganIn his A Budget of Paradoxes, p. 82. using his own name as example; "Great Gun, do us a sum!" is attributed to his son William De Morgan, but a family friend John Thomas Graves was prolific, and a manuscript with over 2,800 has been preserved.Robert Edoward Moritz, On Mathematics and Mathematicians (2007), p. 151.
|
|
A transposon contains genetic sequences that encode for proteins that mediate its own movement, but can also carry genes for additional proteins. Transposase is encoded within the transposon DNA and used to facilitate its own movement, making this process self-sufficient within organisms. All simple transposons contain a transposase encoding region flanked by terminal inverted repeats, but the additional genes within the transposon DNA can vary. Viruses, for example, encode the essential viral transposase needed for conservative transposition as well as protective coat proteins that allow them to survive outside of cells, thus promoting the spread of mobile genetic elements.
|
|
However, that was not the only trick that Painvin used to crack the ADFGX cipher. He also used repeating sections of ciphertext to derive information about the likely length of the key that was being used. Where the key was an even number of letters in length he knew, by the way the message was enciphered, that each column consisted entirely of letter coordinates taken from the top of the Polybius Square or from the left of the Square, not a mixture of the two. Also, after substitution but before transposition, the columns would alternately consist entirely of "top" and "side" letters.
|
|
A dog cortical map obtained by Ferrier using the electrical stimulation of the brain These – and other investigations in the same line – resulted in international fame for Ferrier and assured his permanent place as one of the greatest experimental neurologists. In June 1876 he was elected a Fellow of the Royal Society at the age of 33 and Fellow of the Royal College of Physicians the following year. He was also the first physiologist to make an audacious (if scientifically incorrect) transposition of cortical maps obtained in monkeys to the human brain. This proposal soon led to practical consequences in neurology and neurosurgery.
|
|
Sweden implemented the EU's 2006 Data Retention Directive in May 2012, and it was fined €3 million by the Court of Justice of the European Union for its belated transposition (the deadline was 15 September 2007). The directive allowed member states to determine the duration data is retained, ranging from six months to two years; the Riksdag, Sweden's legislature, opted for six months. In April 2014, however, the CJEU struck down the Data Retention Directive. PTS, Sweden's telecommunications regulator, told Swedish ISPs and telcos that they would no longer have to retain call records and internet metadata.
|
|
Before the implementation of the SEA Directive into the Danish planning system, there had been a long history of consideration of the environmental effects that a planning process may have. Therefore, the transposition of the SEA Directive into Danish legislation conforms fully, and the supporting guidance (albeit late) ensures that SEAs conducted should be directive compliant. This historical approach has ensured that the SEA process has been institutionalised into the planning process. This ensures that environmental considerations are the subject of political debates and that parliamentary bills are prepared adequately with the SEA Directive and Danish SEA Act in mind.
|
|
The DAZ (Deleted in AZoospermia) gene family encodes potential RNA binding proteins that are expressed in prenatal and postnatal germ cells of males and females. The protein encoded by this gene is localized to the nucleus and cytoplasm of fetal germ cells and to the cytoplasm of developing oocytes. In the testis, this protein is localized to the nucleus of spermatogonia but relocates to the cytoplasm during meiosis where it persists in spermatids and spermatozoa. Transposition and amplification of this autosomal gene during primate evolution gave rise to the DAZ gene cluster on the Y chromosome.
|
|
RNA-OUT is a non-coding RNA that is antisense to the RNA-IN non-coding RNA. Transposition of insertion sequence IS10 is regulated by an anti-sense RNA which inhibits transposase expression when IS10 is present in multiple copies per cell. IS10 antisense pairing is facilitated by the RNA-binding protein, Hfq. RNA-OUT consists of a stem-loop domain topped by a flexibly paired loop; the 5′ end of the target molecule, RNA-IN, is complementary to the top of the loop, and complementarity extends for 35 nucleotides down one side of RNA-OUT.
|
|
NUMT, pronounced "new might," is an acronym for "nuclear mitochondrial DNA" segment coined by evolutionary geneticist, Jose V. Lopez, which describes a transposition of any type of cytoplasmic mitochondrial DNA into the nuclear genome of eukaryotic organisms. More and more NUMT sequences, with different size and length, in the diverse number of Eukaryotes, have been detected as more whole genome sequencing of different organisms accumulate. In fact, NUMTs have often been unintentionally discovered by researchers who were looking for mtDNA (mitochondrial DNA). NUMTs have been reported in all studied eukaryotes, and nearly all mitochondrial genome regions can be integrated into the nuclear genome.
|
|
The palette of colours is extended and there is a tendency towards exuberance or gaudiness. Woodcuts and Paupers' Bibles were used as examples by the artists (though pure copies were rare). During this time, influences from Early Netherlandish painting, including attempts at realism and perspective, can be seen in a few of the murals; again probably via German transposition (some of the artists such as Albertus Pictor and were themselves German). On the whole, however, church murals continued to follow a vernacular, decorative style with few elements emerging from the nascent Renaissance in the rest of Europe.
|
|
"Bruno Maderna's Serial Arrays", Society for Music Theory. Volume 13, Number 1, March 2007. yet lacks 2s and 6s. 6-20 maps onto itself under transposition three times (@0,4,8) and under inversion three times (@1,4,9) (six degrees of symmetry), allowing only four distinct forms, one form overlapping with another by way of an augmented triad or not at all, and two augmented triads exhaust the set as do six minor and major triads with roots along the augmented triad. Its only five-note subset is 5-21 (0,1,4,5,8), the complement of which is 7-21 (0,1,2,4,5,8,9), the only superset of 6-20.
|
|
Ptolemy substituted a diatonic sequence of seven transpositions pitched either a whole tone or a semitone apart. The entire double-octave scale system was then transposed onto each of these relative pitch levels, requiring (in modern terms) a different key signature in each case, and therefore a different sequence of whole and half steps in the fixed central octave span. The Hypophrygian transposition was the second-lowest of these, a whole tone above the Hypodorian. A whole tone higher was the Hypolydian, followed a semitone higher still by the Dorian, then after another whole tone by the Phrygian, and so on (; ).
|
|
As exchanging the indices of an array is the essence of array transposition, an array stored as row-major but read as column-major (or vice versa) will appear transposed. As actually performing this rearrangement in memory is typically an expensive operation, some systems provide options to specify individual matrices as being stored transposed. The programmer must then decide whether or not to rearrange the elements in memory, based on the actual usage (including the number of times that the array is reused in a computation). For example, the Basic Linear Algebra Subprograms functions are passed flags indicating which arrays are transposed.
|
|
Harpsichord builders in the Southern Netherlands built instruments with two keyboard (two manuals) which could be used for transposition. These Flemish instruments served as the model for Baroque-era harpsichord construction in other nations. In France, the double keyboards were adapted to control different choirs (groups) of strings, making a more musically flexible instrument (e.g., the upper manual could be set to a quiet lute stop, while the lower manual could be set to a stop with multiple string choirs, for a louder sound; this enabled the harpsichordist to have two dynamics and tone colours from one instrument).
|
|
An older man is holding up his thumb and forefinger, indicating that they are only little girls. The meaning of this transposition to the human situation hinges on the double meaning of 'unripe' (vert) in French, which could also be used of a sexually immature female. From this emerges the story's subtext, of which a literal translation reads: There is the same sexual ambiguity in the Greek of Babrius. The phrase there is "" (), the word having both the literal meaning of an unripe grape and the metaphorical usage of a girl not yet ripe for marriage.
|
|
The PiggyBac (PB) transposon from the cabbage looper moth Trichoplusia ni was engineered to be highly active in mammalian cells, and is capable of genome- wide mutagenesis. Transposons contained both PB and Sleeping Beauty inverted repeats, in order to be recognized by both transposases and increase the frequency of transposition. In addition, the transposon contained promoter and enhancer elements, a splice donor and acceptors to allow gain- or loss-of- function mutations depending on the transposon's orientation, and bidirectional polyadenylation signals. The transposons were transformed into mouse cells in vitro and mutants containing tumours were analyzed.
|
|
Superfamilies are identified by shared DNA sequence and ability to respond to the same transposase. Common features of hAT transposons include a size of 2.5-5 kilobases with short terminal inverted repeats and short flanking target site duplications generated during the transposition process. The hAT superfamily's name derives from three of its members: the hobo element from Drosophila melanogaster, the Activator or Ac element from Zea mays, and the Tam3 element from Antirrhinum majus. The superfamily has been divided based on bioinformatics analysis into at least two clusters defined by their phylogenetic relationships: the Ac family and the Buster family.
|
|
Tania A. Baker Ph.D. is a Professor of Biology at the Massachusetts Institute of Technology and formally the head of the Department of Biology. She earned her B.S. in Biochemistry from University of Wisconsin–Madison and her Ph.D. in Biochemistry from Stanford University under the guidance of Arthur Kornberg. She joined the MIT faculty in 1992 and her research is focused on the mechanisms and regulation of DNA transposition and protein chaperones. She is a member of the National Academy of Science, fellow of the American Academy of Arts and Sciences, and has been a Howard Hughes Medical Institute (HHMI) investigator since 1994.
|
|
She also trained at AKAD college in 1988 and continued with courses in the fields of stamping, screen printing, and lithography. She honed her technique in mixed media and in new techniques such as transposition of photographs over sandblasted woodcuts at the University of Alaska Fairbanks during 1994. She also benefited from training under a grant from the Danish Arts Foundation during 2002. She has held exhibitions at: Filosofgangen, Odense in 2009 ; Lyngby Kunstforening, Copenhagen in 2010; at Stege Bibliotek, Bispegarden Kalundborg, Pakhuset, and Nykøbing Sjælland in 2011; at the Norske Kirke, Copenhagen, in 2012, 2013 and 2014.
|
|
According to music critic Richard Osborne, writing in The New Grove Dictionary of Opera, "it is important to record the degree to which singers have sometimes distorted Rossini's intentions. The most serious distortion has been the upward transposition of the role of Rosina, turning her from a lustrous alto into a pert soprano."Osborne, Richard 1992, p. 311. However, it has also been noted that Rossini, who frequently altered his music for specific singers, wrote a new aria for the second act for Joséphine Fodor- Mainvielle, a soprano who had sung Rosina in the 1818 London premiere, and sang the new aria c.
|
|
Peter Schat's 'Zodiac of the Hours', which graphically represents the tone-clock steerings of the twelve hours. Note that X can only be steered as a diminished seventh tetrachord (hence, the only non-triangular shape). Each point of a shape represents a pitch-class on the chromatic circle, and each shape represents one transposition or inversion of an hour. The term 'tone clock' (toonklok in Dutch) was originally coined by Dutch composer Peter Schat, in reference to a technique he had developed of creating twelve-note pitch 'fields' by transposing and inverting a trichord so that all twelve pitch- classes would be created once and once only.
|
|
The following year he defeated the South Australian chess player Ernest Hack, becoming unofficial Western Australian Chess Champion, and taking over Hack's chess column in The Western Mail. In 1895 he joined the public service, initially as sub-editor of the Western Australian Yearbook. Later he would rise to become Government Statistician and Registrar-General. In 1895, Siebenhaar began a translation of the first edition of Ongeluckige voyagie van't schip Batavia ("Unlucky voyage of the ship Batavia"), a third person transposition of Francisco Pelsaert's journal of the 1629 shipwreck of the Batavia off the west coast of Australia, and subsequent mutiny and massacre amongst the survivors.
|
|
He edited music by Monteverdi for Carus-Verlag, including the collection of sacred music Selva morale e spirituale and excerpts from it. He authored a critical edition of the Vespro della Beata Vergine for Oxford University Press in 1999 and subsequently wrote a book, The Monteverdi Vespers of 1610: Music, Context, Performance. A reviewer described it as "comprehensive" and "authoritative", covering Monteverdi's work in the context of his contemporaries, the music, and considerations for its performance. He noted the author's knowledge and "keen musical instincts" in aspects of performance such as tempo, tuning, pitch and transposition, vocal technique, pronunciation and ornamentation, and continuo realization.
|
|
As Hamilton states: > Suppose an Article had been introduced into the Constitution, empowering the > United States to regulate the elections of the particular States, would any > man have hesitated to condemn it, both as an unwarrantable transposition of > power, and as a premeditated engine for the destruction of the State > Governments? This statement by Hamilton pinpoints the exact point that he is trying to convince the American people of. If they, the people, would condemn this supposed article, then they should also condemn an article that would do the same thing, but in reverse. An article that would have allowed the states to regulate the elections of the federal government.
|
|
' The Greek text seems better to reflect the monastic tradition, as expressed by writers such as the fifth-century Abba Isaiah of Scetis in his Ascetic Discourses, that all passions are ultimately divine gifts with a sacred purpose. The second main difference is that, where the Greek has περιεργίας (periergia meaning 'idle curiosity' or 'meddling'), the Slavonic has небрежεнїѧ (nebrezheniya) meaning 'negligence,' 'indifference,' or 'despondency,' which would be ἀκηδία (akêdia) in Greek—the classic monastic sin. A third minor difference is the transposition of terms in the first line. Whereas the Greek consistently reads "ἀργίας, περιεργίας" ('sloth, meddling'), the Slavonic reads "оунынїѧ, небрежεнїѧ" ('despondency [in place of meddling], sloth').
|
|
In the inferred proposition, the consequent is the contradictory of the antecedent in the original proposition, and the antecedent of the inferred proposition is the contradictory of the consequent of the original proposition. The symbol for material implication signifies the proposition as a hypothetical, or the "if- then" form, e.g. "if P then Q". The biconditional statement of the rule of transposition (↔) refers to the relation between hypothetical (→) propositions, with each proposition including an antecent and consequential term. As a matter of logical inference, to transpose or convert the terms of one proposition requires the conversion of the terms of the propositions on both sides of the biconditional relationship.
|
|
The movement's unusual structure has invited a variety of analytical interpretations. Composer Roger Sessions describes the form as more of a triple exposition than a normal sonata form, and the second rotation could be interpreted as a simulation of the expositional repeat seen in many classical sonata form expositions, with the added interest of transposition. Conversely, other analysts have interpreted the second rotation as the onset of the recapitulation or as a "double recapitulation effect" rather than as an expositional repeat, with Hepokoski and Darcy describing it as a "tonally 'wrong' recapitulatory rotation followed by a notably varied, 'right' one in the tonic".Hepokoski, James and Warren Darcy.
|
|
The Draža Mihailović hand cypher was a Double Transposition cipher, using the same key for both cages, the keys being derived from a novel. Marquarts section achieved a fair measure of success with this system, owing to errors in encipherment, stereotyped signatures and also the fact that the cages were often filled up to rectangles with rare letters. Under such circumstances, it was often possible to recover the key from a single message. In some cases, by working out the basic text from which the keys had been derived, they were able to recognize and obtain the novel and hence to read all message traffic currently.
|
|
TransTrem is a guitar vibrato system developed by Steinberger in 1984. Its main feature is to maintain the pitch of each string at the proper tuning interval to the others when the vibrato ("Whammy bar") is used. This allows entire chords to have their pitch bent while remaining in tune, whereas a conventional vibrato system would cause the strings to go out of tune with each other. The system also allows transposition of the pitch of the guitar as a whole: the pitch of all the strings can be raised or lowered from the standard EADGBE tuning and locked into one of several preset positions.
|
|
The ChessMachine was a chess computer sold between 1991 and 1995 by TASC (The Advanced Software Company). It was unique at the time for incorporating both an ARM2 coprocessor for the chess engine on an ISA card which plugged into an IBM PC and a software interface running on the PC to display a chess board and control the engine. The ISA card was sold with a CPU running at either 16 MHz or 32 MHz, and 128 KB, 512 KB, or 1 MB of onboard memory for transposition tables. This made economic sense at the time of introduction because mainstream PCs were only running from 10 MHz to 25 MHz.
|
|
The most common congenital heart defects (CHDs) which cause shunting are atrial septal defects (ASD), patent foramen ovale (PFO), ventricular septal defects (VSD), and patent ductus arteriosi (PDA). In isolation, these defects may be asymptomatic, or they may produce symptoms which can range from mild to severe, and which can either have an acute or a delayed onset. However, these shunts are often present in combination with other defects; in these cases, they may still be asymptomatic, mild or severe, acute or delayed, but they may also work to counteract the negative symptoms caused by another defect (as with d-Transposition of the great arteries).
|
|
Following two research contracts with the European Space Agency (ESA) in the domain of planetary protection and space-based solar power stations, IDEST won two major projects for the European Union: The European Twinning Project UA/06/PCA/OT/05 Boosting Ukrainian Space Cooperation with the European Union, resulting in a series of meetings organized in Kiev between June 2008 and February 2010; and the Collaborative Project Consent (the 7th Framework Programme) relating to the protection of personal data in social networks. IDEST has also worked in close collaboration with the Romanian authorities in the transposition of the European law of telecommunications into Romanian national law.
|
|
Based on deuterium- labeling experiments, they concluded that alkene formation is initiated by hydride reduction of the iminium ion followed by double bond migration and nitrogen extrusion which occur in a concerted manner. Allylic diazene rearrangement as the final step in the reductive 1,3-transposition of α,β-unsaturated tosylhydrazones to the reduced alkenes can also be used to establish sp3-stereocenters from allylic diazenes containing prochiral stereocenters. The influence of the alkoxy stereocenter results in diastereoselective reduction of the α,β-unsaturated tosylhydrazone. The authors predicted that diastereoselective transfer of the diazene hydrogen to one face of the prochiral alkene could be enforced during the suprafacial rearrangement.
|
|
While NASM does not define "keyboard competency", there is a general consensus among universities that competency should include functional piano skills such as the playing of repertoire, harmonization, transposition, sight-reading, open score reading, and improvisation. The structure of college level group piano classes varies by university. Group piano sequences typically involve 2 to 6 semesters, situated within the first 2 or 3 years of study. Goals of the group piano sequence include introducing and reinforcing functional keyboard skills, bringing students with varying musical background to a competent level by the end of the course, and nurturing enthusiasm for music in general and the piano specifically.
|
|
For example, the chord is a whole tone scale with one note raised a semitone (the "almost whole-tone" hexachord, sometimes identified as "whole tone-plus"), and this alteration allows for a greater variety of resources through transposition."The Evolution of Twelve-Note Music", p.56. Oliver Neighbour. Proceedings of the Royal Musical Association, 81st Sess. (1954–1955), pp. 49–61. Leonid Sabaneev interpreted the Prometheus chord as harmonics 8 through 14, without 12 (1, 9, 5, 11, 13, 7 = C, D, E, F, A, B), but the 11th harmonic is 48.68 cents away from the tritone (F), the 13th harmonic is 59.47 cents away from a major sixth (A).
|
|
Ukraine will also ensure that its relevant national bodies participate fully in the European and international organisations for standardisation, legal and fundamental metrology, and conformity assessment including accreditation in accordance with its area of activity and the membership status available to it. Ukraine will also progressively transpose the corpus of European standards (EN) as national standards, including the harmonised European standards. Simultaneously with such transposition, Ukraine will withdraw conflicting national standards, including its application of interstate standards (GOST/ГОСТ), developed before 1992. In addition, Ukraine will progressively fulfill the other conditions for membership, in line with the requirements applicable to full members of the European Standardisation Organisations.
|
|
Lidenbrock deduces that the message is a transposition cipher, but achieves results no more meaningful than the baffling original. Professor Lidenbrock locks everyone in the house and forces himself, Axel, and Martha the maid to go without food until he cracks the code. Axel discovers the answer when fanning himself with the deciphered text: Lidenbrock's deciphering was correct but simply needed to be read backward in order to reveal a paragraph written in rough Latin. Axel tries to hide his discovery from Lidenbrock, afraid of the professor's maniacal reactions, but after two days without food, he knuckles under and reveals the secret to his uncle.
|
|
Some musicians are encouraged to learn to read directly onto one whistle, while others are taught to read directly onto another. The whistle player who wants music to read on to all whistles will need to learn the mechanics of written transposition, taking music with one key signature and rewriting it with another. Tablature notation for the tin whistle is a graphical representation of which tone holes the player should cover. The most common format is a vertical column of six circles, with holes to be covered for a given note shown filled with black, and a plus sign (+) at the top for notes in the second octave.
|
|
Mutations in the ZFPM2 gene are responsible for rare and sporadic cases of congenital heart disease. These include cases of Tetralogy of Fallot, truncus arteriosus, failure to from the pulmonary artery valve combined with ventricular septal defect, double outlet right ventricle, transposition of the great arteries, and interrupted aortic arch. Sporadic cases of Tetralogy of Fallot were also found in cases where the levels of Hypermethylation at CpG sites in the ZFPM2 gene promoter were greatly elevated; these cases were associated with decreases cardiac tissue levels of mRNA for ZFPM2. These cases likely reflect the role of ZFPM2 in promoting GATA4's function in the embryonic development of the heart.
|
|
According to the biographer Bernard Violet as well as to journalist Caroline Bee, the video could contain a political message throughout the metaphorical transposition of the revolution of October 1917, and every character would represent a category of people or ideas;Bee, 2006, pp. 340-43. the scene in which Tristana is falling on a snowy slope refers to the fall of a cradle in the stairs in the 1925 silent film The Battleship Potemkin.Violet, 2004, p. 80. The video, in its production as well as in its theme, is a real tribute to the revolutionary Soviet Russian film director and film theorist Sergei Eisenstein.
|
|
Much like other characterized transposons, the mechanism for Tn7 transposition involves cleavage of the 3' ends from the donating DNA by the TnsA protein of the TnsAB transposase. However, Tn7 is also uniquely cleaved near the 5' ends, about 5 bp from the 5' end towards the Tn7 transposon, by the TnsB protein of TnsAB. After the insertion of the transposon into the target DNA site, the 3' ends are covalently linked to the target DNA, but the 5 bp gaps are still present at the 5' ends. As a result, repair of these gaps leads to a further 5 bp duplication at the target site.
|
|
In the language of combinatorics, the Forte numbers correspond to the binary bracelets of length 12: that is, equivalence classes of binary sequences of length 12 under the operations of cyclic permutation and reversal. In this correspondence, a one in a binary sequence corresponds to a pitch that is present in a pitch class set, and a zero in a binary sequence corresponds to a pitch that is absent. The rotation of binary sequences corresponds to transposition of chords, and the reversal of binary sequences corresponds to inversion of chords. The most compact form of a pitch class set is the lexicographically maximal sequence within the corresponding equivalence class of sequences.
|
|
On January 1, 2013, EU Directive 2010/63/EU "on the protection of animals used for scientific purposes" entered into force for the EU Member States (MS), repealing Directive 86/609/EEC. Because it is a Directive, it allows Member States certain flexibility in transposition of national rules. The status of the implementation of the new Directive in the EU is described by the EC General Environment Directorate. :Article 1.3: The new EU Directive applies to the following animals: (a) live non-human vertebrate animals, including: (i) independently feeding larval forms; and (ii) foetal forms of mammals from the last third of their normal development; (b) live cephalopods.
|
|
The mechanisms involved include gene conversion, unequal crossing-over, transposition, slippage replication and RNA-mediated exchanges. Because mutations changing the sequence of one copy are less common than deletions, duplications and replacement of one copy by another, the copies gradually come to resemble each other much more than they would if they had been evolving independently. Concerted evolution can be unbiased, in which case every version has an equal probability of being the one that replaces the others. However, if the molecular events have any bias favouring one version of the sequence over others, that version will dominate the process and eventually replace the others.
|
|
Astronaut Office Chief Deke Slayton had warned the crew that they were all "expendable", and that any extramarital affairs must not become public. Eisele remained on the crew, and on October 11, 1968, Apollo 7 was launched on an 11-day mission—the first crewed flight test of the third generation United States spacecraft. By this time, the Senior Pilot title was changed to Command Module Pilot. Together with spacecraft commander Schirra and Lunar Module Pilot Cunningham, Eisele performed simulated transposition and docking maneuvers with the upper stage of their Saturn IB launch vehicle, and acted as navigator, taking star sightings and aligning the spacecraft's guidance and navigation platform.
|
|
Among the most prominent of these operations are the duodenal-jejunal bypass and ileal transposition where duodenal switch is a part of the operation. The following observations were reported on the resolution of obesity related comorbidities following the duodenal switch: type 2 diabetes 99%, hyperlipidemia 99%, sleep apnea 92%, and hypertension 83%. Because the pyloric valve between the stomach and small intestine is preserved, people who have undergone the DS do not experience the dumping syndrome common with people who've undergone the Roux-en-Y gastric bypass surgery (RNY). Much of the production of the hunger hormone, ghrelin, is removed with the greater curvature of the stomach.
|
|
The same effect is used in instrumental tunes, in which a solo instrument does a melodic line and then there is a "response" from the horn section or rhythm section. capo : A clip-on metal or plastic device with a rubber-padded bar that holds down all six strings of the guitar in a fret position selected by the performer. It is attached with an elastic or spring-loaded mechanism. It allows a guitar player to have the open strings start at a higher pitch, thus facilitating the transposition of songs and the use of the "ringing", rich sound of open chords in unusual keys.
|
|
He has been an observer of the historical meeting between the Chinese tradition and the western contemporary society in the early 21st century. In 2013, he declares to the Il Sole 24 Ore that contemporary Chinese society and architecture are "seeking the contemporary transposition of its millenary traditionIl Sole 24 Ore Arredo, l'Italia insegue la Germania sul mercato cinese". Moreover, he's the author of many articles of "L'Arca International" magazine.Arca International L'Arca In his academic research he defines and investigates the hybrid modular systems concepts in terms of process innovation linked with the ongoing deep changes of life styles and housing habits in our contemporaneity.
|
|
Arnold was the author of 120 articles in the fields of histology and pathological anatomy.Julius Arnold @ Who Named It With Austrian pathologist, Hans Chiari, his name is lent to a condition known as Arnold–Chiari malformation, a disorder that takes place when the cerebellar tonsils and the medulla oblongata protrude through the foramen magnum into the spinal canal, without displacing the lower brain stem.Arnold-Chiari malformation @ Who Named It Arnold described his pathological findings associated with the disorder from an infant who died shortly after delivery. He published his account of the disorder in an 1894 paper titled "Myelocyste, Transposition von Gewebskeimen und Sympodie".
|
|
In the late 20th and into the 21st century, significant interest has developed in representing sheet music in a computer-readable format (see music notation software), as well as downloadable files. Music OCR, software to "read" scanned sheet music so that the results can be manipulated, has been available since 1991. In 1998, virtual sheet music evolved further into what was to be termed digital sheet music, which for the first time allowed publishers to make copyright sheet music available for purchase online. Unlike their hard copy counterparts, these files allowed for manipulation such as instrument changes, transposition and MIDI (Musical Instrument Digital Interface) playback.
|
|
Kurosawa's next project, Throne of Blood, an adaptation of William Shakespeare's Macbeth—set, like Seven Samurai, in the Sengoku Era—represented an ambitious transposition of the English work into a Japanese context. Kurosawa instructed his leading actress, Isuzu Yamada, to regard the work as if it were a cinematic version of a Japanese rather than a European literary classic. Given Kurosawa's appreciation of traditional Japanese stage acting, the acting of the players, particularly Yamada, draws heavily on the stylized techniques of the Noh theater. It was filmed in 1956 and released in January 1957 to a slightly less negative domestic response than had been the case with the director's previous film.
|
|
These include a gene that confers resistance to particular antibiotics (ampicillin is most frequently used for bacterial strains), an origin of replication to allow the bacterial cells to replicate the plasmid DNA, and a suitable site for cloning (referred to as a multiple cloning site). DNA structural instability can be defined as a series of spontaneous events that culminate in an unforeseen rearrangement, loss, or gain of genetic material. Such events are frequently triggered by the transposition of mobile elements or by the presence of unstable elements such as non-canonical (non-B) structures. Accessory regions pertaining to the bacterial backbone may engage in a wide range of structural instability phenomena.
|
|
ADFGVX was cryptanalysed by French Army Lieutenant Georges Painvin, and the cipher was broken in early June 1918. The work was exceptionally difficult by the standards of classical cryptography, and Painvin became physically ill during it. His method of solution relied on finding messages with stereotyped beginnings, which would fractionate them and then form similar patterns in the positions in the ciphertext that had corresponded to column headings in the transposition table. (Considerable statistical analysis was required after that step had been reached, all done by hand.) It was thus effective only during times of very high traffic, but that was also when the most important messages were sent.
|
|
In Earth orbit, the crew faced minor technical issues, including a potential problem with the environmental control system and the S-IVB third stage's attitude control system, but eventually resolved or compensated for them as they prepared to depart towards the Moon. After two orbits, the rocket's third stage reignited for just over five minutes, propelling the craft towards the Moon at about . Six minutes after the burn of the S-IVB, the command and service module, containing the crew, separated from the rocket and traveled for before turning around and retrieving the lunar module from inside the expended rocket stage. The maneuver, known as transposition, docking, and extraction, went smoothly.
|
|
Transposition pylon of power line for single-phase AC traction current (110 kV, 16.7 Hz) near Bartholomä in Germany. A traction network or traction power network is an electricity grid for the supply of electrified rail networks. The installation of a separate traction network generally is done only if the railway in question uses alternating current (AC) with a frequency lower than that of the national grid, such as in Germany, Austria and Switzerland. Alternatively, the three-phase alternating current of the power grid can be converted in substations by rotary transformers or static inverters into the voltage and type of current required by the trains.
|
|
The euphonium, like the tenor trombone, is pitched in concert B. For a valved brass instrument like the euphonium, this means that when no valves are in use the instrument will produce partials of the B harmonic series. It is generally orchestrated as a non-transposing instrument like the trombone, written at concert pitch in the bass clef with higher passages in the tenor clef. Treble clef euphonium parts transposing down a major ninth are included in much concert band music:The major-ninth is transposition for the sake of trumpet players doubling on euphonium. in the British-style brass band tradition, euphonium music is always written this way.
|
|
Later, HEFCE admitted that it had made a transposition error, and that in fact, 73 per cent of state school graduates gained a first or upper second class degree compared with 82 per cent of independent school graduates. This admission attracted far less publicity than the original erroneous assertion. Across all English universities, state school students who scored two Bs and a C at A-level did on average eight per cent better at degree level than their privately educated counterparts. However, two Bs and a C represents an entry tariff of 112, well below the average demanded by any of the UK's Russell Group universities.
|
|
In addition an exchange of initial experiences and resolutions was coordinated in order to identify good practicesWebsite about BSS transposition, ESR, retrieved on March 26th 2020. MEDIRAD, is one of the current projects EFOMP is involved in during its preparation phase started by the European Union in 2017 dealing with implications of medical low dose radiation exposure. EFOMP is in the advisory panel of the project and participates in work package six in order to formulate policy recommendations for the effective protection of patients and medical workers and the general publicWebsite of MEDIRAD, European Institute for Biomedical Imaging Research (EIBIR), retrieved on March 26th 2020.
|
|
Part II of the Act creates a series of performers' rights in application of the Rome Convention for the Protection of Performers, Producers of Phonograms and Broadcasting Organisations of 1961. These rights are retrospective in respect of performances before commencement on 1 August 1989 (s. 180). These rights have been largely extended by the transposition of European Union directives and by the application of the WIPO Performances and Phonograms Treaty: the section below describes only the rights which were created by the Copyright, Designs and Patents Act 1988 itself. A performer has the exclusive right to authorise the recording and/or broadcast of his performances (s. 182).
|
|
For search algorithms such as NegaScout or MTD(f) to perform efficiently, the transposition table must work well. Otherwise, for example when a hash-collision occurs, a subtree will be re-expanded. When MTD(f) is used in programs suffering from a pronounced odd-even effect, where the score at the root is higher for even search depths and lower for odd search depths, it is advisable to use separate values for f to start the search as close as possible to the minimax value. Otherwise, the search would take more iterations to converge on the minimax value, especially for fine grained evaluation functions.
|
|
"All recordings available at the time of writing contradict Universal Edition by transposing the horns down an octave further than that of the interval of the second shown in the published score." Hodgson was quite confused about horn transposition; horn players since the time of Bach, Handel and Vivaldi had been playing their parts down an octave from written pitch, per instructions from these composers. Writing one octave higher than the intended pitch was a notational convention which helped composers avoid constant ledger lines and awkward placing of music. A careful analysis of 46 shows that the composer intended B basso, or one octave and a step below written pitch.
|
|
This technique also allows immediate array transposition, index reversal, subsampling, etc. For languages like C, where the indices always start at zero, the dope vector of an array with d indices has at least 1 + 2d parameters. For languages that allow arbitrary lower bounds for indices, like Pascal, the dope vector needs 1 + 3d entries. If the array abstraction does not support true negative indices (as for example the arrays of Ada and Pascal do), then negative indices for the bounds of the slice for a given dimension are sometimes used to specify an offset from the end of the array in that dimension.
|
|
Scarnati 1996, pp. 99–111(score publication) Voxman 1977 Another transcription of the concerto, as concerto a 5 for oboe, strings and continuo in C minor, is found in a 1717 manuscript. The type of errors in this manuscript seems to suggest that the transposition from D minor to C minor may have been produced by its scribes while copying. This manuscript writes the composer's name as "Marcello" without specifying a first name: as Alessandro's brother Benedetto was far better known as a composer by the name Marcello, later generations would interpret the title of the manuscript as referring to the better known of the "Marcello" composers.
|
|
In this model, portions of genes or non-coding regions can accidentally serve as templates during repair of double stranded breaks (DSBs) occurring in Helitrons during their transposition. Low-fidelity repair of DSB by Non-Homologous End Joining is more frequent in plants and mammals than repair through homologous recombination, and is often accompanied by insertions of 100–4000 bp long “filler DNA” copied from diverse genomic or extra-chromosomal DNA regions into DSB. This model predicts that 2 to 8 bp regions of microhomology exist between the regions that flank the DSB in the Helitron and that flank the original host sequence captured by the Helitron.
|
|
The Stonewall Attack is a chess opening characterized by White (generally) playing their pawns to d4 and e3, playing Bd3, Nd2, and then playing pawns to c3 and then f4; although the moves are not always played in that order (see transposition). The Stonewall is a system; White heads for a very specific pawn formation, rather than trying to memorize long lines of different variations. If White puts up the Stonewall formation it is called the Stonewall Attack, regardless of how Black chooses to defend against it. When Black sets up a Stonewall formation, with pawns on c6, d5, e6 and f5, then it is a variation of the Dutch Defense.
|
|
He also worked on several Czechoslovakian bigraphic procedures (Polygraphic substitution), and on breaking the Czechoslovakian Air Force double-transposition, where the message count only amounted to 10-25 messages per day. Voegele was known to have worked on a number of cyphers during the course of the war. These included the Government Telegraph Code, India Code, Syko, the RAF 4-digit code, Aircraft Movement Code in Autumn 1942, Bomber Code in Winter 1942, January 1943, Slidex in May 1943, Aircraft Reporting Code from July 1943, UCO Weather Code from May 1944 and Weather Codes throughout the war. Typex was attempted by Voegele in the early 1940s.
|
|
Though a similar harmonic resonance is achieved by playing nearly any series of four perfect fourths and a major third, the ubiquitous chord is most frequently spelled as above in Ginastera's compositions, regardless of the tonal center (or lack thereof) of the piece in which the chord appears. Consequently, if "Triste" is to be performed in transposition, the performers must consider the specific sonority of the E-A-D-G-B-E chord and whether it too should be transposed or left as written. 3\. Zamba With no relation to the Brazilian samba, the Argentine zamba is a graceful eighteenth century scarf dance of Peruvian origin.
|
|
Compression: The more common characters are encoded by only one character, instead of two, this reduces the ciphertext size and potentially the cipher's proneness to a frequency attack. Fractionation: Unlike in the Polybius Square (where every character is represented by a pair of digits), a straddling checkerboard will not encrypt each character with the same number of ciphertext digits. This makes it harder for a cryptanalysts to determine the boundaries between plaintext characters. This may be combined with a transposition (as it is in the VIC cipher) in order to locate the ciphertext letters of the same plaintext character at unknown locations in the ciphertext.
|
|
In fortran, a do-statement's start such as `DO 12 I = 1,15` is distinguished from `DO 12 I = 1.15` (an assignment of the value 1.15 to a variable called `DO12I`; recall that spaces are irrelevant) only by the difference between a comma and a full stop, and a printed listing's glyphs may not be well-formed. Careful attention to the design of a language can promote clarity and simplicity of expression with a view to creating a reliable compiler whose behaviour is easily understandable. Yet poor choices are common. For example, Matlab denotes matrix transposition by using an apostrophe as in A' which is unexceptionable and closely follows mathematical usage.
|
|
Issue 482, vol 25, no 2. p. 64. January 15, 1999. p. 64. An example of his transposition is when he played a regular C-note as an A-note on the Alto/Baritone saxophone with an A♯-note for the tenor, while the piano and guitars played their original notes and chord progression as written.Nott, p.83. He collaborated with several other Sun musicians in their songs, including with Jerry Lee Lewis in "I'll Sail My Ship Alone" and "Hang Up My Rock And Roll Shoes," with Roy Orbison in “I Like Love” and "The Fools' Hall of Fame,"Anglares, pp. 14, 18.
|
|
At a higher level, large chromosomal segments undergo duplication, lateral transfer, inversion, transposition, deletion and insertion. Ultimately, whole genomes are involved in processes of hybridization, polyploidization and endosymbiosis, often leading to rapid speciation. The complexity of genome evolution poses many exciting challenges to developers of mathematical models and algorithms, who have recourse to a spectrum of algorithmic, statistical and mathematical techniques, ranging from exact, heuristics, fixed parameter and approximation algorithms for problems based on parsimony models to Markov chain Monte Carlo algorithms for Bayesian analysis of problems based on probabilistic models. Many of these studies are based on the detection of sequence homology to assign sequences to protein families.
|
|
In response to Gide's criticism that he hid his actual sexuality within his novel, Proust told Gide that "one can say anything so long as one does not say 'I'."Lucey. Ibid. Proust's intimate relations with such individuals as Alfred Agostinelli and Reynaldo Hahn are well-documented, though Proust was not "out and proud," except perhaps in close-knit social circles. In 1949, the critic Justin O'Brien published an article in the PMLA called "Albertine the Ambiguous: Notes on Proust's Transposition of Sexes" which proposed that some female characters are best understood as actually referring to young men. Strip off the feminine ending of the names of the Narrator's lovers—Albertine, Gilberte, Andrée—and one has their masculine counterpart.
|
|
Transposition of both Ac and Ds occurs during development of a tissue and is under precise control which is determined by the number of Ac loci present, their organization, and their position in the chromosome complement. The transposable elements not only entirely remove or alter the gene function via insertion, but can also exert a mutator activity when they leave the position where they had visited the chromosome. Induced disturbances in quantity and organization of the heterochromatic elements of the chromosome could give rise to a series of alterations in its structure, behavior, and in genic reactions that can alter phenotypic expression. The Ac and Ds elements share two properties that are common for transposable elements.
|
|
To model the dynamics of transposable elements (TEs) within a genome, one has to realize that the elements behave like a population within each genome, and they can jump from one haploid genome to another by horizontal transfer. The mathematics has to describe the rates and dependencies of these transfer events. It was observed early on that the rate of jumping of many TEs varies with copy number, and so the first models simply used an empirical function for the rate of transposition. This had the advantage that it could be measured by experiments in the lab, but it left open the question of why the rate differs among elements and differs with copy number.
|
|
Patients who have undergone such surgical correction of the congenital transposition are exposed to long term risks of cardiovascular events. In particular sinus node dysfunction, atrial arrhythmias, ventricular arrhythmias including sudden cardiac arrhythmic death, heart failure due to anatomically right ventricular failure or venous obstruction at the level of the baffle or caval anatomy have been described. The high chance of developing arrhythmias results in up to 25% of patients who have undergone a Senning or Mustard procedure having a pacemaker by adulthood. Long term studies have disclosed that although from the functional capacity (NYHA Class) standpoint the Senning and the Mustard operation are similar, there is a higher risk of sinus node disease and arrhythmias with the latter.
|
|
It was shown that low temperature-dependent transposition was the cause of the methylation/demethylation of Tam3, not the other way around as previously believed. It was shown in a study that decreases in the methylation of Tam3 were found in tissue that was still developing at cooler temperatures, but not in tissue that was developed or grown in hotter temperatures. Antirrhinum majus has also been used to examine the relationship between pollinators and plants. With debate as to the evolutionary advantages the conical-papillate shape of flower petals, with arguments suggesting the shape either enhanced and intensified the color of the flower or aided in orienting pollinators through sight or touch.
|
|
It is on this basis that these medieval mentions are thought to be Barland. The first specific mention of a castle at the location was in the will and testament of Peter Skydmore, which made reference to a marriage agreement with Rice ap John ap Richard ap Madoc of "Barlondon and Burwaire within the lordship of the castle at New Radnor." Writing in the Radnorshire Society transactions journal in 1961, E.J.L. Cole proposed that Barlondon was a transposition of the sounds of Beraldon, with the change having taken place at some point between 1425 and 1450. By 1545, the castle was being referred to as "Barlonde" and had been mortgaged by John a'Madog to Roger Davies of Norton.
|
|
The comics later appeared in a large number of magazines and newspapers, including L'Unità, Il Corriere della Sera, Il Venerdì di Repubblica, Il Messaggero, L'espresso, Panorama, Cuore, TV Sorrisi e Canzoni. The comic strip is pretty autobiographical, and the title character, a middle-aged former Communist average man struggling with family, politics and hobbies, is a self-portrait of the same author.Stephen Gundle, Between Hollywood and Moscow: The Italian Communists and the Challenge of Mass Culture, 1943–1991, Duke University Press, 2000, pp.197-202. The same Staino starred in a live-action transposition of the comics, hosted in a segment of the television variety Drive In, in the 1984/1985 season.
|
|
The third stage remained attached to the spacecraft while it orbited the Earth one and a half times while astronauts and mission controllers prepared for translunar injection (TLI). Apollo 17 S-IVB rocket stage, shortly after transposition and docking with the Lunar Module This parking orbit was quite low by Earth orbit standards, and it would have been short-lived due to aerodynamic drag. This was not a problem on a lunar mission because of the short stay in the parking orbit. The S-IVB also continued to thrust at a low level by venting gaseous hydrogen, to keep propellants settled in their tanks and prevent gaseous cavities from forming in propellant feed lines.
|
|
In 1939 Enriquez bought a small bungalow, which he christened El Hurón Azúl (the Blue Ferret), in the Arroyo Naranjo district on the outskirts of Havana. This remained his home for the rest of his life. Here he painted El Rapto de las Mulatas (The kidnapping of the Mulatto Women), one of his most famous works, featured on a 1964 Cuban stamp. A transposition of the Rape of the Sabine Women to the Cuban fields, it is said that Enríquez had a horse brought to his workshop, tied Sara Cheméndez (his female model at the time) to the horse and had the animal lashed, in order to have a more realistic scene for the painting.
|
|
There is an alternative form of solfeggio which was called "the wisest or rather sophisticated parallage of Mr Ioannis Iereos Plousiadinos" (ἡ σοφωτάτη παραλλαγὴ κυρίου Ἰωάννου Ἰερέως τοῦ Πλουσιαδηνοῦ). It uses a crossing point and three ' into four directions. What makes this parallage wiser than the one of John Koukouzeles is simply, that it can be used for tetraphonia and for triphonia at the same time and without the use of any transposition. It does look for odd ways as well, how to change between the echoi (similar to the corrupted heptaphonia of the Koukouzelian wheel), but here the changes were rather based on more common combinations of different tetrachords mixing the diatonic with the chromatic or enharmonic genus.
|
|
The simplest form of triphonia was like as a permanent transposition of each tetrachord which always start on plagios tetartos (πλ δ') and ascends until the phthongos of tritos (γ'), passing through the tetrachord πλ δ῾, α῾, β῾, and finally γ῾ within three steps (τρεις φωναὶ, τριφωνία). The final note is always and at the same time (γ' = πλ δ'). In fact the ascending right branch from the x at the bottom left continues from the ' of (γ') in the center up to the ' of (β'), but another signature of (γ') is written aside as an alternative annotation of the same '. This parallage corresponds to a certain convention in the use of notation.
|
|
Bach recycled some of the preludes and fugues from earlier sources: the 1720 Klavierbüchlein für Wilhelm Friedemann Bach, for instance, contains versions of eleven of the preludes of the first book of the Well- Tempered Clavier. The C major prelude and fugue in book one was originally in C major – Bach added a key signature of seven sharps and adjusted some accidentals to convert it to the required key. In Bach's own time just one similar collection was published, by Johann Christian Schickhardt (1681–1762), whose Op. 30 L'alphabet de la musique, contained 24 sonatas in all keys for flute or violin and basso continuo, and included a transposition scheme for alto recorder.
|
|
From the beginning of Single Euro Payments Area (SEPA) on 28 January 2008, STEP2 has been offering SEPA Credit Transfer processing services across all SEPA countries. Since 2 November 2009, the transposition date of the Payment Services Directive, EBA Clearing has been processing SEPA Direct Debits with its STEP2 SDD Core and STEP2 SEPA Direct Debit ("Business to Business") services. Through its SEPA Credit Transfer and Direct Debit offerings, STEP2 provides banks across Europe with one channel through which they can send and receive their SEPA Credit Transfers and SEPA Direct Debits. The STEP2 platform reaches nearly 100 percent of all banks that have signed the SCT and SDD Scheme Adherence Agreements of the European Payments Council (EPC).
|
|
In advance of the film's release, as customary for the era, Signet Books published an "inferred" novelization of the script; meaning it wasn't identified as such, per se, but the publication date and the copyright assigned to Embassy Pictures Corporation mark it as a work derived from the screenplay. In this case, the screenwriters did their own adapting, Les & Tina Pine by-lined under their unmarried names, Les Pine and Tina Rome. At 128 pages of very small print—also common for the era, especially for media tie-ins—their book represents a thorough transposition from lean script to fleshed out novel, reconceiving the story in a deeply internalized and highly stylized fashion. The cover price was 60¢.
|
|
It was said the companies each had a proper safety policy but lacked an integrated safety culture. Safety was too often only a concern of front-line personnel instead of being subject to systemic planning and risk analysis. The further development of a complete safety culture was considered to be necessary, given the future challenges expected for the railways. Additionally, other problems cited were a problematic transposition of European directives regarding railways and rail safety into national law, insufficient resources for the Railway Safety and Interoperability Service, an unclear division of responsibilities between the Service and Infrabel, and a lack of cooperation between the Service and the Investigation Body for Railway Accidents and Incidents.
|
|
This freedom allows the designer to choose the update functions or S-boxes that satisfy all other cryptographic criteria and even choose arbitrary or key-dependent update functions (see family keying). Hardware-efficient lightweight T-functions with identical widths of all the update functions for each bit of the state can thus be easily constructed. The core accumulators of VEST ciphers are a good example of such reasonably light-weight T-functions that are balanced out after 2 rounds by the transposition layer making all the 2-round feedback functions of roughly the same width and losing the "T-function" bias of depending only on the less significant bits of the state.
|
|
Hanson called this the isomeric relationship, and defined two such sets as isomeric.Hanson, Howard (1960). Harmonic Materials of Modern Music (New York: Appleton-Century-Crofts), p. 22\. . See: isomer. According to Michiel Schuijer (2008), the hexachord theorem, that any two pitch-class complementary hexachords have the same interval vector, even if they are not equivalent under transposition and inversion, was first proposed by Milton Babbitt, and, "the discovery of the relation," was, "reported," by David Lewin in 1960 as an example of the complement theorem: that the difference between pitch-class intervals in two complementary pitch-class sets is equal to the difference between the cardinal number of the sets (given two hexachords, this difference is 0).
|
|
This recurring note is regarded as the central pitch of the row. Each of the five sections uses a different transposition of this series, with central pitches (in the bass- clarinet version) on D, E, A, G, and A, which are the fifth through ninth notes of the original (prime form) of the Klang series. Each of these 25-note cycles is then subdivided into five groups of 3, 4, 5, 6, and 7 notes, permuted differently in each cycle, resulting in a total of twenty-five groups containing 125 notes. At the end, a final D is added as the 126th note, returning to the central pitch of the first cycle (Kohl 2012b, 479, 481).
|
|
Finnchu was son of Finnlug, a descendant of Eochaidh Muidhmeadhon, and an inhabitant of Cremorne, county of Monaghan, and his second wife Idnait (alternate spellings Iodhnait and Ionait), daughter of Flann, of the Ciannachta of Glen Geimhin.The Irish life and the Martyrology of Donegal make him son of Finnlug, son of Setna, but in other authorities he is son of Setna . Finnchu was born and baptised at Mog-Ruth (Fermoy) in Munster, by Ailbe (Emly), and "a screpall, that is seven pennies of gold, paid as a baptismal fee". The form of his name given in the Calendar of Oengus is Chua, to which Finn (fair) being added makes Chua-finn, and by transposition Finnchua.
|
|
B clarinet is a transposing instrument. When the note C occurs in a score that is especially written for a B clarinet (top), the instrument will actually sound a B (bottom), hence the name of the instrument. The very same fingering when played on an A clarinet will sound an A, and in a score for A clarinet, an A will be written as a C. A transposing instrument is a musical instrument whose music is recorded in staff notation at a pitch different from the pitch that actually sounds (concert pitch). A written middle C (C4) on a transposing instrument produces a pitch other than C, and that pitch identifies the interval of transposition when describing the instrument.
|
|
This is normally only done when it is necessary to enact legislation for matters that are common to the Bailiwick as a whole (such as financial regulation or the transposition of UK and European legislation into the domestic law of all three jurisdictions). Examples of this are the Data Protection (Bailiwick of Guernsey) Law and the Human Rights (Bailiwick of Guernsey) Law. Guernsey has almost complete autonomy over internal affairs and certain external matters. However, the Crown - that is to say, the UK Government - retains an ill-defined reserved power to intervene in the domestic affairs of any of the five Crown Dependencies within the British Islands "in the interests of good government".
|
|
What is so special about this particular literary device is that in melitzah the sentences compounded out of quotations mean what they say; but below and beyond the surface they reverberate with associations to the original texts, and this is what makes them psychologically so interesting and valuable. In the transposition of a quotation from the original (in this case canonical) text to a new one, the meaning of the original context may be retained, altered, or subverted. In any case the original context trails along as an invisible interlinear presence, and the readers, like the writer, must be aware of these associations if they are to savor the new text to the full.
|
|
Her 1978 multimedia work, She, presented at the Hayward Gallery, London, in 1978 was an early example of performance that incorporated live video and slide projections. Transparencies of neon signs, poetry and images of shop windows featuring mannequins were projected on a wall before which Keane performed, while video of the performance played on monitors surmounted with neon texts. Keane has said that the work brought into play "the actual and the recorded, the shop dummy, and the person, the illusion and the reality" Transposition, first presented at the Museum of Modern Art, Vienna, in 1992, used the body as a screen with video projected onto the naked backs of men as they glide sideways standing on a travelator.
|
|
For instance, the seven natural pitch classes that form the C-major scale can be obtained from a stack of perfect fifths starting from F: :F—C—G—D—A—E—B Any sequence of seven successive natural notes, such as C–D–E–F–G–A–B, and any transposition thereof, is a diatonic scale. Modern musical keyboards are designed so that the white notes form a diatonic scale, though transpositions of this diatonic scale require one or more black keys. A diatonic scale can be also described as two tetrachords separated by a whole tone. The term diatonic originally referred to the diatonic genus, one of the three genera of the ancient Greeks.
|
|
Goldmann, in line with the novel-as-mirror-society ideology, says that he doubts the structure of the novel (degraded search for authentic values expressed through mediatization) was invented individually. More likely, it is a reflection of the social life of a group. This is where Goldmann introduces his thesis: “The novel form seems to me, in effect, to be the transposition on the literary plane of everyday life in the individualistic society created by market production. There is a rigorous homology between the literary form of the novel...and the everyday relation between man and commodities in general, and by extension between men and other men, in a market society” (7).
|
|
Each DAZ protein family member was discovered individually, over a period of time by different research groups. BOULE was first identified in Drosophila, with homologs being found in other organisms, from sea anemone to humans, DAZL is thought to have come from BOULE by a gene duplication event and was first discovered in mice, but is present in all vertebrates, and the Y-chromosomal DAZ gene was first found in infertile males, but is also present in apes and Old World monkeys. DAZ arose during primate evolution by (i) transposition (moving) from the autosomal gene to the Y chromosome, (ii) removing unwanted parts of Exons within the transposed gene and (iii) amplification (making multiple copies) of the modified gene.
|
|
Gautier, who started off as a painter, contributed much to the world of art criticism. Instead of taking on the classical criticism of art that involved knowledge of color, composition and line, Gautier was strongly committed to Denis Diderot's idea that the critic should have the ability to describe the art such that the reader might "see" the art through his description. Many other critics of the generation of 1830 took on this theory of the transposition of art – the belief that one can express one art medium in terms of another. Although today Gautier is less well known as an art critic than his great contemporary, Baudelaire, he was more highly regarded by the painters of his time.
|
|
The existence of this group was suggested by Bernd Fischer in unpublished work from the early 1970s during his investigation of {3,4}-transposition groups: groups generated by a class of transpositions such that the product of any two elements has order at most 4. He investigated its properties and computed its character table. The first construction of the baby monster was later realized as a permutation group on 13 571 955 000 points using a computer by Jeffrey Leon and Charles Sims, though Robert Griess later found a computer-free construction using the fact that its double cover is contained in the monster. The name "baby monster" was suggested by John Horton Conway.
|
|
Although it may now be accepted in the art world as a viable practice, it continues to arouse questioning, as with the Tate Gallery's Turner Prize exhibition of Tracey Emin's My Bed, which consisted literally of a transposition of her unmade and disheveled bed, surrounded by shed clothing and other bedroom detritus, directly from her bedroom to the Tate. In this sense the artist gives the audience time and a stage to contemplate an object. As such, found objects can prompt philosophical reflection in the observer ranging from disgust to indifference to nostalgia to empathy. As an art form, found objects tend to include the artist's output—at the very least an idea about it, i.e.
|
|
Rolling-Circle Mechanism for Helitron transposition and gene acquisition in the concerted modelHelitron could be either autonomous or non-autonomous. One transposase molecule cleaves at the donor (by the first tyrosine (Y1) residue of the Rep protein) and target sites (by the second tyrosine (Y2) residue) and binds to the resulting 5' ends. The free 3' OH in the target DNA attacks the DNA–Y1 bond and forms a bond with the donor strand resulting in strand transfer. Replication at the cleaved donor site initiates at the free 3' OH where the donor strand serves as a primer for DNA synthesis by host DNA polymerase and replication proceeds to displace one strand of the helitron.
|
|
Although written in the form of a conventional travel narrative, the Briefe constituted in fact a major contribution to the theoretical literature on art history. As Michael Podro has written, Schnaase's first book > is the principal transposition of Hegel's thought into the general > discussion of the development of art.... In his Niederländische Briefe > Schnaase responded to two difficulties in Hegel's Aesthetics; the assumption > that past works of art were definitively understood from the point of view > of the present, and that art was representative of its culture than > contributing to it. The way in which he did this dominated one critical > tradition for the next hundred years.M. Podro, The critical historians of > art (New Haven, 1982), 31.
|
|
Like many American films of the time, The Squaw Man was subject to restrictions and cuts by city and state film censorship boards. For example, the Chicago Board of Censors required a cut, in Reel 4, of the intertitle "By God, you've got to make her happy", the shooting of Cash Hawkins, the shooting of the man in an ambush, and the modification of the plot by the transposition of the scenes of baby moccasins, etc., to indicate that the marriage had taken place prior to when any intimacy between Naturich and Jim Wynnegate had taken place, which would include placing the intertitle "Send for the Justice of the Peace" before the moccasin scene.
|
|
Following an appeal from journalist Gavin Sheridan the Irish Office of the Commissioner for Environmental Information determined in September 2011 that NAMA was a public authority for the purposes of the Access to Information on the Environment (AIE) Regulations 2007, and was therefore obliged to answer AIE requests from applicants.Decision of Sheridan & NAMA text The Regulations in question were the Irish transposition of European Directive 2003/4/EC, an implementation of one element of the Aarhus Convention into EU law. NAMA disagreed with this decision and appealed to the High Court on a point of law. In February 2013 High Court judge Colm Mac Eochaidh ruled in favour of the Commissioner for Environmental Information.
|
|
Conventional histopathology is inherently subject to a certain degree of ambiguity due to the possibility of Specimen Provenance Complications (SPCs) resulting from instances of specimen transposition, extraneous/foreign cell contamination or misidentification of cells used in clinical or anatomical pathology. These types of errors are considered the most rapidly growing category of malpractice claims involving pathologists, and most claims involve a specimen switch between patients. In terms of frequency of occurrence, a 2013 study published in the American Journal of Clinical Pathology indicates that 0.93% of biopsies could be subject to an SPC. Furthermore, each case involves at least two individuals, so this error rate actually underestimates the percentage of patients potentially impacted by incidents of biopsy misidentification.
|
|
Mephisto) Chess machines/programs are available in several different forms: as stand-alone chess machines (usually a microprocessor running a software chess program, but sometimes as a specialized hardware machine), software programs running on standard PCs, web sites, and apps for mobile devices. Programs run on everything from super- computers to smartphones. Hardware requirements for programs are minimal: the apps are no larger than a few megabytes on disk, use a few megabytes of memory (but can use much more, if it is available), and any processor 300Mhz or faster is sufficient. Performance will vary modestly with processor speed, but sufficient memory to hold a large transposition table (up to several gigabytes or more) is more important to playing strength than processor speed.
|
|
He has received several grants and awards. In 2002 he was awarded the Fegersten Foundation Music Prize for his lifetime contribution to Norwegian music, and in 2015 the Ministry of Culture, Sports and Tourism in Hanoi honored him with a medal for his contribution to the development of the Vietnamese music life. 2015 saw Johnson editing the book Viet Nam Overtures, a collection of articles covering the history and development of Transposition. December 2016 saw Johnson being bestowed with Norwegian collecting society TONO´s Outreach Prize. Johnson has also been a board member for a number of Norwegian cultural institutions and organizations, and as of 2015 he is serving as Chairman of the Board for Oslo’s multicultural MELA Festival and the classical music festival Valdres Sommersymfoni.
|
|
He and another contributor to the magazine, journalist Tudor Teodorescu-Braniște, carried out a debate in the magazine's pages: Fondane's articles defended Romanian Symbolism against criticism from Teodorescu-Braniște, and offered glimpse into his personal interpretation of Symbolist attitudes. One piece he wrote in 1919, titled Noi, simboliștii ("Us Symbolists") stated his proud affiliation to the current (primarily defined by him as an artistic transposition of eternal idealism), and comprised the slogan: "We are too many not to be strong, and too few not to be intelligent."Tomescu (2005), p. 229–230 In May 1920, another of his Rampa contributions spoke out against Octavian Goga, Culture Minister of the Alexandru Averescu executive, who contemplated sacking George Bacovia from his office of clerk.
|
|
Olivier Messiaen in 1986 Olivier Eugène Prosper Charles Messiaen (, , ; December 10, 1908 – April 27, 1992) was a French composer, organist, and ornithologist, one of the major composers of the 20th century. His music is rhythmically complex; harmonically and melodically he employs a system he called modes of limited transposition, which he abstracted from the systems of material generated by his early compositions and improvisations. He wrote music for chamber ensembles and orchestra, vocal music, as well as for solo organ and piano, and also experimented with the use of novel electronic instruments developed in Europe during his lifetime. He travelled widely and wrote works inspired by diverse influences ranging from Japanese music, the landscape of Bryce Canyon in Utah and the life of St. Francis of Assisi.
|
|
Birdsong fascinated Messiaen from an early age, and in this he found encouragement from his teacher Dukas, who reportedly urged his pupils to "listen to the birds". Messiaen included stylised birdsong in some of his early compositions (including L'abîme d'oiseaux from the Quatuor pour la fin du temps), integrating it into his sound-world by techniques like the modes of limited transposition and chord colouration. His evocations of birdsong became increasingly sophisticated, and with Le réveil des oiseaux this process reached maturity, the whole piece being built from birdsong: in effect it is a dawn chorus for orchestra. The same can be said for "Epode", the five-minute sixth movement of Chronochromie, which is scored for eighteen violins, each one playing a different birdsong.
|
|
213 rather he concentrated on the theology of joy, divine love and redemption. Messiaen continually evolved new composition techniques, always integrating them into his existing musical style; his final works still retain the use of modes of limited transposition. For many commentators this continual development made every major work from the Quatuor onwards a conscious summation of all that Messiaen had composed up to that time. However, very few of these major works lack new technical ideas—simple examples being the introduction of communicable language in Meditations, the invention of a new percussion instrument (the geophone) for Des canyons aux etoiles..., and the freedom from any synchronisation with the main pulse of individual parts in certain birdsong episodes of St. François d'Assise.
|
|
ATCC27551 and Pseudomonas diminuta is highly conserved (100% sequence homology), although the plasmids where the genes are found have very different sequences apart from a 5.1Kb conserved region where the gene is found. A closer look on the organization of the opd gene from Flavobacterium suggests a potential transposon-like architecture, which accounts for the widespread distribution of the gene among other microbial species that might have occurred through lateral DNA transfer. The opd gene is flanked by transposition insertion sequences, characteristic of Tn3 family of transposons. Moreover, a transposase-like sequence (homologous to TnpA) and a resolvase-like sequence (homologous to TnpR) were also identified in regions upstream of the opd gene, which are characteristics of class II transposons such as Tn3.
|
|
42, 63 While technical improvements and an equal-tempered scale reduced the need for two clarinets, the technical difficulty of playing in remote keys persisted, and the A has thus remained a standard orchestral instrument. In addition, by the late 19th century, the orchestral clarinet repertoire contained so much music for clarinet in A that the disuse of this instrument was not practical. Attempts were made to standardise to the B instrument between 1930 and 1950 (e.g., tutors recommended learning routine transposition of orchestral A parts on the B clarinet, including solos written for A clarinet, and some manufacturers provided a low E on the B to match the range of the A), but this failed in the orchestral sphere.
|
|
With the Senning surgical repair, a baffle – or conduit - is created within the atria that reroutes the deoxygenated blood coming from the inferior and superior venae cavae to the mitral valve and therefore to the pulmonary circulation In the Footsteps of Senning: Lessons Learned From Atrial Repair of Transposition of the Great Arteries. Review Dodge-Khatami A, Kadner, A , Berger F, et al.Ann Thorac Surg 2005;79:1433-1444 This is accomplished by creating a systemic venous conduit that channels deoxygenated blood from the superior and inferior vena cava towards the mitral valve. After this complex plastic reconstruction using flaps from the right atrial tissue and the interatrial septum and lets the oxygenated pulmonary venous blood flow to the tricuspid valve and from there to the systemic circulation.
|
|
While working with Beckwith at Harvard, Shapiro was part of the first team to isolate a single gene from an organism. The gene they isolated was lacZ, which codes for the β-galactosidase enzyme used by E. coli bacteria to digest the sugars in milk. Their technique involved transduction of two complementary copies of the gene into two different bacteriophages, then mixing the genetic material from the two phages, and finally using a nuclease to degrade the single-stranded phage genome, leaving only the double-stranded DNA formed by the two copies. In a paper published in the Proceedings of the National Academy of Sciences in 1979, Shapiro was the first to propose replicative transposition as a mechanism for gene mobility.
|
|
This transposition (μεταβολή κατὰ τόνον) causes a shift of the ambitus about two pentachords higher, which is the interval of a major ninth, and prepares the melos within the tetartos octave G—d—g with the upper tetrachord (δ' d—α' e—β' f sharp—γ' g). Today, psaltes are most familiar with the virtuosic salto into the upper octave g in the "fast sticheraric" composition of Petros Peloponnesios. This most abridged version is also the most effective. The voice gets not tired within the upper register, because the singer just jumps only once and for a short moment into the upper tetrachord, so it gives the impression to sing the tetartos melos one octave higher (in fact, not higher than the upper third).
|
|
In that same operation the transposition of this carillon was unfortunately raised: whereas the instrument at first transposed down a major second, its 51 bells now speak at concert pitch. The bells of Soldiers' Tower Carillon range in weight from 23 pounds to the bourdon's 4 tons, and are performed on special occasions such as convocation, reunions, homecoming and Remembrance Day in addition to regular recitals attended by university members and the general public. Remembrance Day Ceremonies at the University of Toronto are held yearly, on or about the 11th of November, with representatives from many Canadian institutions laying wreaths at the foot of the Soldier's Tower in honour of alumni who, as soldiers, made the ultimate sacrifice during WWI and WWII.
|
|
The practice of psaltic art and the disposition of the echoi through which a certain composition had to pass, can be studied by the kalophonic method of doing the thesis of the sticheraric melos.See the kalophonic composition over the model of the sticheron τῷ τριττῷ τῆς ἐρωτήσεως for 29 June (Gerlach 2009, pp. 319-380). The psaltes skilled in the psaltic art usually opened his performance by an extended enechema which recapitulated the disposition of all the echoi which the kalophonic melos had to pass through. Usually the disposition was simple and did not change by the use of transposition, but some more complex stichera did as well and the tetraphonic system allowed always a new disposition between plagios and kyrios of a certain echos.
|
|
After re- translating the original code, Johnson realizes by transposition the entity's name should be "Harry" (Adams). Johnson hypothesizes that the sphere is an object which allows a person's subconscious thoughts to manifest in reality, and Harry Adams has acquired the power through entering it. (Confirmed by his childhood fear of squid, especially the giant squid in the novel Twenty Thousand Leagues Under the Sea, manifested in the form of a vast number of small squid and later a giant squid that attacks the DH-8 Habitat.) Johnson and Halpern sedate Adams and wait for contact to be re-established with the surface, but the manifestations continue. Halpern accuses Johnson of having entered the sphere and gaining access to the power.
|
|
Although musical set theory is often thought to involve the application of mathematical set theory to music, there are numerous differences between the methods and terminology of the two. For example, musicians use the terms transposition and inversion where mathematicians would use translation and reflection. Furthermore, where musical set theory refers to ordered sets, mathematics would normally refer to tuples or sequences (though mathematics does speak of ordered sets, and although these can be seen to include the musical kind in some sense, they are far more involved). Moreover, musical set theory is more closely related to group theory and combinatorics than to mathematical set theory, which concerns itself with such matters as, for example, various sizes of infinitely large sets.
|
|
The Royal Road went toward the Church of Nossa Senhora da Candelária, in downtown Rio de Janeiro, before passing over the Freguesia de São João do Orago do Rio Merity, by the port of Pavuna, by Inhaúma and the Freguesia de Nossa Senhora da Apresentação do Irajá. These paths formed for a long time the best option to enter the land of the Recôncavo Fluminense, as access was difficult due to the large amount of wetlands and rivers of considerable width. To establish the route of the Estrada Real, were considered the best spots for transposition of the Saratoga and Meriti, noting where these rivers formed bars. The colonization of the area required to route the flow of production of the mills.
|
|
In Fazlullah's study, patients with parietal lesions were blindfolded and tested for tactile-amorphosynthesis by applying simultaneous stimulation on both sides of the body. Patients were then asked to report on the size, shape and nature of the presented object. Results determined that patients with a right parietal lobe lesions presented symptoms such as anosognosia, hemiasomatognosia, metamorphognosia, corporeal agnosia, phantom sensations, transposition of parts of the body, constructional apraxia, disorientation of space, agnosia of the left portion of space, anaesthoagnosia, and Balint optic ataxia, while patients with left parietal lobe lesions presented symptoms such as Gerstmann syndrome, parietal apraxia and construction apraxia. Other patients with symptoms of Tactile- Amorphosynthesis showed signs of lobe lesions in the sensory tract and the spinal cord glioma.
|
|
Eagle was launched with Columbia on July 16, 1969 atop a Saturn V launch vehicle from Launch Complex 39A, and entered Earth orbit 12 minutes later. The LM was pushed onto its trajectory toward the Moon with the trans-lunar injection (TLI) burn. About 30 minutes later, the transposition, docking, and extraction maneuver was performed, which extracted the LM from the S-IVB upper stage. Eagle entered lunar orbit on July 19, 1969. On July 20, Neil Armstrong and Buzz Aldrin entered into the LM and separated it from CSM. Five minutes into the descent burn, and above the surface of the Moon, the LM guidance computer (LGC) distracted the crew with the first of several unexpected 1201 and 1202 program alarms.
|
|
However, the presence of many tightly grouped shapes in the Voynich manuscript (such as "or", "ar", "ol", "al", "an", "ain", "aiin", "air", "aiir", "am", "ee", "eee", among others) does suggest that its cipher system may make use of a "verbose cipher", where single letters in a plaintext get enciphered into groups of fake letters. For example, the first two lines of page f15v (seen above) contain "" and "", which strongly resemble how Roman numbers such as "CCC" or "XXXX" would look if verbosely enciphered. The theory that the encryption system started from a fundamentally simple cipher and then was augmented by adding nulls (meaningless symbols), homophones (duplicate symbols), transposition cipher (letter rearrangement), false word breaks, and more is also entirely possible.
|
|
The Committee on European Affairs and Oversight of the European Funds (CEAOEF) is one of the 17 standing committees in the 41st National Assembly of the Republic of Bulgaria. The Committee is in charge of the accurate transposition of the European Union's legislation, the examination of draft legislative proposals of the EU and of the oversight of the spending of the European funds in Bulgaria. Through CEAOEF, the National Parliament participates in the political dialogue with institutions of the EU regarding recent issues on the EU political agenda and exercises its new powers according to the Treaty of Lisbon. Regular meetings of the Committee take place every Wednesday in the building of the National Assembly on Knqz Alexander I blvd.
|
|
Eerdmans paperback edition (1965) The Weight of Glory and Other Addresses is a collection of essays and addresses on Christianity by C.S. Lewis. It was first published as a single transcribed sermon, "The Weight of Glory" in 1941, appearing in the British journal, Theology, then in pamphlet form in 1942 by Society for Promoting Christian Knowledge, London. It was published in book form in 1949, as a compilation of five addresses, in London by Geoffrey Bles under the title Transposition and Other Addresses and in the U.S. by The MacMillan Company under the title The Weight of Glory and Other Addresses. A revised and expanded edition featuring four additional essays and an Introduction by Walter Hooper was published by Macmillan Publishers in 1980.
|
|
The Ordo is issued with the authority of the bishop or bishops concerned, and is binding on the clergy in their jurisdiction. Religious orders in the diocese usually have their own directories which, in the case of the larger orders, often differ according to the state in which they are present. For secular clergy the calendar of the Roman Missal and Roman Breviary, apart from special privilege, always forms the basis of the Ordo recitandi. To this the feasts celebrated in the diocese are added, and, as the higher grade of these special celebrations often causes them to take precedence of those in the ordinary calendar, a certain amount of shifting and transposition is inevitable, even apart from the complications caused by the movable feasts.
|
|
Other than these works few articles have been written on Petrarch's epic poem in English, however there have been various serious scholarly works written in the twentieth and twenty-first centuries in French, Italian, and German. To Petrarch, his Africa was his croce e delizia for the rest of his life. Petrarch set great store by Africa and his other classicizing works, but the epic was not particularly well-received because of the literary transposition from Livy; the two parts of the death of Magone and the love story of Sofonisba have been rather better received. Historians show how it was quite likely that Petrarch met Chaucer and that the Africa and other of Petrarch's works influenced works of Chaucer, especially certain episodes of Canterbury Tales.
|
|
" More critically, he thought that the plot's "glaring flaw" was the immediate transposition of events from Egypt to India, also believing that the inclusion of British colonialists as the antagonists made "partial amends" for the colonialist attitude displayed by Tintin in Tintin in the Congo. Michael Farr thought that Tintin was "a maturer hero" in Cigars, being more of a detective than a reporter. He thought that the dream sequence was "one of the most imaginative and disturbing scenes" in the series, illustrating Hergé's "growing virtuosity with the medium." He also praised the scenes set in the Indian colonial bungalow, commenting that it was "claustrophobic and sinisterly dramatic" and worthy of the work of Agatha Christie, opining that the car chase provided "a highly cinematic ending.
|
|
In conductors' scores and other full scores, music for transposing instruments is generally written in transposed form, just as in the players' parts. Some composers from the beginning of the 20th century onward have written orchestral scores entirely in concert pitch, e.g. the score of Sergei Prokofiev's Piano Concerto No. 1 in D. The names of transposing instruments use flats instead of sharps (thus there are instruments in E or in B, but not in D or in A). In practice the actual transposition in the score may (for the convenience of the player) depend on the key of the music. For example, in a section in C major an E alto saxophone part will appear in A major (three sharps).
|
|
Medial crooks, inserted in the central portion of the instrument, were an improvement devised in the middle of the 18th century, and they could also be made to function as a slide for tuning, or to change the pitch of the fundamental by a semitone or tone. The introduction of valves made this process unnecessary, though many players and composers found the tone quality of valved instruments inferior (Richard Wagner sometimes wrote horn parts for both natural and valved horns together in the same piece). F transposition became standard in the early 19th century, with the horn sounding a perfect fifth below written pitch in treble clef. In bass clef, composers differed in whether they expected the instruments to transpose down a fifth or up a fourth.
|
|
The Baptism of Christ, oil on oak, 59.5 × 77 cm, Kunsthistorisches Museum, Vienna Landscape with Charon Crossing the Styx, oil on panel, 64 × 103 cm (25.2 × 40.6 in), Prado Museum, Madrid Joachim Patinir, also called Patenier (c. 1480 – 5 October 1524), was a Flemish Renaissance painter of history and landscape subjects. He was Flemish, from the area of modern Wallonia, Les rochers par lesquels l'art gothique suggère conventionnellement un site sauvage et désertique, sont présents. Comme d'aucuns l'ont remarqué, ces pics rocheux qui vont devenir chez Patinier, indissociables de l'évocation d'un paysage ressemblent à ceux qu'il a pu voir dans la région dinantaise [...] Mais il va de soi que les paysages représentés ne sont jamais dans leur ensemble la transposition de sites existants.
|
|
Lastly, some dsDNA viruses are replicated as part of a process called replicative transposition whereby a viral genome in a host cell's DNA is replicated to another part of a host genome. dsDNA viruses can be subdivided between those that replicate in the nucleus, and as such are relatively dependent on host cell machinery for transcription and replication, and those that replicate in the cytoplasm, in which case they have evolved or acquired their own means of executing transcription and replication.Cann 2015, pp. 122–127 dsDNA viruses are also commonly divided between tailed dsDNA viruses, referring to members of the realm Duplodnaviria, usually the tailed bacteriophages of the order Caudovirales, and tailless or non-tailed dsDNA viruses of the realm Varidnaviria.
|
|
While the original version for oboe had been lost before Alfred Einstein wrote Mozart: His Character, His Work, the oboe origin of the flute concerto was suspected then, in part because of references in letters to a now-missing oboe concerto, as Einstein wrote, and of similar details in the orchestral string lines which suggested a transposition was used. Also, Einstein noted the two scores in D Major and C Major of the K. 314 Concerto in the Library of the Gesellschaft der Musikfreunde in Vienna, which led to the belief that the oboe concerto was the origin of the flute concerto. The orchestra parts of the composition and solo oboe part in C were rediscovered by Bernhard Paumgartner in Salzburg, in 1920.
|
|
Based on studies using EP receptor agonists and receptor antagonists, EP2 in mice and, at least in lambs, EP3 may play minor parts in maintaining patency of the ductus. These studies also appear relevant to humans: nonsteroidal anti-inflammatory drugs, particularly indomethacin, are used to reduce prostaglandin production and thereby close the ductus in neonates, infants, and older patients with Patent ductus arteriosus; furthermore, prostaglandins or their analogs are used to keep the ductus open in neonates with congenital heart defects such as Transposition of the great arteries until corrective surgery can be performed (see Ductus arteriosis#Patent Ductus arteriosis). To allow further studies of EP4 function, colonies obtained by cross-breeding the 5% of mice surviving EP4 deletion are used.
|
|
Leon-Portilla suggests, "That there is in [the Nican Mopohua] an exposition of key ideas in Christian thinking, wrapped up in the language and form conceived from the world of the Nahua. It is without a doubt that this narrative seeks to demonstrate who God and the Virgin Mary are and that their relations are of kindness and protection for human beings." The emphasis on the beauty of a miraculous event as given by the Nican Mopohua can be contrasted with the account of Sánchez, which focuses primarily on the agreements between Indian accounts of the apparition and Biblical prophecy, most notably and . Because the apparition, and the purportedly miraculous transposition of the Virgin's image onto Diego's tilma ("mantle") of ayatl, i. e.
|
|
Producer Morris Gest asked d'Antalffy to compose music for Hofmannstahl's play, Everyman. His stay in the U.S. was lengthened by an invitation to teach from Union Theological Seminary in New York, and shortly afterwards his Academy of Music contract expired. D'Antalffy taught freshmen composition, counterpoint, music-reading, transposition and orchestration from 1927 to 1929 at the seminary's new sacred-music school, which existed until 1973. D'Antalffy at the Roxy Theatre organ in New York The Miracle company offered him work again at the beginning of 1929; Morris Gest was looking for a composer and conductor for a new production, The Freiburg Passion Play, directed by David Belasco (Gest's father-in-law, who had staged John Luther Long's short story "Madame Butterfly").
|
|
In addition, duplication after insertion contributes to NUMT diversity. NUMTs have no self-replicating mechanism or transposition mechanism; therefore, NUMT duplication is expected to occur in tandem or to involve larger segmental duplication at rates representative of the rest of the genome. Evidence for NUMT duplications that are not in proximity to other NUMTs is present in many genomes and probably happens as part of segmental duplication. However, duplications of recent human-specific NUMTs as part of segmental duplication seem to be rare; in humans, only a few NUMTs are found to have overlap with segmental duplication, and those NUMTs were found in only one of the copies while missing from the others, clearly demonstrating that the NUMTs were inserted subsequent to the duplication events.
|
|
The work of Al-Qalqashandi (1355–1418), based on the earlier work of Ibn al-Durayhim (1312–1359), contained the first published discussion of the substitution and transposition of ciphers, as well as the first description of a polyalphabetic cipher, in which each plaintext letter is assigned more than one substitute. However, it has been claimed that polyalphabetic ciphers may have been developed by the Arab cryptologist Al Kindi (801–873) centuries earlier. The Alberti cipher by Leon Battista Alberti around 1467 was an early polyalphabetic cipher. Alberti used a mixed alphabet to encrypt a message, but whenever he wanted to, he would switch to a different alphabet, indicating that he had done so by including an uppercase letter or a number in the cryptogram.
|
|
Structural features of SB transposase. The 360-amino acid polypeptide has three major subdomains: the amino-terminal DNA-recognition domain that is responsible for binding to the DR sequences in the mirrored IR/DR sequences of the transposon, a nuclear localization sequence (NLS), and a DDE domain that catalyzes the cut-and-paste set of reactions that comprise transposition. The DNA-recognition domain has two paired box sequences that can bind to DNA and are related to various motifs found on some transcription factors; the two paired boxes are labeled PAI and RED, both having the helix- turn-helix motif common for DNA-binding domains. The catalytic domain has the hallmark DDE (sometimes DDD) amino acids that are found in many transposase and recombinase enzymes.
|
|
The French Overture had previously been written down in C minor; for the publication of 1735 Bach transposed it to B minor and made slight changes to the musical text, for example in the rhythms of the first movement. The reason for the transposition is not known: one speculation is that the aim was to increase the contrast between the two works. F major is a "flat" key and B minor is a "sharp" key, and the keynotes are related by a tritone, which is the most distant modulation. Another possible motivation is that out of the eight German note names A, B (B), C, D, E, F, G, H (B), six had already been used as keynotes in the Partitas, thus only F and H remained.
|
|
Since instruments pitched in A were not available to play music that had already been written, bass clarinets produced after 1900 were equipped with the low E extension key to allow easy transposition of such parts. Until the last half of the 20th century, no new bass clarinets pitched in A were produced. For a brief period starting in the late 1970s, a bass clarinet with Boehm style keywork and pitched in A (and keyed to low E, even though the original parts seldom descend below written low E) was again produced by Selmer Paris. While perfectly functional, such instruments were both expensive and a significant physical burden to the player, who would have to carry two heavy bass clarinets to rehearsals and performances.
|
|
The principal 12-tone row for Threni is D-G-G-A-C-A-D-B-E-C-F-F. Stravinsky makes considerable use of the tonal – even diatonic – possibilities of this row. However, Stravinsky does not really use twelve-tone technique in depth in this work, relying on free transposition and combination, selection, and repetition, so that the character of the music is actually not very different from his earlier works: the beginning of "Sensus spei", for example (especially the many repeated notes in the alto solo, and the repeated response from the chorus), recalls Renard and Les noces, and the two short passages for strings and chorus near the beginning setting the Hebrew letters caph and res are reminiscent of places in Orpheus (1948).
|
|
Because it is a Directive, it allows Member States certain flexibility in transposition of national rules. The status of the implementation of the new Directive in the EU is described by the EC General Environment Directorate. Purposes of this Directive are to provide scope (via Articles 1 & 3), harmonise the current EU understanding of what defines an animal (Article 1.3), map resources, identify competent people and authorities (Articles 47.5 & 48), establish a common framework, and promote collaboration of the Member States with the EC to promote animal welfare in the EU as a European value in Article 13 of the Treaty of the Functioning of the EU (TFEU). Animal welfare is not an EU policy area per se as it is for agriculture, fisheries, research, etc.
|
|
The upturned face in the bushes A sample of blue paint taken from the right edge in 1973 was re-examined by performing analysis such as scanning electron microscopy (SEM) coupled to the energy dispersive X-ray spectroscopy (EDX), which in connection with optical microscopy revealed the following structure and composition. From bottom to top: # Canvas (from transposition); # Oily lead white (adhesive); # Thick oily layer with azurite (repaint); # Chalk ground; # Oily lead white with scarce particles of charcoal; # Oily blue with azurite; with layers 4 to 6 being original. The presence of chalk ground under the original blue proves that this is a panel painting transposed on a canvas. The original blue layer is lead white with azurite containing a few grains of ochre and charcoal.
|
|
Fink and Mao describe balance as "the extent to which the moves are well-mixed", citing a tighter knot that comes loose less easily as its primary virtue. It is calculated by a particular formula, but can be best understood by the layman as the degree to which the L, R, and C moves are evenly distributed throughout the knotting sequence, and the extent to which the L-R or R-L pattern continues uninterrupted after non-terminal centering moves (which requires a change of winding direction from counterclockwise to clockwise, or vice versa). Each of the aesthetic knots displays these qualities. A number of knots have virtually identical variants, which differ by the transposition of L and R pairs.
|
|
The first forms of graphism that allow one to hazardly identify an animal, did not appear until around 30,000 B.C. Prehistoric art records are very numerous, and statistical processing has allowed us to unravel the general meaning of what they represented. The earliest known paintings do not represent a hunt or a family scene, but are graphic building blocks without any associated description. All these early forms therefore suggests that figurative art was directly linked with language and was, in the broadest sense, much closer to writing than to what we understand by a work of art. It was symbolic transposition, not copying of reality, that is to say that graphism did not begin start by reproducing reality in a slavishly photographic manner, but with abstraction.
|
|
In addition to music publishing, the firm published a collection of theoretical works, written by Jacques Durand and others: (Éléments d’harmonie), Ernest Guiraud (Traité pratique d'instrumentation), Vincent d'Indy (Cours de composition musicale) written in collaboration with Auguste Sérieyx, Léon Roques (Principes théoriques et pratiques de la transposition). Éditions Durand also published, under the title "Littérature musicale", a collection of monographs on composers (Louis Aubert by Louis Vuillemin, Claude Debussy by Daniel Chennevière, Paul Dukas by Gustave Samazeuilh, Gabriel Fauré by Louis Vuillemin, Vincent d'Indy by Louis Borgex, Maurice Ravel by Roland-Manuel, Roger-Ducasse by Laurent Ceillier, Albert Roussel by Louis Vuillemin, Camille Saint-Saëns by , etc.) or about particular compositions (for example Ascanio, Fervaal and Tannhaüser), and also the memoirs of publisher Jacques Durand.
|
|
Frank James Marshall, inventor of the Modern Benoni Bobby Fischer and Mikhail Tal, two pioneers of the Modern Benoni Vugar Gashimov, a leading practitioner of the Modern Benoni The Modern Benoni was invented by Frank Marshall at the New York 1927 chess tournament. He played it twice, gaining a draw against José Raúl Capablanca in the Fianchetto Variation, but losing soundly to Aron Nimzowitsch, who played the Knight's Tour. Nimzowitsch received the third special prize of the tournament for this game and labelled Marshall's opening an "unfortunate" "extravagance" in his annotations; as a result, it lay virtually abandoned for decades. However, Karel Hromádka's experiments with the Benoni Defence in the 1930s occasionally featured the moves ...e7-e6 and ...exd5, resulting in a transposition to the Modern Benoni.
|
|
Two Japanese works by Satoru Ikeda (b.1961) have taken their beginning from Traherne's "The Salutation". The first was a vocalic transposition of the English text for chamber choir, accordion, tuba and harp, in which the instruments "are symbols of Heaven, Earth, and Man" (2003).Composer's site Later the composer wrote a purely instrumental work for alto flute which was divided into three movements (Abyss, Awakening and Apparition), inspired by three stanzas from the poem (2015).A performance on YouTube Another interpretation of Traherne for full orchestra was Australian composer Nigel Butterley’s Meditations of Thomas Traherne (1968), based on five prose meditations.The Australian Broadcasting Corporation recording of 1992 on YouTube Two organ works have been inspired by Tom Denny’s Traherne windows in the Audley chapel in Hereford Cathedral (see above].
|
|
The slow introduction to the first movement, like that of the thirteenth quartet, is based on a motif that recurs throughout the late quartets and in the Große Fuge as well: the second tetrachord of the harmonic minor scale. The movement is in a modified sonata form which involves three full rotations of the expositional primary and secondary thematic material, each with a different tonal plan, in contrast to the usual sonata form which only cycles fully through this material twice (for the exposition and recapitulation). The first expositional rotation begins in the tonic and moves down a third to VI (F major) for the second key area (m. 48), while the second – following a developmental episode – is almost a direct transposition that begins in E minor (m.
|
|
Developments in modern French music were a major influence on Messiaen, particularly the music of Claude Debussy and his use of the whole-tone scale (which Messiaen called Mode 1 in his modes of limited transposition). Messiaen rarely used the whole-tone scale in his compositions because, he said, after Debussy and Dukas there was "nothing to add",Messiaen, Technique de mon langage musical but the modes he did use are all similarly symmetrical. Messiaen had a great admiration for the music of Igor Stravinsky, particularly the use of rhythm in earlier works such as The Rite of Spring, and his use of orchestral colour. He was further influenced by the orchestral brilliance of Heitor Villa-Lobos, who lived in Paris in the 1920s and gave acclaimed concerts there.
|
|
Boxed album liner notes, Virgin Records This song, plus two others chosen as the B-side in different countries, had been released the month before as three of four new songs on the compilation album Boxed. They were mixed and encoded for SQ quadraphonic sound, the only format this album was issued in, and all issues of these songs in vinyl and tape formats have the encoding, even if they only say "stereo" on the label, as do all single releases. "Argiers" is another traditional folk song, performed by Leslie Penning on recorders and Mike Oldfield on acoustic guitar and ARP string synthesiser. An unusual feature of this arrangement is that it is in a minor key, having been converted from its original major key via diatonic transposition.
|
|
Yepes' 10-string guitar tuning The instrument made it possible to transcribe works originally written for baroque lute without deleterious transposition of the bass notes. However, the main reason for the invention of this instrument was the addition of string resonators tuned to C, A#, G#, F#, which resulted in the first guitar with truly chromatic string resonance – similar to that of the piano with its sustain/pedal mechanism. After 1964, Yepes used the ten-string guitar exclusively, touring all six inhabited continents, performing in recitals as well as with the world's leading orchestras, giving an average of 130 performances each year. He recorded the Concierto de Aranjuez for the first time with the ten-string guitar in 1969 with Odón Alonso conducting the Orquesta Sinfonica R.T.V. Española.
|
|
What makes the big difference between traditional transposition based problem solving and TDS is that asking some computer if it has solved a problem follows a request-response approach, in which the computer asking the other computer has to wait for a response. In TDS, forwarding a job to another computer does not involve any waiting, because you know (by design) that the other computer will accept the job and try to solve it. This means that latency (the main cause of delays in request-response models) is not an issue, because a computer simply never waits for an answer to come back. The hardware or operating system can guarantee that the message arrives at its destination so the program does not have to worry about anything anymore after it forwards the job.
|
|
During his three years at UCSD, in La Jolla, Clynes gave a concert at Brubecker Hall, playing the Beethoven Diabelli Variations, as well as a first performance of a group of 5 songs he composed, called "Sentone Songs," employing the remarkable vocal range of Linda Vickerman who performed them. The songs, in his own avant garde style, contained many varied syllables but no known words of any language. He did studies of laughter at the brain Institute of UCLA at that time, unsuccessfully attempting to measure the electric counterpart in the brain of the moment that initiates laughter. He was the first to discover, in studying voice recognition in 1975 that a speaker's identity, though unimpeded by changes in speed (tempo), was masked by transposition of as little as a semitone in pitch.
|
|
Joseph Schillinger embraced not only contrapuntal inverse, retrograde, and retrograde-inverse—operations of matrix multiplication in Euclidean vector space—but also their rhythmic counterparts as well. Thus he could describe a variation of theme using the same pitches in same order, but employing its original time values in retrograde order. He saw the scope of this multiplicatory universe beyond simple reflection, to include transposition and rotation (possibly with projection back to source), as well as dilation which had formerly been limited in use to the time dimension (via augmentation and diminution) (). Thus he could describe another variation of theme, or even of a basic scale, by multiplying the halfstep counts between each successive pair of notes by some factor, possibly normalizing to the octave via Modulo-12 operation ().
|
|
In information theory and computer science, the Damerau–Levenshtein distance (named after Frederick J. Damerau and Vladimir I. Levenshtein.) is a string metric for measuring the edit distance between two sequences. Informally, the Damerau–Levenshtein distance between two words is the minimum number of operations (consisting of insertions, deletions or substitutions of a single character, or transposition of two adjacent characters) required to change one word into the other. The Damerau–Levenshtein distance differs from the classical Levenshtein distance by including transpositions among its allowable operations in addition to the three classical single-character edit operations (insertions, deletions and substitutions). In his seminal paper, Damerau stated that in an investigation of spelling errors for an information- retrieval system, more than 80% were a result of a single error of one of the four types.
|
|
Arterial switch operation or arterial switch, is an open heart surgical procedure used to correct dextro-transposition of the great arteries (d-TGA); its development was pioneered by Canadian cardiac surgeon William Mustard and it was named for Brazilian cardiac surgeon Adib Jatene, who was the first to use it successfully. It was the first method of d-TGA repair to be attempted, but the last to be put into regular use because of technological limitations at the time of its conception. Use of the arterial switch is historically preceded by two atrial switch methods: the Senning and Mustard procedures. This surgery may be used in combination with other procedures for treatment of certain cases of double outlet right ventricle (DORV) in which the great arteries are dextro-transposed.
|
|
Raymond Vaufrey, studying the industry of flint implements found at the foot of the engraved rocks, takes the naturalistic figures to the "Neolithic of the Capsian tradition" deriving from the Neolithic of Egypt, and places them between 4200 and 2000 B.C. The ram, which he considers domesticated, is only a transposition of the Egyptian cult of Ammon and the representations of it cannot be older than 2200 B.C. For Henri Lhote however, there is not any archaeological argument which should cause one to separate the rams, supposed to be later, from the giant hartebeest, elephants or rhinoceros. Being like them of Neolithic age, they cannot derive from the Egyptian ram, and need not on that account be considered as the ancestors of a cult of which the ram of Ammon would constitute a late sequel.
|
|
Lydecker, the "flawed antagonist" of Dark Angel is said to be a transposition of Deckard, the "flawed hero" of Blade Runner. Alec McDowell/X5-494's love interest is named Rachel, believed to be a reference to the replicant Rachael, though in Dark Angel it is McDowell and not Rachel who is bio-engineered. His flashbacks of this traumatic relationship use piano music similar to that used in Blade Runner to denote memories and a desire for former times. Alec's genetic memory enhancements enable him, with only a few hours practice, to play a detailed piano piece by Frédéric Chopin, the composer originally scripted for the scene in Blade Runner where Rachael inexplicably finds herself able to play the piano; both characters are considered to be pre- programmed by state forces to master superhuman skills.
|
|
Obviously enough, it is possible to play ...e6 to get to the Scheveningen type of pawn structure and play ...e5 afterwards, so in this sense through loss of one tempo there can be a transposition from one type of pawn structure into another. According to Andrew Soltis, after a Boleslavsky hole is created, the idea is not to keep the pawn on d6 backwards; at some stage in the game, if Black is permitted to play a ...d6–d5 pawn advance this will free his dark squared bishop, releasing the position and freeing his game. In the famous Bg5 Najdorf Sicilian, the pawn advance e5 is rarely ever played at the top level because the white knight can hop into the f5-square with good practical chances for securing an advantage.
|
|
The authenticity of the sonata as such is uncertain, though three of the movements were certainly composed by Handel, but for other instruments. It is referred to as "Halle Sonata No. 2" (in German "Hallenser Sonate Nr. 2"), following Chrysander's assumption that it was an early work, composed during Handel's boyhood in Halle, before 1703. This cannot be true for this particular sonata, however, because the first two movements are a transposition into E minor of the corresponding movements of the final version of the much-revised Sonata for oboe in C minor, HWV 366, which dates from 1711–12. The fourth movement, also, was originally a minuet in G minor for harpsichord, later printed in 1733, while the third movement is a Grave whose attribution to Handel is very doubtful.
|
|
88, n. 6. For example, the forms of the row from Requiem Canticles are as follows: P0: R0: I0: RI0: IR0: Note that IR is a transposition of RI, the pitch class between the last pitches of P and I above RI. Other compositions that include retrograde inversions in its rows include works by Tadeusz Baird and Karel Goeyvaerts. One work in particular by the latter composer, Nummer 2, employs retrograde of the recurring twelve-tone row B–F–F–E–G–A–E–D–A–B–D–C in the piano part.Herman Sabbe, Het muzikale serialisme als techniek en als denkmethode: Een onderzoek naar de logische en historische samenhang van de onderscheiden toepassingen van het seriërend beginsel in de muziek van de periode 1950–1975 (Ghent: Rijksuniversiteit te Gent, 1977): 55.
|
|
In addition Vanier has been able to perfectly recreate the visual field along the scenic tall mountains and vast (also the main protagonists of the film) and you are not limited to telling the original story, but it has enriched, taking cue to give life to his new staff and transposition, where the most interesting aspect, is due to the shots of the landscape that reveal the past of a documentary filmmaker. Félix Bossuet, the boy who plays the main role, was chosen from more than 2,400 children from the same director candidates because of a "lightning strike" as stated by Vanier. Mehdi El Glaoui, the son of Cécile Aubry, who played Sebastian in the TV series of the same name in the 1960s, has a small role in the film as André.
|
|
While Michel Debré judged its transposition to France impossible, majority elections in two rounds, introduced in 1958, led to similar outcomes, with coalitions formed before the election and remaining stable afterwards. Where ordinary law is concerned (), this election method no doubt contributes more to the stability of governments than the detail of Article 49. At the same time, one may note the effect of changing the election method in Italy in 1993, in the absence of major reform of the constitution, which remained strict monist parliamentarism, incidentally fairly close to that of the Fourth Republic. However, this election method does not always guarantee the existence of a majority, as shown by the English example in the 1920s, or else the composition of the Assemblée nationale between 1988 and 1993.
|
|
This is not only an important discovery on its own, but is also highly informative and helpful for understanding the evolutionary process and the time period different occurrence might take place. The searching for mtDNA in nuclear DNA continued until 1994 when the recent remarkable transposition of 7.9 kb of a typically 17.0-kb mitochondrial genome to a specific nuclear chromosomal position in the domestic cat was reported. This is the time that NUMT was coined to designate the large stretches of mitochondrial DNA in the genome. Up to now, the whole genomes of many eukaryotes, both vertebrate, and invertebrate, have been sequenced and NUMT was observed in the nuclear genome of various organisms, including yeast, Podospora, sea urchin, locust, honey bee, Tribolium, rat, maize, rice, and primates.
|
|
Many of the notions were first elaborated by Howard Hanson (1960) in connection with tonal music, and then mostly developed in connection with atonal music by theorists such as Allen Forte (1973), drawing on the work in twelve-tone theory of Milton Babbitt. The concepts of set theory are very general and can be applied to tonal and atonal styles in any equally tempered tuning system, and to some extent more generally than that. One branch of musical set theory deals with collections (sets and permutations) of pitches and pitch classes (pitch-class set theory), which may be ordered or unordered, and can be related by musical operations such as transposition, inversion, and complementation. The methods of musical set theory are sometimes applied to the analysis of rhythm as well.
|
|
The innovation of the 10th century was the design of neumes which were so detailed, that they kept plenty of information concerning ornaments and accents. Rebecca Maloy (2009) even assumed that the use of transposition (mentioned as "absonia" in Scolica enchiriadis) might be found behind the diastematic Aquitanian neume notation—an assumption which clearly illustrates the weak side of Adémar's notation in comparison with the letter notation invented by William of Volpiano, which came never in use outside Normandy. Until this time very complex modal structures and microtonal shifts could be notated, as Maloy demonstrated by the most complex example of written transmission: the notation of the soloistic chant genre offertory. But Western notation did never develop modal signatures and the melodic structure was directly deduced by the diastematic notation.
|
|
For example, if a man named Eduardo Fernández Garrido marries a woman named María Dolores Martínez Ruiz and they have a child named José, there are several legal options, but their child would most usually be known as José Fernández Martínez. Spanish gender equality law has allowed surname transposition since 1999, subject to the condition that every sibling must bear the same surname order recorded in the Registro Civil (civil registry), but there have been legal exceptions. Since 2013, if the parents of a child were unable to agree on the order of surnames, an official would decide which is to come first, with the paternal name being the default option. The only requirement is that every son and daughter must have the same order of the surnames, so they cannot change it separately.
|
|
As a random sequence provides the novel termination signal, this model does not require a high density of Helitrons in the genome. Indeed, in the one-ended-type fusions, the inserted fragment of donor DNA is flanked at one end (constant end) by IRR and at the other end by the CTTG or GTTC sequence present in the donor (variable end) in a way that usually results in multiple tandem insertions of the donor plasmid or capture of flanking sequence in the target site. This failure to recognize the termination signal for Helitron transposition may result in the DNA flanking the 3' end of the Helitron being transferred along with the Helitron to the donor site as well (gene capture). This may be how Helitrons have acquired additional coding sequences.
|
|
The word al-jabr presumably meant something like "restoration" or "completion" and seems to refer to the transposition of subtracted terms to the other side of an equation; the word muqabalah is said to refer to "reduction" or "balancing" – that is, the cancellation of like terms on opposite sides of the equation." he has been described as the fatherBoyer, Carl B., 1985. A History of Mathematics, p. 252\. Princeton University Press. "Diophantus sometimes is called the father of algebra, but this title more appropriately belongs to al- Khowarizmi..." , "...the Al-jabr comes closer to the elementary algebra of today than the works of either Diophantus or Brahmagupta..."S Gandz, The sources of al-Khwarizmi's algebra, Osiris, i (1936), 263–277,"Al-Khwarizmi's algebra is regarded as the foundation and cornerstone of the sciences.
|
|
In mathematics, the Robinson–Schensted–Knuth correspondence, also referred to as the RSK correspondence or RSK algorithm, is a combinatorial bijection between matrices with non-negative integer entries and pairs of semistandard Young tableaux of equal shape, whose size equals the sum of the entries of . More precisely the weight of is given by the column sums of , and the weight of by its row sums. It is a generalization of the Robinson–Schensted correspondence, in the sense that taking to be a permutation matrix, the pair will be the pair of standard tableaux associated to the permutation under the Robinson–Schensted correspondence. The Robinson–Schensted–Knuth correspondence extends many of the remarkable properties of the Robinson–Schensted correspondence, notably its symmetry: transposition of the matrix results in interchange of the tableaux .
|
|
With the emergence of electronic commerce in the 2000s, some traditional sheet publishers, as well as new entrants, developed online retailer websites to offer sheet music in an electronic manner. The first to offer the service online was Sheet Music Direct (1997) but quickly followed by MusicNotes and Sheet Music Score who were able to offer interactive features like transposition and change of instrument using scorch (Avid) technology. Newcomer Sheet Music Plus only recently (2011) entered the market, offering PDF files only. Those commercial services started as worldwide retailers with a large base of licensed sheet music and fast delivery, but progressively offered digital print, ranging from PDF-files to more dynamic offerings such as Scorch technology (Avid) which allowed for midi accompaniment, and on-the- fly change of keys and instruments.
|
|
In The American Scene (1905), Henry James alluded to the stereotype in a description of the Jewish slums in New York City's Lower East Side by comparing Jews to a "sallow aquarium [with] innumerable fish, of over-developed proboscis".. The Jewish nose stereotype was a common motif in the work of Thomas Mann, who described it as "too flat, fleshy, down-pressed". In his 1909 novel Königliche Hoheit (Royal Highness), for example, Mann invents a Jewish doctor, Sammet, whose nose is described as giving away his origins, being "too broad at the bottom".'Seine Nase, zu flach auf den Schnurrbart abfallend, deutete auf seine Herkunft hin'. Cited Yahye Elsaghe ‘German Film Adaptations of Jewish Characters in Thomass Mann,’ in Christiane Schönfeld, Hermann Rasche, Processes of Transposition: German Literature and Film, Rodopi, 2007 pp. 133ff.
|
|
The study further cautioned that the true incidence of both errors and resulting adverse events would be much higher than can be presently measured since the research results were based solely on errors that were actually detected. To determine an estimate for the rate of occult Specimen Provenance Complication occurrence, researchers at Washington University School of Medicine conducted prospective analysis of approximately 13,000 prostate biopsies performed as part of routine clinical practice. Published in the American Journal of Clinical Pathology, this study classified biopsy misidentification errors into two segments: a complete transposition between patients (Type 1) and contamination of a patient’s tissue with one or more unrelated patients (Type 2). The frequency of occult Type 1 and Type 2 errors was found to be 0.26% and 0.67% respectively, or a combined error rate of 0.93%.
|
|
The means of traveling through timelines is a flying saucer-shaped "conveyor"The conveyors of Lord Kalvan of Otherwhen are described as a "cross- time flying saucer" using the Ghaldron-Hesthor field generator, which was developed via a fortuitous fusion of attempts to develop faster than light space travel with ones attempting to explain certain psychic phenomena. Conveyors are fixed in place, which means that as they travel through timelines, they may end up inside nuclear reactors or other hazards or be caught in warfare (a common activity on at least one timeline in nearly every trip, Paratimers note). Weakening of the transposition field is a concern of Paratimers. Because there are so many timelines and many conveyors, it is possible for two conveyors to "cross" each other and end up with mutually weakened fields.
|
|
Activator (Ac)/ Dissociation (Ds) transposable elements were discovered by Barbara McClintock when she was studying the maize genomic composition of the short arm of chromosome 9. She noticed that when chromosome 9 had been exposed to drastic structural modifications, the progeny had changes such as multiple copies of the short arm or lacking one or more of its parts, as well as other changes. She believed that these changes were due to transposition of “mutable loci” into the genome and that these spontaneous translocations were not random due to where the breaks occurred and where they fused. Ac/Ds elements have been observed to insert into gene rich regions of the maize genome, they alter the regulation of gene expression and may create unstable insertion alleles, stable derivatives, or excision alleles due to insertion of a transposable element into a gene.
|
|
The Metropolitan Museum of Art's 2009 catalogue for its exhibition The Model as Muse: Embodying Fashion stated: > Twiggy's adolescent physique was the perfect frame for the androgynous > styles that began to emerge in the 1960s. The trend was manifested in a > number of templates: sweet A-line dresses with collars and neckties, suits > and dresses that took their details from military uniforms, or, in the case > of Yves Saint Laurent, an explicit transposition of the male tuxedo to > women. Simultaneously, under the rubric of "unisex", designs that were > minimalistic, including Nehru suits and space-agey jumpsuits, were proposed > by designers such as Pierre Cardin and Andre Courreges, and, most famously > in the United States, by Rudi Gernreich. Twiggy has been photographed by such noted photographers as Cecil Beaton, Richard Avedon, Melvin Sokolsky, Ronald Traeger, Bert Stern, Norman Parkinson, Annie Leibovitz and Steven Meisel.
|
|
Tuning configurations may change depending on the player's style: a player playing as a lead instrument will choose an overall higher pitch tuning, with more separation or overlap between the melody and bass courses. The stringing/tuning configuration of the Chapman Stick is advantageous to the player who wishes to play large, fully voiced chords with close inner-note relationships. In contrast to a standard guitar, where one tends to "run out of options" within a particular fingering, the Stick tuning results in up to four or even five octaves of note choices under each hand's fretting position. The classic tuning shows another advantage as well: The regular tunings in fourths and fifths remain consistent in each of the two parts of the instrument; regular tunings facilitate learning by beginners, as well as transposition and improvisation by advanced players.
|
|
OpenDocument v1.2 includes additional accessibility features, RDF-based metadata, a spreadsheet formula specification based on OpenFormula, support for digital signatures and some features suggested by the public. OpenDocument 1.2 consists of three parts: Part 1: OpenDocument Schema, Part 2: Recalculated Formula (OpenFormula) Format and Part 3: Packages. It was approved as an OASIS Committee Specification on 17 March 2011 and as an OASIS Standard on 29 September 2011.OASIS office message: Ballot for CS approval of ODF Version 1.2 has passed In October 2011, the OASIS ODF Technical Committee expected to "start the process of submitting ODF 1.2 to ISO/IEC JTC 1 soon". In May 2012, the ISO/IEC JTC 1/SC 34/WG 6 members reported that "after some delay, the process of preparing ODF 1.2 for submission to JTC 1 for PAS transposition is now in progress".
|
|
Schutte administered a thorough theoretical grounding to her pupils and used Théorie de la Musique by A. Danhauser as a framework, supplemented by other intervallic, scalar and harmonic studies. Pupils were also trained in the European tradition of fixed-do Solfège (still used at The Juilliard School and at the Curtis Institute) for application in sight-singing and transposition at sight. The principles of the Russian school of technique as received from the Lhévinnes was taught, from the most fundamental posture, shape and movements of the hands, fingers and wrist, to the most advanced aspects using a systematic review of mechanical exercises (Schmitt, Isidor Philipp, Theodor Kullak, Hermann Berens, Ignaz Moscheles), and études (Carl Czerny, Cramer, Muzio Clementi, Chopin and others). Repertoire and principles of interpretation were built about the foursome of J.S. Bach, Classical sonatas, Romantic literature, and 20th century works.
|
|
Genome sequences indicate that the Olduvai protein domain first appears as part of the myomegalin gene (PDE4DIP) on chromosome 1q36 in mammals at least 200 million years ago. Myomegalin is a paralog (duplicated relative) of CDK5RAP2, a centrosomal protein involved in the cell cycle, of neurons especially, that lacks Olduvai sequences but, when mutated, has been implicated in microcephaly. Orthologs of myomegalin can be seen in vertebrates as far back as bony fish, around 450 million years ago, however, the Olduvai domain is not clearly seen until the emergence of mammals. The first Olduvai domain located outside of myomegalin is seen approximately 100–150 million years ago, when the domain was included in a duplication and transposition event which created a new gene, NBPF1, which would eventually later give rise to a family of duplicated NBPF genes.
|
|
1: Lexicographic ordering; 2: Steinhaus–Johnson–Trotter algorithm; 3: Heap's algorithm; 4: Ehrlich's star-transposition algorithm (see ): in each step, the first entry of the permutation is exchanged with a later entry; 5: Zaks' prefix reversal algorithm: in each step, a prefix of the current permutation is reversed to obtain the next permutation; 6: Sawada-Williams' algorithm: each permutation differs from the previous one either by a cyclic left-shift by one position, or an exchange of the first two entries; 7: Corbett's algorithm: each permutation differs from the previous one by a cyclic left- shift of some prefix by one position; 8: Single-track ordering: each column is a cyclic shift of the other columns; 9: Single-track Gray code: each column is a cyclic shift of the other columns, plus any two consecutive permutations differ only in one or two transpositions.
|
|
ADIF is the result of Railway Sector Act, which arises from the transposition of European Directives. It requires that large European national railway independently manage the infrastructure and trains on it. The ultimate goal was to allow any other rail operator operating on the network to do so on equal terms with the operator, in this case, Renfe, promoting free competition. The RENFE division became effective on 1 January 2005 between the two companies: #Renfe Operadora (newly created entity): Owner of trains and responsible for its circulation, which works in competition with other railway companies #ADIF (Legal successor of RENFE): Owner of infrastructure and responsible for its management, which provides its services to any rail operator who requests A similar operation was conducted on 31 December 2012 with FEVE, a company that managed the narrow gauge railways.
|
|
The Musica enchiriadis was also the only Latin treatise which documented a second tone system beside the systema teleion, but it does not explain at all, how these both systems worked together in practice. The Hagiopolites did neither explain it nor did it mention any tone system nor the metabole kata tonon, but this was probably, because the hymn reform of Jerusalem was mainly concerned with simple models exemplified by heirmoi or troparia. Greek protopsaltes used the transposition only in very few compositions of the sticherarion, for instance the compositions passing through all the modes of the Octoechos,Heinrich Husmann (1970) described them and they were already transcribed into Coislin notation in the earliest sticheraria which can be dated back to the 12th century. or certain melismatic elaborations of troparia in the psaltic style, the soloistic style of the Constantinopolitan cathedral rite.
|
|
It is sometimes said that its name is derived from legends pertaining to King Arthur, such as the reference in Y Gododdin. Some support for this may be provided by several other hilltop and mountaintop features in Britain which bear the same or similar names, such as the peak of Ben Arthur (The Cobbler) in the western highlands, sometimes known as Arthur's Seat, and Arthur's Chair on the ridge called Stone Arthur in the English Lake District. There is no traditional Scottish Gaelic name for Arthur's Seat in Edinburgh, but William Maitland proposed that the name was a corruption of Àrd-na-Said, implying the "Height of Arrows", which over the years became Arthur's Seat (perhaps via "Archer's Seat"). Alternatively, John Milne's proposed etymology of Àrd-thir Suidhe meaning "place on high ground" uncomfortably requires the transposition of the name elements.
|
|
In listing ficarii or inuii (for inui, plural of Inuus) with the Anglo- Saxon gloss wudewasan (woodwose), following (due to a probable transposition error with the previous Satyri or fauni, glossed as unfæle men), Wright notes that the entry "furnishes us with a very curious and instructive example of the long preservation of words connected with popular superstitions": "Supplement to Alfric's Vocabulary of the Tenth or Eleventh Century," p. 188 online. Among the interests evidenced in this particular vocabulary are "a few words connected with the ancient religious belief" (p. 168). Discursive treatment of this group of beings, including the dusii, with remarks on the meaning of "fig," in Richard Payne Knight's "On the Worship of the Generative Powers During the Middle Ages of Western Europe" in Two Essays on the Worship of Priapus (London, 1865), pp.
|
|
Diffusion Diffusion means that if we change a single bit of the plaintext, then (statistically) half of the bits in the ciphertext should change, and similarly, if we change one bit of the ciphertext, then approximately one half of the plaintext bits should change. Since a bit can have only two states, when they are all re-evaluated and changed from one seemingly random position to another, half of the bits will have changed state. The idea of diffusion is to hide the relationship between the ciphertext and the plain text. This will make it hard for an attacker who tries to find out the plain text and it increases the redundancy of plain text by spreading it across the rows and columns; it is achieved through transposition of algorithm and it is used by block ciphers only.
|
|
Phase A of the plan would have launched a 'wet workshop' S-IVB and a standard Block II Apollo CSM into orbit on a Saturn V. The crew would separate the CSM from the S-IVB by blowing off the SLA panels, then perform a Transposition and Docking maneuver similar to that conducted on the lunar flights, in order to dock with the docking module attached to the front of the S-IVB. Optionally they could then use the S-IVB engine to launch them into a high orbit before they vented any remaining propellant into space and entered the S-IVB fuel tank to conduct experiments for a few weeks. After evaluating the use of the S-IVB as a long-term habitat for astronauts, they would separate the CSM from the S-IVB and return to Earth.
|
|
The descendants of William Fairfax continued to assert back claims against the estates of Lord Fairfax, which had been rendered by William Fairfax prior to 1757. In order to absolve himself of these back claims, Denny Fairfax renounced his appointments of Martin and Jones, and instead appointed Bryan Fairfax, 8th Lord Fairfax of Cameron as the sole steward of the proprietary in an official transposition in London on September 21, 1784. Because Denny Fairfax was a British subject residing in England, he had no legal rights under American jurisdiction; thus, he and his British relatives were considered "alien enemies" and his landholdings were confiscated under escheat laws. In 1785, the Virginia General Assembly ordered that all records, books, and documents pertaining to the proprietary's lands be confiscated by the state of Virginia and removed to the Virginia State Land Registrar's Office in Richmond.
|
|
The Austrian theorist Johann Baptist Samber (1707), meanwhile, gave as his rule to transpose downward by a fourth if the bass is notated in F3, but a fifth if it is notated in C4. The practice of transposition does not seem to have been universal; Thomas Morley implies that music ought to be sung in the key in which it was written while Michael Praetorius indicates the choice to transpose or not depends on the ensemble. Banchieri (1609) indicates that instrumental music should be read at pitch, in the higher clefs, while singers use the chiavi naturali at the written pitch. This set of higher clefs was only given the name chiavette in the eighteenth century, by Girolamo Chiti (1718), by which time the practice itself had largely disappeared; by the mid- seventeenth century, most composers had adopted more flexible notational practices.
|
|
For square matrices with entries in a non-commutative ring, there are various difficulties in defining determinants analogously to that for commutative rings. A meaning can be given to the Leibniz formula provided that the order for the product is specified, and similarly for other definitions of the determinant, but non-commutativity then leads to the loss of many fundamental properties of the determinant, such as the multiplicative property or the fact that the determinant is unchanged under transposition of the matrix. Over non-commutative rings, there is no reasonable notion of a multilinear form (existence of a nonzero with a regular element of R as value on some pair of arguments implies that R is commutative). Nevertheless, various notions of non-commutative determinant have been formulated that preserve some of the properties of determinants, notably quasideterminants and the Dieudonné determinant.
|
|
Following transposition and docking, the crew noticed the exterior surface of the lunar module was giving off particles from a spot where the LM's skin appeared torn or shredded; at one point, Duke estimated they were seeing about five to ten particles per second. The crew entered the lunar module through the docking tunnel connecting it with the command module to inspect its systems, at which time they did not spot any major issues. Once on course towards the Moon, the crew put the spacecraft into a rotisserie "barbecue" mode in which the craft rotated along its long axis three times per hour to ensure even heat distribution about the spacecraft from the Sun. After further preparing the craft for the voyage, the crew began the first sleep period of the mission just under 15 hours after launch.
|
|
The first in the series, "The Experimental Research Center of the Territory" (2008) is in continuity with a lifelong exploration of the notion of territory beginning with "The Artistic M2" (1977) and continuing through "The Territory of the M2" (1980, a simulated independent state on the grounds of Forest's property in the town of Anserville, near Paris) and "The Networked Territory" (1996, a hypertext work that Forest considers the Territory's transposition into cyberspace). Each Second Life work is adapted somewhat to the physical location in which it is presented (Nice, Sao Paulo, New York, Beirut, etc.). In addition to staging debates and discussions at a think tank for avatars and offering public access to a mystical disintegrator of trash, some of the Second Life performances center on the philosophical musings and personal confessions of Forest's digital alter ego, Ego Cyberstar.
|
|
In addition, in Croatia the issue of concentration is regulated by the Law on the Protection of Market Competition, a general law that in Article 18 forbids any kind of concentration that can endanger market competition. A specific provision in the Media Act limits ownership concentration with regard to press outlets only: it is limited to media outlets whose market share in terms of total sold copies exceeds 40 percent. National and regional licenses prevent licenses from having more than 30 percent share in similar media or in local daily newspapers in the broadcasting area. The Law on Electronic Media, passed in 2003 and amended in 2007, 2008 and in 2009, to complete the transposition of the EU Audiovisual Directive allows cross-media ownership of national electronic media, if the ownership does not exceed 25 percent.
|
|
During the Middle Ages, Renaissance, and Baroque—that is, through the early 18th century—any kind of imitative musical counterpoints were called fugues, with the strict imitation now known as canon qualified as fuga ligata, meaning "fettered fugue" (; ; ). Only in the 16th century did the word "canon" begin to be used to describe the strict, imitative texture created by such a procedure . The word is derived from the Greek "κανών", Latinised as canon, which means "law" or "norm", and may be related to 8th century Byzantine hymns, or canons, like the Great Canon by St. Andrew of Crete. In contrapuntal usage, the word refers to the "rule" explaining the number of parts, places of entry, transposition, and so on, according to which one or more additional parts may be derived from a single written melodic line.
|
|
It is fairly common for Russian guitar players > (particularly those accompanying themselves singing, such as bards) to bring > the tuning up or down several steps as desired, either to accommodate the > voice or for varying string tension. Vladimir Vysotsky often tuned down a > whole step, sometimes even a step and a half to an open E. Also, variations > in the open G tuning were fairly common, e.g., Bulat Okudzhava would use the > tuning of to play songs written in C, while bard Sergey Nikitin tuned his > guitar to an open G minor: . There are more than 1,000 different chords > possible for the standard open G tuning and plenty of different schools for > left hand (vibrato) and right hand (fingerstyle playing) and enormous > classical music musical transposition archives and music composed for > Russian 7-string guitar for 200 years in Russia.
|
|
'" To pay attention to the course of the sun and to the revolution of the planets is a religious injunction; for such is the import of the words,Deuteronomy 4:6 "This is your wisdom and your understanding in the sight of the nations".Shabbat 75a Despite the general importance and religious significance attached to astronomy in the Holy Land, no notable developments in astronomy happened there. The starry heavens of the land of Israel interested the Jews as creations of God and as means to determine the holidays, but for a better knowledge of them the Jews were undoubtedly indebted to the Babylonians and their Hellenic pupils, as evidenced by the foreign term gematria used to designate the computation of the calendar. Probably this word represents a transposition of the Greek γραμματεία meaning "arithmetic, mathematics.
|
|
Cryopreserving ovarian tissue strips Options for women to have children after cancer have increased significantly in recent years. Women should be counseled on established options such as embryo banking in which hormonal stimulation causes the production of multiple eggs, which are removed, fertilized by sperm, and frozen for future use, and egg banking in which hormonal stimulation causes the production of multiple eggs, which are removed and frozen for storage and future use, and ovarian transposition (surgically moving the ovaries to a different part of the body) and ovarian shielding (physically shielding the ovaries from the area receiving radiation). Experimental techniques include ovarian tissue banking in which an ovary is surgically removed and frozen to be transplanted back into the woman when she is ready to have children. Scientists are also working on ways to mature undeveloped eggs from this ovarian tissue.
|
|
Hypolocrian mode on B The Hypolocrian mode is an almost entirely theoretical mode, introduced into chant theory in the 19th century by the editors of the Pustet-Ratisbon, Mechlin, and Rheims-Cambrai Office-Books, who designated it mode 12. It is the plagal counterpart to the authentic Locrian mode, mode 11 in that system of numbering, in which the Ionian and Hypoionian become modes 13 and 14 . The ambitus of the mode lies between F and the F an octave higher, divided at the final, B. Its reciting tone (or tenor), is E, and its mediant is D. It has two participants, G and C. Although a few plainchant melodies, as well as polyphonic compositions, have been attributed to this mode by some writers, it will generally be found that they are really derived, by transposition, from some other tonality .
|
|
The symphony is in three movements in the traditional fast-slow-fast pattern. The second and third movements are performed without a break: #Allegro—Impetuoso—tranquillo #Con movimento adagio—doppio movimento quasi allegretto #Allegro vivace Although a single twelve-tone row forms the basis of the entire symphony, a second, related row is also used in the first movement only . This main row is: C, C, G, F, G, A / D, B, D, E, B F The two hexachords of this row are combinatorial by inversion at T3 (transposition by a minor third) . The secondary row in the first movement is: A–G–F–F–C–A / B–D–B–E–E–C However, Sessions's free treatment of the combinatorial hexachords and of various trichord (particularly 014, 016, and 026) tends to displace textbook twelve-tone technique, producing a complex but coherent network of pitch-class sets .
|
|
Since the late 70s it has become apparent that the majority of non-coding DNA in large genomes finds its origin in the selfish amplification of transposable elements, of which W. Ford Doolittle and Carmen Sapienza in 1980 wrote in the journal Nature: "When a given DNA, or class of DNAs, of unproven phenotypic function can be shown to have evolved a strategy (such as transposition) which ensures its genomic survival, then no other explanation for its existence is necessary." The amount of junk DNA can be expected to depend on the rate of amplification of these elements and the rate at which non-functional DNA is lost.Another source is genome duplication followed by a loss of function due to redundancy. In the same issue of Nature, Leslie Orgel and Francis Crick wrote that junk DNA has "little specificity and conveys little or no selective advantage to the organism".
|
|